Repeat Expansions of RFC1 in Refractory Chronic Cough

FOR EDITORIAL COMMENT, SEE PAGE 746Over the last decade, the concept of cough hypersensitivity syndrome (CHS) has emerged in adults.1Morice A.H. Millqvist E. Belvisi M.G. et al.Expert opinion on the cough hypersensitivity syndrome in respiratory medicine.Eur Respir J. 2014; 44: 1132-1148Crossref PubMed Scopus (234) Google Scholar CHS is defined as a clinical syndrome characterized by troublesome coughing, often triggered by low levels of thermal, mechanical, or chemical exposure. A neurologic dysfunction is now appreciated as the main mechanism of chronic cough and also of refractory chronic cough (RCC). Patients with RCC experience not only a reduction in quality of life but also a lack of explanation regarding the origin of their cough.2Young E.C. Smith J.A. Quality of life in patients with chronic cough.Ther Adv Respir Disease. 2010; 4: 49-55Crossref PubMed Scopus (62) Google Scholar FOR EDITORIAL COMMENT, SEE PAGE 746 Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome (CANVAS) is a rare autosomal recessive neurologic disorder that appears in the sixth decade with sensory symptoms and/or ataxia.3Traschütz A. Cortese A. Reich S. et al.Natural history, phenotypic spectrum, and discriminative features of multisystemic RFC1 disease.Neurology. 2021; 96: e1369-e1382Crossref PubMed Scopus (57) Google Scholar A biallelic intronic pentanucleotide (mostly AAGGG) repeat expansion (RE) in the replication factor C subunit 1 (RFC1) gene has been identified in patients with CANVAS.4Cortese A. Simone R. Sullivan R. et al.Biallelic expansion of an intronic repeat in RFC1 is a common cause of late-onset ataxia.Nat Genet. 2019; 51: 649-658Crossref PubMed Scopus (227) Google Scholar Notably, the first case series of patients with CANVAS highlighted a high prevalence of chronic cough.4Cortese A. Simone R. Sullivan R. et al.Biallelic expansion of an intronic repeat in RFC1 is a common cause of late-onset ataxia.Nat Genet. 2019; 51: 649-658Crossref PubMed Scopus (227) Google Scholar Moreover, RFC1 expansion has been found in patients with chronic cough and ataxia.3Traschütz A. Cortese A. Reich S. et al.Natural history, phenotypic spectrum, and discriminative features of multisystemic RFC1 disease.Neurology. 2021; 96: e1369-e1382Crossref PubMed Scopus (57) Google Scholar The aim of the current study was to describe the prevalence of RE-RFC1 in patients with RCC as well as the cough characteristics of these patients. A prospective study was conducted from December 1, 2021, to June 30, 2022. The selection of patients with RCC was based on American Thoracic Society and European Respiratory Society guidelines.5Morice A.H. Millqvist E. Bieksiene K. et al.ERS guidelines on the diagnosis and treatment of chronic cough in adults and children.Eur Respir J. 2020; 551901136Crossref Scopus (307) Google Scholar,6Irwin R.S. French C.L. Chang A.B. Altman K.W. Classification of cough as a symptom in adults and management algorithms: CHEST Guideline and Expert Panel Report.Chest. 2018; 153: 196-209Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar Inclusion criteria were as follows: (1) chronic cough with cough duration of > 12 months; (2) visual analog scale score ≥ 4; (3) RCC, defined as chronic cough with no identified causes (despite an ear, nose, and throat assessment; lung function tests; and other tests determined by the investigators) or persistent cough despite an optimal treatment of the cough causes; (4) normal chest CT scan; and (5) no improvement of cough despite 12 weeks of inhaled steroid treatment. Exclusion criteria were current smoking or smoking cessation for < 1 year, chronic respiratory diseases apart from asthma, and known CANVAS. This study was conducted in accordance with French ethics requirements (RnIPH 2021-145) and the National Commission for Data Protection and Liberties (CNIL number 2206723 v 0). Patients were asked to self-complete a 100-mm visual analog scale for cough severity, the Leicester Cough Questionnaire, the Hull Airway Reflux Questionnaire, and the Hospital Anxiety and Depression Scale. Genomic DNA was extracted by using standard methods (Illustra DNA Extraction kit BACC3, GEHC) from peripheral blood samples collected in ethylenediaminetetraacetic acid tubes. To identify RE-RFC1, long-polymerase chain reaction flanking the repeat was performed by using the initially described protocol,4Cortese A. Simone R. Sullivan R. et al.Biallelic expansion of an intronic repeat in RFC1 is a common cause of late-onset ataxia.Nat Genet. 2019; 51: 649-658Crossref PubMed Scopus (227) Google Scholar with slight modifications (forward primer: 5′TACTCCAGCTACACCGTTGC; reverse primer: 5′AGACAGGCCAATCACTTCAG), in addition to repeat-primed polymerase chain reactions for the pathogenic AAGGG repeat and for the initially described AAAAG, AAAGG, and AAGAG repeats. Given the clinical similarities of patients with biallelic or monoallelic RE-RFC1, we pooled the two groups as an RE-RFC1 group for the analysis although monoallelic RE-RFC1 is not considered sufficient for a diagnosis of CANVAS. Among the 68 patients included in the final analysis, 17 (25.0%) patients presented at least one RE-RFC1, with 11 (16.2%) patients presented biallelic RE-RFC1 (Bi-RE-RFC1) and six (8.8%) presented monoallelic RE-RFC1 (Mono-RE-RFC1). There was no difference in terms of sex between patients with and without RE-RFC1 (76.5% vs 77.2%, respectively) (Table 1). However, interestingly, all patients with Mono-RE-RFC1 were female. There was no difference in terms of neuropathy between groups. None of the patients had ataxia or vestibular syndrome. Regarding cough characteristics, age of cough onset was statistically lower in patients with RE-RFC1 compared with the No-RE-RFC1 group (44.6 ± 12.4 years vs 51.2 ± 10.8 years; P = .04). The proportion of patients with “no specific time of cough during the day” was statistically higher in patients with RE-RFC1 compared with the No-RE-RFC1 group (12 [70.6%] vs 20 [35.1%]; P = .048). The proportion of patients with dust/smoke or food as triggering factors were both statistically higher in patients with RE-RFC1 compared with the No-RE-RFC1 group (25 [43.9%] vs 14 [82.4%] [P = .02] and 12 [21.1%] vs 12 [70.6] [P = .0009]). Following adjustment, no specific time of cough during the day and dust/smoke or food as a triggering factor remained strongly associated with RE-RFC1 (Table 2). Age of cough onset was inversely associated with RE-RFC1.Table 1Characteristics of RCC Patients With and With No Repeat Expansions in RFC1 and Multivariate Analysis of Variables Associated With Repeat Expansion of RFC1 Following Adjustment for Age, Sex, BMI, and Smoking StatusCharacteristicNo Repeat Expansion in RFC1 (n = 51)Repeat Expansion(s) in RFC1(n = 17)aEleven patients were homozygous and six were heterozygous for repeat expansions of RFC1.P ValueClinical characteristics Age, y64.4 ± 9.558.8 ± 12.4.056 Female44 (77.2)13 (76.5).45 BMI, kg/m225.2 ± 5.223.5 ± 3.1.20 Ex-smoker17 (29.8)6 (35.3)> .99 ComorbiditiesAsthma14 (24.6)4 (23.5)> .99GERD27 (47.4)9 (52.9)> .99Irritable bowel disease9 (15.8)3 (17.6)> .99Migraine19 (33.3)5 (29.4).77Neuropathy5 (9.8)3 (17.6).40Fibromyalgia2 (3.5)0> .99Thyroid disorder16 (31.4)2 (11.8).20Diabetes3 (5.3)2 (11.8)> .99Depression8 (14.0)1 (5.9).43Anxiety22 (38.6)3 (17.6).08 FEV1 (% of predicted values)102.0 [91.5-108.0]101.5 [89.8-116.5].22 Feno (PPB)10.0 [3.5-15.5]11.0 [6.0-18.0].27Cough characteristics Familial history of chronic cough10 (17.5)5 (29.4).50 Age of cough onset, y51.2 ± 10.844.6 ± 12.4.04 Cough duration, mo120.0 [67.5-245.0]150.0 [78.0-234.0].78 Dry cough31 (54.4)11 (64.7)> .99 Cough locationbCough location is the perception of cough origin described by the patient.Throat23 (40.4)9 (52.9).59Chest6 (10.5)1 (5.9)> .99Both18 (31.6)6 (35.3)> .99No location3 (5.3)1 (5.9)> .99 Arnold’s reflexcArnold’s reflex was assessed according to patients’ statements.12 (21.1)5 (29.4).75Right side4 (33.3)2 (40.0)> .99Left side1 (8.3)1 (20.0).52Both sides5 (41.7)1 (20.0).60Unknown side2 (16.7)1 (20.0)> .99 Time of cough during the dayNight19 (33.3)4 (23.5).38Awake at night12 (21.1)1 (5.9).16When falling asleep11 (19.3)3 (17.6)> .99Early morning14 (24.6)3 (17.6).53Afternoon19 (33.3)6 (35.3)> .99Evening18 (31.6)5 (29.4).77No specific time20 (35.1)12 (70.6).048 Triggers of coughNo1 (1.8)0…Cold41 (71.9)15 (88.2).72Position change30 (58.8)6 (35.3).10Perfume30 (58.8)10 (58.8)> .99Speaking or singing34 (59.6)14 (82.4).36Exercise24 (42.1)8 (47.1)> .99Dust/smoke25 (43.9)14 (82.4).02Drinking11 (19.3)5 (29.4).52After meal15 (24.6)6 (35.3).76Food12 (21.1)12 (70.6).0009Bending15 (26.3)8 (47.1).24Strong smell23 (40.4)9 (52.9).59Job7 (12.3)3 (17.6).70Stress23 (40.4)8 (47.1)> .99 Presence of relief factors32 (56.1)10 (58.8).78 Respiratory symptoms such as breathlessness, chest pain, and wheezing39 (68.4)13 (76.5).50 Postnasal drip31 (54.4)12 (70.6).57 Nasal obstruction20 (35.1)8 (47.1).58 Voice change26 (45.6)10 (58.8).78 Swallowing disorders12 (21.1)4 (23.5)> .99 Heartburn7 (12.3)5 (29.4).16 Regurgitation9 (15.87 (41.2).20 Urinary incontinence26 (45.6)10 (58.8).78 Nausea or vomiting19 (33.3)9 (52.9).27 Total LCQ score12.0 ± 3.411.4 ± 3.3.53Physical domain4.3 ± 1.14.0 ± 1.2.42Social domain3.8 ± 1.53.6 ± 1.3.52Psychological domain3.9 ± 1.23.8 ± 1.3.80 VAS score for assessing cough severity7.4 ± 2.07.3 ± 2.0.89 Hull Airway Reflux Questionnaire Scores27.2 ± 11.131.5 ± 10.7.18 HADSAnxiety score7.5 ± 3.37.4 ± 3.2.85Depression score6.1 ± 4.15.4 ± 4.2.56Quantitative data with a normal distribution are expressed as mean ± SD. Qualitative data are expressed as No. (%) of patients. Quantitative data with no normal distribution are expressed as median [interquartile range]. Bold font indicates statistical significance. Feno = fractional exhaled nitric oxide; GERD = gastroesophageal reflux disease; HADS = Hospital Anxiety and Depression Scale; LCQ = Leicester Cough Questionnaire; RCC = refractory chronic cough; VAS = visual analog scale.a Eleven patients were homozygous and six were heterozygous for repeat expansions of RFC1.b Cough location is the perception of cough origin described by the patient.c Arnold’s reflex was assessed according to patients’ statements. Open table in a new tab Table 2Multivariate Analysis of Variables Associated With Repeat Expansion of RFC1 Following Adjustment for Age, Sex, BMI, and Smoking StatusVariableOR95% CIFamilial history of cough1.740.43-6.61History of neuropathy2.130.36-11.44Age of cough onset0.94470.89-0.9954No specific time of cough during the day6.311.71-28.52Smoke/dust as triggering cough4.301.13-21.62Food as triggering cough6.991.88-30.29Bold font indicates statistical significance. Open table in a new tab Quantitative data with a normal distribution are expressed as mean ± SD. Qualitative data are expressed as No. (%) of patients. Quantitative data with no normal distribution are expressed as median [interquartile range]. Bold font indicates statistical significance. Feno = fractional exhaled nitric oxide; GERD = gastroesophageal reflux disease; HADS = Hospital Anxiety and Depression Scale; LCQ = Leicester Cough Questionnaire; RCC = refractory chronic cough; VAS = visual analog scale. Bold font indicates statistical significance. For the first time, we identified that one-quarter of patients with RCC present at least one RE-RFC1 (16.2% Bi-RE-RFC1 and 8.8% Mono-RE-RFC1), whereas these expansions are rare in the general population (0.7% in European subjects).4Cortese A. Simone R. Sullivan R. et al.Biallelic expansion of an intronic repeat in RFC1 is a common cause of late-onset ataxia.Nat Genet. 2019; 51: 649-658Crossref PubMed Scopus (227) Google Scholar The patients with Bi-RE-RFC1 harboring RCC are in fact patients with early CANVAS. Up to now, although neural dysfunction was highly suspected in patients with RCC, no evidence of neurologic disorders has ever been shown in these patients. The pathophysiology of RE-RFC1 in CANVAS has not been fully elucidated. However, neuropathologic examinations clearly pointed to ganglionopathy (eg, sensory neuronopathy) involving the dorsal root and V, VII, and VIII cranial nerve ganglia, with ganglionic and nerve root atrophy and loss of neuronal cells originating in the brainstem. Indeed, in a recent paper, neuropathologic examination of a patient with a peculiar form of CANVAS associated with parkinsonism showed neuronal loss in the vagal nucleus.7Huin V Coarelli G Guemy C et al.Motor neuron pathology in CANVAS due to RFC1 expansions.Brain. 2022; 145: 2121-2132Crossref PubMed Scopus (20) Google Scholar Given that the vagus nerve seems to play a key role in chronic cough,8Ryan N.M. Gibson P.G. Birring S.S. Arnold’s nerve cough reflex: evidence for chronic cough as a sensory vagal neuropathy.J Thorac Dis. 2014; 6: S748-S752PubMed Google Scholar one of the possible explanations for the high prevalence of chronic cough in CANVAS could be vagal neuronopathy. However, there is no evidence of other dysfunction in visceral reflexes in patients with CANVAS. Among the study patients with RCC with at least one RE-RFC1, we identified a large proportion (8.8%) of patients with Mono-RE-RFC1. Further data are needed to determine if only one expansion could be sufficient to induce neurologic symptoms such as chronic cough. One expanded allele in the RFC1 gene has also been found in spinocerebellar ataxia.9Aboud Syriani D. Wong D. Andani S. et al.Prevalence of RFC1-mediated spinocerebellar ataxia in a North American ataxia cohort.Neurol Genetics. 2020; 6: e440Crossref PubMed Google Scholar If Mono-RE-RFC1 is able to trigger chronic cough or other neurologic symptoms, the inheritance mode (autosomal recessive) classically described in CANVAS should then be reconsidered, at least for chronic cough. In the current study, all patients with Mono-RE-RFC1 were female. It is well established that cough reflex sensitivity increases in female subjects. Mono-RE-RFC1 in female subjects could increase the threshold of cough leading to clinical expression of cough. However, few cases harboring Mono-RE-RFC1 associated with nonsense or frameshift variations in RFC1 have been described recently.10Benkirane M. Da Cunha D. Marelli C. et al.RFC1 nonsense and frameshift variants cause CANVAS: clues for an unsolved pathophysiology.Brain. 2022; 145: 3770-3775Crossref PubMed Google Scholar Additional studies would be necessary to verify their involvement in the disease. We cannot exclude that these additional variations could be present in the Mono-RE-RFC1 patients. We also found that age of cough onset was lower in patients with RE-RFC1 compared with the No-RE-RFC1 group in accordance with a genetic origin of RCC. In studies on CANVAS, it has been established that cough may be reported by patients up to 36 years prior to the onset of neurologic symptoms.3Traschütz A. Cortese A. Reich S. et al.Natural history, phenotypic spectrum, and discriminative features of multisystemic RFC1 disease.Neurology. 2021; 96: e1369-e1382Crossref PubMed Scopus (57) Google Scholar Chronic cough seems to be the first expression of CANVAS. Notably, age of cough onset gradually increases in patients with Bi-RE-RFC1, Mono-RE-RFC1, and No-RE-RFC1 (42.6 ± 9.9, 48.4 ± 16.4, and 51.2 ± 10.8 years, respectively). Interestingly, food or dust/smoke was statistically more frequently reported as a trigger of cough in RCC patients with RE-RFC1 compared with the No-RE-RFC1 group. It is well established that C fiber-mediated cough is triggered by a range of irritant environmental chemicals. These nerve fiber types terminate in the paratrigeminal nucleus in the medulla oblongata, a dysfunctional area in CANVAS. One of the main limitations of the current study is the fact that we focused the analysis on RCC. No patients with chronic cough who respond to usual treatments were included. However, no definition of non-RCC is currently available. Moreover, a transitory placebo effect is regularly seen in patients with RCC, highlighting the difficulties in making a diagnosis of non-RCC. In the phase 3 trial on gefapixant (a P2X3 receptor antagonist), a reduction in 53% to 57% of cough frequency was observed in patients labeled as having RCC.11McGarvey L.P. Birring S.S. Morice A.H. et al.Efficacy and safety of gefapixant, a P2X(3) receptor antagonist, in refractory chronic cough and unexplained chronic cough (COUGH-1 and COUGH-2): results from two double-blind, randomised, parallel-group, placebo-controlled, phase 3 trials.Lancet. 2022; 399: 909-923Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar For these reasons, we decided to focus on RCC. To conclude, we show that RE-RFC1 occurs in as many as 25% of patients with RCC; this knowledge would strongly improve the diagnosis of these patients. Among patients with RCC, 16.2% presented Bi-RE-RFC1 associated with an early diagnosis of CANVAS and 8.8% presented Mono-RE-RFC1. Young age and food or dust/smoke as triggers are highly suggestive of RE-RFC1. Although RE-RFC1 is one missing piece of the puzzle, efforts should be made to discover the other pieces of an RCC diagnosis. As noted in the current study, neuropathy was observed in RE-RFC1-negative patients. Further studies should be performed on the link between nonrelated RFC1 neuropathy and chronic cough. The impact of RE-RFC1 on the efficacy of adenosine triphosphate receptor blockers, currently developed, should be urgently assessed. The authors have reported to CHEST the following: L. G. reports personal fees from Bayer, MSD, and Chiesi; has participated in clinical trials from Bayer and MSD; reports grants, personal fees, and nonfinancial support from AstraZeneca; and reports personal fees and nonfinancial support from GSK, Novartis, and Sanofi, outside the submitted work. B. M. has participated in clinical trials from AstraZeneca and Boehringer Ingelheim; and reports grants, personal fees, and nonfinancial support from Boehringer Ingelheim, Chiesi, GSK, and Menarini. None declared (P. C., C. M., T. V., D. B., A.-S. L., L. M.). Other contributions: We would like to thank Fondation du souffle for their support. Cough, Cough: How Much of the Symptom Resides in Your Genes?CHESTVol. 163Issue 4PreviewCoined in the 1800s by polymath Francis Galton,1 the ways in which “nature vs nurture” manifests in biological processes has been a recurrent question for centuries. As we describe later, this question has surprisingly made its way into the science of cough. Cough is one of the most common respiratory symptoms, clearing irritants, debris, pathogens, and other insults from the airways. Over time, cough may become a significant cause of morbidity and reduce quality of life if it becomes chronic, defined as a cough lasting longer than 8 weeks. Full-Text PDF