A recent pilot study in patients with paroxysmal nocturnal hemoglobinuria (PNH), using a humanized monoclonal antibody that binds human complement C5 and inhibits terminal complement protein activation, suggests that blocking complement is a potentially effective therapeutic option for PNH. However, since C5 is critical for proper regulation of inflammatory responses as well as complement activation, terminal complement proteins with more restricted function may represent better targets. The pore-forming C5-9 complex includes several protein targets, but persons with C9 deficiency have measurable evidence of in vitro complement activation, indicating that the C5b-8 complex can cause lysis in the absence of C9. Blocking complement at C9 may not, therefore, completely prevent complement-mediated hemolysis and adequately protect PNH erythrocytes. Accordingly, we used in vitro selection methodology to identify high affinity nuclease-resistant RNA aptamers that bind specifically to human complement C8. Aptamers bound C8 with a Kd of 1.4nM and 54.1% after round 7. C8 aptamers identified after rounds 4 to 7 of selection were cloned and sequenced, and aptamer clones were screened for in vitro binding and complement-inhibitory activity. Aptamers were first incubated with purified C8 at a concentration sufficient to induce 50–70% hemolysis, then antibody-sensitized erythrocytes and C8-depleted serum were added. One C8 aptamer clone (4–101) had strong inhibitory hemolytic activity with 91.9% inhibition at 250nM, compared to only 12.3% inhibition observed with random aptamers at 250nM. Aptamer clone 4–101 bound C8 with a Kd of 15nM and a Bmax of 74.2%. Inhibition of hemolysis by C8 aptamer clone 4–101 was enhanced by adding a previously published C5 aptamer clone f8/c11, (TCTCATGCGCCGAGTGTGAGTTTACCTTCGT, Immunopharmacology 42:219, 1999) in a modified human serum hemolytic assay using total human serum: 54.4% inhibition was observed using C8 aptamer 4–101 at 500nM, versus 83.0% inhibition using C8 aptamer 4–101 with C5 aptamer f8/c11 in combination at 500nM. Thus, C8 aptamer clones can efficiently inhibit complement-mediated lysis, with enhanced activity in combination with a known C5 aptamer. These data indicate that combinatorial blocking aptamers that bind terminal human complement proteins can efficiently inhibit the complement pathway, and therefore represent a novel potential therapeutic option for patients with PNH. Based on these in vitro data, therapeutic C8 aptamers should be considered for the in vivo treatment of PNH patients with massive hemolysis. C5 inhibitors could still be useful, however, as an adjunct therapy if C8 aptamers insufficiently inhibit complement-mediated lysis.
更多