Automated analysis of panoramic radiographs remains challenging due to anatomical complexity and image variability. While deep learning has shown strong performance in dental imaging, most studies focus on isolated tasks. This study aimed to propose a hierarchical YOLOv8-based framework aligned for comprehensive analysis of panoramic radiographs using structured dental annotations. A three-stage deep learning pipeline based on YOLOv8 was developed using the DENTEX dataset. The framework includes (1) quadrant classification, (2) tooth enumeration (FDI 11-48), and (3) tooth-level abnormality detection using a two-stage approach (binary screening followed by subtype classification). Panoramic radiographs with hierarchical annotations were used, with an 80:20 train–validation split. Performance was evaluated using mAP50, mAP50-95, precision, recall, and F1-score. The model achieved near-perfect performance for quadrant classification (mAP50=0.994, mAP50-95=0.750, precision=0.994, recall=0.995, and F1=0.994) and strong performance for tooth enumeration (mAP50=0.936, mAP50-95=0.536, precision=0.902, recall=0.897, and F1=0.899). Abnormality detection showed moderate performance (mAP50=0.687, mAP50-95=0.480, precision=0.655, recall=0.742, and F1=0.696). At the class level, impacted teeth (F1=0.904) and caries (F1=0.885) were well detected, whereas periapical lesions (F1=0.568) and deep caries (F1=0.585) showed lower performance. Precision and recall were balanced across tasks. The proposed hierarchical framework enables anatomical localization and integration of detection tasks of panoramic radiographs within a unified pipeline using YOLOv8. While performance is near-ceiling for anatomical tasks, disease detection remains challenging, particularly for low-contrast lesions.
Addressing anterior crowding in adult patients has become increasingly reliant on clear aligner therapy, driven by growing aesthetic demands. However, the challenge of creating sufficient space for proper alignment often requires additional methods. One such method is molar distalization, which can be particularly effective when enhanced by a custom 3D-printed distalization jig combined with mini-screws. This combination not only facilitates bodily molar movement but also helps prevent undesirable tipping, ensuring more controlled results. This case reported the management of severe anterior crowding in an adult patient using clear aligner treatment assisted by a custom 3D-printed distalization jig and mini-screw. In the case presented, a 26-year-old male patient with severe anterior crowding was treated with clear aligners, augmented by a custom-designed 3D-printed jig and mini-screw anchorage. The patient had a Class II canine malocclusion, palatoversion of the maxillary lateral incisor, and a noticeable 2.3 mm maxillary midline shift to the right. Elastic chains attached to mini-screws were used to activate the jig, generating the required counteracting moment for bodily molar movement. Upon review of the post-treatment records, the results showed significant improvement: crowding was resolved, and the midline was successfully corrected. The inclination of the maxillary central incisors (U1-SN) increased to 104.98°, while the IMPA remained within the normal range at 93.22°. Superimposition analysis confirmed that molars had undergone bodily distalization, as opposed to mere tipping. The patient was highly satisfied with both the aesthetic improvements and the overall facial profile transformation.
Gradual and persistent destruction of the tooth and surrounding supporting structures is the key to the chronic inflammatory condition Periodontitis, aided from an imbalance in the oral biofilm environment. To evaluate the effect of non-surgical periodontal therapy on blood glucose levels and C-reactive protein in periodontitis patients, and to understand the co-relationship between periodontal well-being and glycemic parameters in subjects with periodontitis versus healthy periodontium. Forty-one patients (aged 25-50 years) were recruited from the outpatient department of periodontics at AB Shetty Memorial Institute of Dental Sciences. Subjects were divided into periodontitis (n=21) and healthy periodontium (n=20) groups. Periodontal clinical variables such as pocket probing depth (PPD) and clinical attachment loss (CAL ) were assessed using William's graduated periodontal probe and mouth mirror. Baseline and post treatment samples were assessed for blood glucose (HbA1c and FBS), and serum C-Reactive protein levels were analysed. A significant reduction in HbA1c levels from 6.07% to 5.95% following periodontal treatment (p<0.001). Fasting Blood glucose levels showed significant reduction from 90.10 mg/dL to 84.19 mg/dL post-treatment (mean difference: 5.90 mg/dL, p<0.001). This study demonstrates that systemic inflammation may be a potential mechanistic link between periodontitis and increased glycaemic parameters. Maintaining periodontal health could therefore play a beneficial role in the management of glycaemic parameters. Non-surgical periodontal treatment is effective in improving the systemic inflammatory markers as well as glycaemic and periodontal clinical parameters in periodontitis patients.
Autism Spectrum Disorder (ASD) presents sensory and behavioral challenges that may complicate oral care. This study evaluated biofilm accumulation and caries prevalence in children with and without ASD, enrolled in an educational center in San Luis Potosí, México. A cross-sectional study was conducted at a specialized ASD educational center in San Luis Potosí, México. Twenty children with ASD and 40 neurotypical children, matched by age and sex, underwent oral examinations assessing biofilm using the simplified debris index (DI-S) and caries using the international caries detection and assessment system (ICDAS). Participants aged 5-12 years(90%male). Caries prevalence was significantly lower in the ASD group (60%) compared with controls (95%) (p=0.01). DI-S scores indicated fair-to-poor oral hygiene in both groups, with no significant differences. Early ICDAS lesions (codes 1-2) were more common in ASF primary teeth, whereas cavitated lesions (codes 3-6) were more frequent in neurotypical children. In this study population of children with ASD demonstrated lower caries prevalence yet similar biofilm accumulation compared with neurotypical peers.
Research in dentistry plays a crucial role in the education and development of professionals while advancing scientific knowledge and continuously improving dental care. This study aimed to characterize research courses within dental programs at universities across Latin America and the Caribbean. A cross-sectional study analyzed 248 curricula from dental programs in the region in 2023. Of the 248 programs reviewed, 178 included a research course, with 16.85% (n=30) originating from Peru. South America had the highest representation, accounting for 74.72%, and 57.87% (n=103) of the research courses were from private institutions. Research courses are concentrated in South America, with Peru leading in the number and percentage of courses. At the institutional level, private universities had a more substantial presence of research courses compared to public institutions. Additionally, the association between the percentage of research courses and the Scimago ranking underscores the importance of research in enhancing academic prestige and driving institutional innovation.
To identify if an association exists between MTHFR gene polymorphism (rs1801133) and non-syndromic cleft lip (NSCLP) and palate in patients belonging to the South Indian population. 25 patients with NSCLP and 25 healthy patients as controls were enrolled in the study. Genotyping of rs1801133 polymorphism was performed with PCR and amplification refractory mutation system. The primers used were MTHFR-Forward: 5’- TGCTGTTGGAAGGTGCAAGAT - 3’, MTHFRR1: 5’ - GCGTGATGATGAAATCGG - 3’ and MTHFRR2: 5’ - GCGTGATGATGAAATCGA - 3’. Cycling was carried out with an annealing temperature of 58 degree C for 30 seconds Genotype and allele frequency distributions in both the groups were compared using Chi-square test. The frequency of the GA was 100% without GG and AA genotype in group 1 (case group). The allele frequency in group 2 (control group) was found to be GG=24% and GA=76%. The GG homozygous genotype was absent in the case group, whereas the AA homozygous genotype was absent in boths groups. There was a statistically significant deviation from Hardy Weinberg Equilibrium with a p value of <0. 00001 and <0.0022 in the case group control group respectively. Both the groups showed a deviation in Hardy- Weinberg equilibrium depicting an evolving genotyping variant in the South Indian population. Classification of the genotypes based on genetic models such as dominant, recessive or additive did not present any significant association of the polymorphism marker with disease status.
Orthodontic tooth movements are a complex process that involves mechanical forces applied to teeth, leading to changes in the periodontal ligament, alveolar bone, dental pulp, and neovasculature tissue. The mechanosensitive influence of the electrical signals through ion channels plays a significant role in understanding the cell signaling pathways and cell differentiation to increase and promote bone remodeling and regeneration. The mechanism of cell signaling in response to bioelectric potential due to mechanical loading, including mechanosensing, transduction, and cellular responses, facilitated the tooth movement in response to mechanical forces. Moreover, the neurovascular unit plays a crucial role during orthodontic tooth movement, which involves the coordinated activity of osteoclasts and osteoblasts to reshape the alveolar bone. The review aims to present the biological processes that underpin the cellular response, explicitly focusing on the role of signal transduction during the biological tissue response of the orthodontic tooth movement to deepen our understanding of this mechanism.
This scoping review aimed to map the extent, nature, and characteristics of the available evidence on artificial intelligence (AI) applied to cone-beam computed tomography (CBCT)-based periodontal and peri-implant diagnosis. A scoping review was conducted in accordance with Joanna Briggs Institute methodological guidance and reported following PRISMA-ScR. A systematic search of PubMed/MEDLINE, Scopus, Web of Science, and LILACS/BVS was performed up to April 3, 2026, without language restrictions. Records were exported in RIS format, managed in Zotero for duplicate removal, and screened in Rayyan using predefined eligibility criteria. Original studies applying AI-based methods to CBCT images for periodontal and/or peri-implant diagnostic purposes were included. Data were charted descriptively to summarize study characteristics, diagnostic targets, AI models, performance metrics, and methodological limitations. Of the 358 records identified, 174 were screened after removal of duplicate records and conference papers. Twelve reports underwent full-text assessment, and 7 studies were included in the final qualitative synthesis. Most studies were published between 2024 and 2026 and focused predominantly on periodontal applications, whereas only one addressed peri-implant marginal bone loss. The most consistent findings were observed in narrowly defined tasks, particularly furcation involvement detection, periodontal bone topography segmentation, periodontal defect mapping, and peri-implant marginal bone loss grading. Broader diagnostic platforms showed more variable performance. AI applied to CBCT-based periodontal and peri-implant diagnosis represents an emerging field with still limited methodological development. This review maps the CBCT-specific evidence base and identifies priorities for advancing toward more interpretable, externally validated, and clinically useful AI systems.
The aim of this study was to determine the academic impact of converting fifth-year clinical courses at the Faculty of Dentistry of the University of Costa Rica from a semester-based to an annual format by comparing approval, failure, and academic delay outcomes between the two curricular models. An observational retrospective study with longitudinal follow-up was conducted using institutional academic records of 670 students from entry years 2007-2020, with follow-up through December 2024. Student records were analyzed considering variables such as gender, age, admission note, clinic approval rates, and academic delay. Approval rates between curricular formats were compared using chi-square tests and multivariate logistic regression models (OR, 95% CI). Academic delay was analyzed descriptively by clinical discipline and curricular format. Of the students included, 322 completed clinical courses under the semester-based system and 348 under the annual system. Statistically significant differences favoring the annual format were observed in Endodontics (79% vs. 64.3%; p<0.001) and Periodontics (91.4% vs. 83.5%; p=0.002), whereas Restorative Dentistry showed higher approval rates under the semester-based model (83.5% vs. 75.9%; p=0.014). No significant differences were found in Diagnosis, Oral Surgery and Exodontia, or Pediatric Dentistry and Orthodontics. Although a greater absolute number of students repeated courses under the semester-based format, failure in the annual format was associated with a longer mandatory academic delay (12 months vs. 6 months). The academic impact of annualization was heterogeneous across clinical disciplines, highlighting the importance of evaluating curricular reforms using objective indicators before consolidating permanent structural changes in dental clinical education.
The rising clinical demand for tooth bleaching necessitates a comprehensive understanding of its impact on pre-existing restorations. This study aimed to evaluate the effect of two bleaching protocols on the microhardness and surface roughness of four composite resins with distinct filler architectures. Thirty-six discs were manufactured for each composite resin: microhybrid (Opallis), submicron (Brilliant EverGlow), nanofilled (Filtek™ Z350 XT), and nanohybrid (Tetric® N-Ceram). Specimens were randomly assigned (n=12) to two bleaching protocol-35% hydrogen peroxide (HP) and 10% carbamide peroxide (CP)-and a control group (distilled water). A total of 144 discs were evaluated for microhardness and 144 for surface roughness. Data were analyzed using Wilcoxon, Kruskal-Wallis, and Mann-Whitney U tests with Bonferroni correction, as well as the Scheirer-Ray-Hare test (α=0.05). Bleaching protocols significantly altered surface properties (p<0.001), indicating that the bleaching effect is highly dependent on the specific material structure. A significant interaction was observed between the bleaching agent and filler architecture (p<0.01). The microhybrid resin (Opallis) exhibited the highest reduction in microhardness (∆ VHN: 36.2) and the greatest increase in roughness (∆ Ra: 0.40 µm) under 35% HP, exceeding the clinically acceptable threshold of 0.2 µm for biofilm accumulation. Conversely, the nanofilled architecture (Filtek™ Z350 XT) maintained structural and topographical stability, showing no significant differences compared to the control group (p>0.05), regardless of the protocol. Nanohybrid and submicron resins demonstrated intermediate levels of degradation. The surface stability of resin composites is determined by a synergistic interaction between the bleaching protocol and filler architecture, with microhybrid structures being the most susceptible. Bleaching with 35% HP was more deleterious than 10% CP. The nanofilled architecture provides superior resilience to oxidative stress.
Accurate diagnosis of odontogenic cystic lesions remains challenging due to overlapping histopathological features. Immunohistochemistry (IHC) using cytokeratin markers may improve diagnostic precision. This study evaluated the diagnostic concordance between conventional histopathology and immunohistochemical analysis using CK14 and CK19 markers in odontogenic cystic lesions. A prospective single-center observational study was conducted analyzing 126 odontogenic cystic lesions from the Fundación Hospital Universitario Metropolitano between 2021-2023. All specimens underwent conventional histopathological examination followed by immunohistochemical staining with CK14 and CK19 antibodies. Diagnostic concordance was assessed using Cohen's kappa coefficient. The study included 126 cases with mean patient age of 42.3±16.8 years. Inflammatory cysts were most prevalent (35 cases, 27.8%). Overall diagnostic concordance between histopathology and immunohistochemistry was 72.2% (κ=0.68; 95% CI: 0.58-0.78; p<0.001). CK14 showed positive staining in 89.7% of cases, while CK19 was positive in 83.3%. Combined CK14+CK19 analysis improved diagnostic accuracy to 78.6% (κ=0.74; 95% CI: 0.65-0.83). Lesion size >3 cm (OR: 2.84; p=0.008) and extensive inflammation (OR: 3.21; p=0.003) were identified as independent predictors of diagnostic. Immunohistochemical analysis using CK14 and CK19 markers may provide valuable complementary diagnostic information in odontogenic cystic lesions, particularly in cases with extensive inflammation or large size. The combined use of both markers may enhance diagnostic precision, although multicenter validation is required before recommending standardized implementation.
Pathological lesions such as cysts and tumors can significantly weaken the mandible, increasing the risk of pathological fractures during or after surgical removal. Preventive osteosynthesis using patient-specific plates (PSPs) has emerged as a reliable method to enhance mandibular stability in such cases. The intraoperative use of these plates may be considered in patients at elevated fracture risk, as demonstrated in the present case. A 67-year-old woman was detected with a well-defined unilocular radiolucent lesion in the right posterior mandible during a routine dental examination. Cone-beam computed tomography revealed a lesion measuring 24.0 × 11.6 × 24.6 mm, extending to the base of the mandible. Enucleation of the lesion was planned, with a preoperative decision to use a patient-specific titanium plate due to the high fracture risk. Virtual surgical planning (VSP) was performed using CBCT data, and a customized plate was fabricated using 3D printing technologies. During surgery under general anesthesia, the cyst was enucleated, and the PSP was fixed at the planned location. The patient was followed up during the first week, second week, first month, and eighth month. Postoperative healing was uneventful, with resolution of transient hypoesthesia and confirmed plate positioning on follow-up imaging.This case suggests that the application of a patient-specific plate, guided by virtual planning and three-dimensional modeling, may help reduce the risk of pathological fracture during mandibular surgery, while allowing for more precise plate adaptation and stable postoperative outcomes.
Oral candidiasis is one of the most common fungal infections, and its diagnosis is typically clinical; however, misinterpretation may lead to confusion with other conditions that share similar features, such as oral lichen planus (OLP), a chronic immune-mediated inflammatory disease. The aim of this study is to describe a case of erosive OLP initially treated as candidiasis, emphasizing the importance of differential diagnosis in persistent ulcerative lesions. A 19-year-old male presented with multiple painful diffuse erosions and ulcerations that interfered with speech and eating, with a pain intensity of 10/10 on the visual analog scale. He was initially diagnosed with oral candidiasis in primary care and treated with nystatin without improvement. Clinical examination revealed bilateral involvement of the buccal and labial mucosa with erosive and ulcerative lesions, along with reticular whitish plaques consistent with Wickham’s striae and a negative Nikolsky sign. A clinical diagnosis of erosive OLP was established and later confirmed by histopathological analysis. Treatment with systemic corticosteroids, with gradual tapering and nighttime nystatin as antifungal prophylaxis, was initiated, resulting in complete clinical resolution within one month and stable evolution over two years, with mild episodes associated with trauma or stress. Accurate differential diagnosis of oral lesions is essential for timely management. Erythematous or ulcerative oral lesions that do not respond to antifungal therapy should be reassessed, and OLP should be considered in the differential diagnosis. Biopsy and clinicopathological correlation are key to avoiding misdiagnosis and unnecessary treatments.
The aim of this study was to evaluate the effect of surface treatment and ageing on the microtensile bond strength of bulk fill composite repairs. Composite blocks were prepared using a bulk fill resin composite and divided into two groups: (A) no ageing and (B) ageing. The composite surfaces were conditioned with: (G1) control group (no surface treatment), (G2) adhesive application, (G3) phosphoric acid etching + adhesive application, (G4) phosphoric acid etching + silane + adhesive application, (G5) hydrofluoric acid etching + adhesive application, (G6) hydrofluoric acid etching + silane + adhesive application, (G7) aluminium oxide (Al2O3) sandblasting + adhesive application, (G8) Al2O3 sandblasting + silane + adhesive application. Bulk-fill substrates were then repaired with resin composite. Repaired resin blocks were cut into sticks and subjected to a microtensile test. Mechanically treated surfaces were characterized by SEM and profilometry. The highest microtensile bond strength values were obtained in group 1A. Al2O3 sandblasting followed by silane and adhesive application significantly improved microtensile bond strength values from the other ageing groups. The repair bond strength of thermal-aged bulk-fill composites is lower than non-aged composites. Silane application increased the microtensile bond strength.
Oral cancer remains a significant global health burden, requiring the development of effective and safer therapeutic options. Rutin, a naturally occurring flavonoid with antioxidant and anti-inflammatory properties, has gained attention for its potential anticancer activity. This study aimed to evaluate the therapeutic potential of rutin against oral cancer through a combined computational and experimental approach. Molecular docking was performed to assess rutin’s binding interactions with key molecular targets involved in oral cancer progression, particularly within the PI3K/AKT, MAPK, and NF-κB signaling pathways. Network and functional enrichment analyses were used to identify regulatory molecules and biological processes associated with rutin. Pharmacokinetic profiling was conducted to evaluate bioavailability and efficacy. In vitro assays were carried out to determine rutin’s effects on oral cancer cell viability, apoptosis induction, and caspase activation. Docking studies revealed strong interactions of rutin with critical proteins regulating cancer-related pathways. Network analysis highlighted EGFR, STAT3, and AP-1 as key nodes linked to apoptosis, cell cycle regulation, DNA repair, inflammation, and epithelial-mesenchymal transition. Pharmacokinetic predictions supported favorable absorption and bioavailability. In vitro findings demonstrated that rutin reduced oral cancer cell viability in a dose-dependent manner, enhanced apoptotic activity, and triggered caspase activation. Rutin exerts anticancer effects against oral cancer by modulating multiple signaling pathways and key regulatory molecules. These results provide mechanistic insights into its therapeutic potential and support further preclinical and clinical evaluation of rutin as a candidate for oral cancer treatment.
Mobile health (mHealth) applications have become a tool for enhancing awareness, facilitating early detection, aiding diagnosis, and supporting treatment follow-up. However, the sustainability and effectiveness of these applications depend on user experience (UX) influencing adoption, engagement, and trust. A comprehensive, independent search was conducted in 3 databases (PubMed-Medline, Scopus, Embase) and 2 additional sources (ScienceDirect and Google scholar) from inception till 10th September 2025, adhering to Preferred Reporting Items for Systematic Reviews and Meta-analysis: Extension for Scoping Reviews checklist. Study designs such as experimental, quasi-experimental, cohort, case-control, and cross-sectional assessing users of all ages their experiences towards oral cancer based mobile applications were included. Experiences were assessed in terms of adoption, acceptance, usability, feasibility and satisfaction. Two independent reviewers screened the articles with 0.89 agreement rate as per Cohen’s kappa. Rayyan AI software was used for screening. Narrative evidence synthesis approach was used to present the extracted data. The initial search identified 693 studies, of which 7 met inclusion criteria. Across studies, usability, feasibility, acceptance, adoption, and satisfaction were reported positively among healthcare professionals, patients, and community participants. Usability and feasibility were higher among applications with offline functionality or stable internet connectivity and digital literacy. Acceptance and adoption were high across user groups, although medicolegal concerns were reported by professionals. Satisfaction was associated with internet connectivity and gender, with higher ratings among men. Professionals prioritized clinical utility and documentation, whereas non-clinical users focused on ease of use and health awareness. mHealth applications for oral cancer are generally well received across user groups with a positive user experience. Future research should prioritize usability assessments using standardized tools. Tailoring app design to address the priorities of all user groups will improve user experience, which will be key to driving adoption and sustained use.
Severe early childhood caries is among the most prevalent oral conditions in children and may significantly affect health, esthetics, and self-esteem. Finding restorative solutions that are both functional, esthetic, and well accepted by young patients can be a clinical challenge, especially in primary anterior teeth with extensive structural loss. This report presents the case of a 5-year-2-month-old boy with multiple carious lesions in the primary dentition, a high caries risk profile, and a strong esthetic concern shared by both the child and his mother. After completing the urgent and stabilization phases, the maxillary primary incisors were rehabilitated using 3D-printed crowns, prioritizing patient comfort and procedural simplicity. The digital workflow included intraoral scanning, customized anatomical design with Exocad® DentalDB 3.2, and additive manufacturing using biocompatible Crowntec® resin. The crowns were placed without complications and with excellent patient cooperation. Follow-up visits at one, three, and six months demonstrated proper adaptation, stability, and excellent gingival response. Both the child and his mother expressed satisfaction with the esthetic and functional outcome. The use of 3D-printed crowns in pediatric patients with early childhood caries represents a viable and effective restorative option that combines technical precision with esthetic, emotional, and psychosocial benefits, contributing not only to oral health but also to the child’s overall well-being.
Oral squamous cell carcinoma (ICD-10 C05.0) is the most common malignant neoplasm of the oral cavity, associated with high mortality and a poor prognosis. Early diagnosis is essential to improve survival, particularly in older adults. We report the case of a 90-year-old female patient who sought care due to a “palatal mass.” Clinical examination revealed an ulcerated and verrucous lesion on the left maxillary alveolar ridge, initially treated as candidiasis without clinical improvement, which delayed the definitive diagnosis. The progressive enlargement of the lesion led to discontinuation of complete denture use. An incisional biopsy was performed, and histopathological analysis confirmed a well-differentiated squamous cell carcinoma, with pseudoepitheliomatous hyperplasia considered as a differential diagnosis. Computed tomography demonstrated irregular margins and bone involvement, findings consistent with locally invasive tumor behavior. Postoperative healing was uneventful, and the patient was referred for oncologic management through her health insurance system. This case highlights the importance of clinical, radiographic, and histopathological correlation in the diagnosis of suspicious oral lesions, as well as the need for early biopsy of persistent or progressive lesions, particularly in older denture-wearing patients.
This case series evaluated three children with maxillary transverse deficiency and a habitual unilateral mastication preference who were treated with rapid maxillary expansion (RME). Considering the growing recognition of functional alterations in children with transverse deficiencies, RME has been proposed as a therapeutic approach capable of remodeling skeletal structures and influencing muscular dynamics. Electromyographic activity of the bilateral masseter, temporalis, and upper and lower orbicularis oris muscles was recorded during rest, dental clenching, suction, swallowing, and non-habitual mastication at baseline (T0), six months (T1), and eighteen months (T2). By six months, transverse deficiencies were corrected in all patients, with increases in anterior and posterior arch widths and closure of the anterior open bite, and these skeletal and dental changes remained stable throughout the 18-month follow-up. Functionally, an initial increase in orbicularis oris activity and improved muscular symmetry were observed at six months; partial asymmetry reappeared at 18 months, reflecting the persistence of habitual right-sided unilateral mastication. RME produced stable skeletal and dental outcomes and promoted early functional adaptations in these three patients, but when used in isolation, it was insufficient to induce lasting modifications of their established unilateral masticatory patterns, highlighting the need for multidisciplinary management to achieve long-term functional stability.
Bruxism can lead to tooth fractures, abrasion, mobility, denture issues, temporomandibular disorders (TMD), masticatory muscle pain (MMP), fatigue, and hypertrophy. Aligners can cause clenching/bruxism, which increases masticatory muscle activity and worsens TMD symptoms. This review aimed to evaluate the impact of clear aligner therapy on MMP in patients with bruxism. A literature search was conducted in three electronic databases (PubMed, SCOPUS, and Cochrane Library) for articles published between 2019 and 2024. The selection followed PICO criteria, and studies were included if they addressed the relationship between clear aligner use and muscle activity in patients with bruxism. From an initial 4,836 records, 13 studies met the inclusion criteria. Findings indicate that while clear aligners may cause general discomfort in all patients, their use in individuals with bruxism is associated with a reduction in MMP, supported by decreased surface electromyographic activity. In conclusion, clear aligner therapy appears to reduce masticatory muscle pain and muscle activity in patients with bruxism.
