The presence of XX versus XY sex chromosomes is associated with increased HDL cholesterol levels in the mouse

MATERIALS AND METHODS Mice Four Core Genotypes (FCG) C57BL/6 mice were bred and genotyped as described previously. Briefly, XX female mice were mated with XY–(Sry+) male mice to generate XX, XX(Sry+), XY–, and XY–(Sry+) offspring, and genotyping was performed by PCR to detect presence of the Sry transgene (forward: AGCCCTACAGCCACATGATA; reverse: GTCTTGCCTGTATGTGATGG) and Y-chromosome–specific sequence (forward: CTGGAGCTCTACAGTGATGA; reverse: CAGTTACCAATCAACACATCAC). Where indicated, gonadectomy was performed at 75 days of age, as previously described. XY* mice, backcrossed to strain C57BL/6EiJ for >10 generations, were bred as described previously. XY* males have the Y* chromosome that recombines aberrantly with the X chromosome. Mating XY* males with XX females generates the three genotypes included in this study: XX, XXY*, and XY*, which are similar to XX, XXY, and XY mice, respectively. Progeny of XY* mice were gonadectomized at 75 days of age, as previously described. Gonadal males and females were housed in separate cages and maintained at 23°C with a 12:12 hour light:dark cycle. All mice were initially fed Purina mouse chow diet containing 5% fat (Purina 5001; PMI Nutrition International, St. Louis, MO). Where specified, mice were fed a chow diet until age 3.5 months of age (4 weeks after gonadectomy), and then fed an atherogenic diet for 16 weeks (diet TG90221 containing 7.5% cocoa butter, 1.25% cholesterol, 0.5% sodium cholate; Teklad Research Diets, Madison, WI). For all studies, blood samples were obtained at 7.5 months of age (FCG mice) or 14 months of age (XY* mice) after fasting 0800–1300. Plasma was collected after centrifugation of whole blood at 3,400 x g for 10 minutes at 4°C. Mouse studies were conducted in accordance with and approved by the Institutional Animal Research Committee of the University of California, Los Angeles.