Introduction Cerebral vasospasm represents a formidable challenge in the aftermath of subarachnoid hemorrhage (SAH), significantly contributing to morbidity and mortality. This life‐threatening and potentially reversible complication is conventionally addressed through percutaneous transluminal balloon angioplasty (PTA) or intra‐arterial (IA) infusion of vasodilators, particularly when standard medical therapies prove ineffective. However, these endovascular interventions often fall short in efficacy or are marred by elevated complication rates, including vessel rupture and thromboembolic events. The persistent issue of frequent recurrence underscores a pressing unmet need in vasospasm management. In this context, the NeVa VS (Vesalio)—a patented, retrievable nitinol stent—emerges as a novel solution engineered explicitly for cerebral vasospasm post‐aneurysmal rupture. Notably, it is the sole device approved for this application in the United States. This study delineates our initial clinical experiences utilizing the NeVa VS device. Methods Our study encompassed 23 patients across seven US centers, all treated with the NeVa VS device. Of 24 cases analyzed to date, all were confronting refractory symptomatic cerebral vasospasm after aSAH. The deployment of NeVa VS involved a 0.021” or 0.027” ID micro‐catheter, positioning the stent across the affected vasospasm segment. Following a recommended 5‐10 minute interval, allowing the self‐expanding nitinol structure to dilate the constricted vessel segment mechanically, the device was resheathed into the microcatheter and removed. We aimed to evaluate intraoperative efficacy, user experience, safety parameters, and preliminary outcomes in this patient cohort. Parameters such as vessel caliber pre‐ and post‐intervention, procedural metrics, and outcomes—including symptom relief, patient status changes, and adverse events—were meticulously analyzed. Outcomes Comprehensive outcomes were ascertained for 23 patients. The median age was 42 years (±13, SD); 74% were female, and 70% were of Hispanic/Latino ethnicity. The device was deployed, on average 12 days (±8) after the index hemorrhage, in total 24 times (1.0 per case) in the MCA (57%) or basilar artery (43%) for an average of 6.4 minutes (±2.7). MAC/sedation was utilized in 17% of cases. With one exception, all treatments were deemed successful (96%) with significant improvement in the degree of spasm from 78% pre‐ and 22% post‐intervention, and no safety events occurred, in particular, no ischemic strokes or intraprocedural ruptures. Four patients (17%) required additional treatment, on average 11.0 days after the first treatment. Conclusion In this preliminary multi‐center study, the NeVa VS device demonstrates a 96% success rate in performing a safe and efficacious single‐stage intervention to address severe stenosis secondary to vasospasm post‐aSAH. The device's ability to control vessel expansion and preserve distal flow offers a significant advantage over traditional balloon angioplasty. It also exhibits a lower risk profile concerning vessel rupture and the option to utilize MAC/sedation instead of solely general anesthesia in selected cases (17%), marking a significant advancement in neurointerventional therapy for symptomatic vasospasm.

BACKGROUND AND PURPOSE: The optimal patient sedation during mechanical thrombectomy for ischemic stroke in the extended time window is unknown. The purpose of this study was to assess the impact of patient sedation on outcome in patients undergoing thrombectomy 6-16 hours from stroke onset. MATERIALS AND METHODS: Endovascular Therapy Following Imaging Evaluation for Ischemic Stroke 3 (DEFUSE 3) was a multicenter, randomized, open-label trial of thrombectomy for ICA and M1 occlusions in patients 6-16 hours from stroke onset. Subjects underwent thrombectomy with either general anesthesia or conscious sedation at the discretion of the treating institution. RESULTS: Of the 92 patients who were randomized to intervention, 26 (28%) underwent thrombectomy with general anesthesia and 66 (72%) underwent thrombectomy with conscious sedation. Baseline clinical and imaging characteristics were similar among all groups. Functional independence at 90 days was 23% for general anesthesia, 53% for conscious sedation, and 17% for medical management (P=.009 for general anesthesia versus conscious sedation). Conscious sedation was associated with a shorter time from arrival in the angiosuite to femoral puncture (median, 14 versus 18 minutes; P = 0.05) and a shorter time from femoral puncture to reperfusion (median, 36 versus 48 minutes; P=.004). Sixty-six patients were treated at sites that exclusively used general anesthesia (n=14) or conscious sedation (n=52). For these patients, functional independence at 90 days was significantly higher in the conscious sedation subgroup (58%) compared with the general anesthesia subgroup (21%) (P=.03). CONCLUSIONS: Patients who underwent thrombectomy with conscious sedation in the extended time window experienced a higher likelihood of functional independence at 90 days, a lower NIHSS score at 24 hours, and a shorter time from femoral puncture to reperfusion compared with those who had general anesthesia. This effect remained robust in institutions that only treated patients with a single anesthesia technique.

Aptamers, or nucleic acid ligands, have gained clinical interest over the past 20 years due to their unique characteristics, which are a combination of the best facets of small molecules and antibodies. The high binding affinity and specificity of aptamers allows for isolation of an artificial ligand for theoretically any therapeutic target of interest. Chemical manipulations of aptamers also allow for fine-tuning of their bioavailability, and antidote control greatly expands their clinical use. Here we review the various methods of antidote control of aptamer therapeutics--matched oligonucleotide antidotes and universal antidotes. We also describe the development, recent progress, and potential future therapeutic applications of these types of aptamer-antidote pairs.

Purpose/Objective(s)Image-guided stereotactic radiosurgery/radiotherapy (IGRT) is used to treat both de-novo and recurrent intracranial meningiomas as adjuvant treatment after microsurgical resection or alone for unresectable lesions. This retrospective study describes a multimodal approach to treating intracranial meningiomas using IGRT at a single institution.Materials/MethodsRecords were reviewed of patients with intracranial meningiomas who underwent IGRT at our institution from March 2008 - March 2010. All patients were treated on a Novalis TX radiosurgery system, utilizing orthogonal kV imaging and con-beam CT for image guidance.ResultsFifty-nine patients received IGRT for treatment of intracranial meningiomas. Thirty six percent were men and 64% were women. Mean age was 60 years (range, 22-83 years). Fifty-one percent were de-novo treatments, while 49% were recurrent lesions. Thirty-five (57%) were grade I, 13 (21%) were grade II, 2 (3%) were grade III and 9 (15%) were presumed to have meningiomas on the basis of serial imaging but did not undergo surgery/biopsy. Eighteen (51%) patients with grade I lesions underwent IGRT within 3 months of resection, while 9 (69%) grade II and 1 (50%) grade III lesion had IGRT within 3 months of resection. By location, 12 lesions (20%) were petroclival, 11 (19%) cavernous sinus, 10 (17%) cerebral convexity, 9 (15%) parasagittal, 5 (9%) tentorial, 3 (5%) optic nerve sheath, 3 (5%) orbital, 3 (5%) planum sphenoidale, 2 (3%) suprasellar, and 1 (2%) ethmoid sinus. Univariate analysis revealed no relationship between either grade (p = 0.61) or location (p = 0.99) and the start of SRS. Eleven (19%) lesions with a median volume of 2.0 cm3 were treated to1400 cGy in a single fraction, while 12 (20%) lesions with a median volume of 15.6 cm3 received 2500 cGy in 5 fractions. Lesions within or abutting critical structures were treated with conventionally fractionated IGRT with grade I lesions receiving 5220 cGy, grade II lesions received 5400-5580 cGy and grade III lesions 5940 cGy at 180cGy/fraction. The mean planning target volume (PTV) of the lesions was 31.9 ± 44.8 cm3 (range, 0.7-259 cm3). PTV correlated with both total treatment dose and fractionated therapy (p < 0.0001). Median follow-up was 40 ± 24 weeks. Two (3%) patients had tumor progression despite therapy and one of the two succumbed to the disease. Patients commonly required long-term low dose steroids post IGRT and only one patient experienced severe edema requiring hospitalization. No other significant treatment-related toxicities were observed.ConclusionsIGRT is a viable strategy to treat intracranial meningiomas, alone or in combination with surgery. Tumor progression was similar to previous studies. Acute toxicity was minimal over the broad range of fraction schemes employed. Purpose/Objective(s)Image-guided stereotactic radiosurgery/radiotherapy (IGRT) is used to treat both de-novo and recurrent intracranial meningiomas as adjuvant treatment after microsurgical resection or alone for unresectable lesions. This retrospective study describes a multimodal approach to treating intracranial meningiomas using IGRT at a single institution. Image-guided stereotactic radiosurgery/radiotherapy (IGRT) is used to treat both de-novo and recurrent intracranial meningiomas as adjuvant treatment after microsurgical resection or alone for unresectable lesions. This retrospective study describes a multimodal approach to treating intracranial meningiomas using IGRT at a single institution. Materials/MethodsRecords were reviewed of patients with intracranial meningiomas who underwent IGRT at our institution from March 2008 - March 2010. All patients were treated on a Novalis TX radiosurgery system, utilizing orthogonal kV imaging and con-beam CT for image guidance. Records were reviewed of patients with intracranial meningiomas who underwent IGRT at our institution from March 2008 - March 2010. All patients were treated on a Novalis TX radiosurgery system, utilizing orthogonal kV imaging and con-beam CT for image guidance. ResultsFifty-nine patients received IGRT for treatment of intracranial meningiomas. Thirty six percent were men and 64% were women. Mean age was 60 years (range, 22-83 years). Fifty-one percent were de-novo treatments, while 49% were recurrent lesions. Thirty-five (57%) were grade I, 13 (21%) were grade II, 2 (3%) were grade III and 9 (15%) were presumed to have meningiomas on the basis of serial imaging but did not undergo surgery/biopsy. Eighteen (51%) patients with grade I lesions underwent IGRT within 3 months of resection, while 9 (69%) grade II and 1 (50%) grade III lesion had IGRT within 3 months of resection. By location, 12 lesions (20%) were petroclival, 11 (19%) cavernous sinus, 10 (17%) cerebral convexity, 9 (15%) parasagittal, 5 (9%) tentorial, 3 (5%) optic nerve sheath, 3 (5%) orbital, 3 (5%) planum sphenoidale, 2 (3%) suprasellar, and 1 (2%) ethmoid sinus. Univariate analysis revealed no relationship between either grade (p = 0.61) or location (p = 0.99) and the start of SRS. Eleven (19%) lesions with a median volume of 2.0 cm3 were treated to1400 cGy in a single fraction, while 12 (20%) lesions with a median volume of 15.6 cm3 received 2500 cGy in 5 fractions. Lesions within or abutting critical structures were treated with conventionally fractionated IGRT with grade I lesions receiving 5220 cGy, grade II lesions received 5400-5580 cGy and grade III lesions 5940 cGy at 180cGy/fraction. The mean planning target volume (PTV) of the lesions was 31.9 ± 44.8 cm3 (range, 0.7-259 cm3). PTV correlated with both total treatment dose and fractionated therapy (p < 0.0001). Median follow-up was 40 ± 24 weeks. Two (3%) patients had tumor progression despite therapy and one of the two succumbed to the disease. Patients commonly required long-term low dose steroids post IGRT and only one patient experienced severe edema requiring hospitalization. No other significant treatment-related toxicities were observed. Fifty-nine patients received IGRT for treatment of intracranial meningiomas. Thirty six percent were men and 64% were women. Mean age was 60 years (range, 22-83 years). Fifty-one percent were de-novo treatments, while 49% were recurrent lesions. Thirty-five (57%) were grade I, 13 (21%) were grade II, 2 (3%) were grade III and 9 (15%) were presumed to have meningiomas on the basis of serial imaging but did not undergo surgery/biopsy. Eighteen (51%) patients with grade I lesions underwent IGRT within 3 months of resection, while 9 (69%) grade II and 1 (50%) grade III lesion had IGRT within 3 months of resection. By location, 12 lesions (20%) were petroclival, 11 (19%) cavernous sinus, 10 (17%) cerebral convexity, 9 (15%) parasagittal, 5 (9%) tentorial, 3 (5%) optic nerve sheath, 3 (5%) orbital, 3 (5%) planum sphenoidale, 2 (3%) suprasellar, and 1 (2%) ethmoid sinus. Univariate analysis revealed no relationship between either grade (p = 0.61) or location (p = 0.99) and the start of SRS. Eleven (19%) lesions with a median volume of 2.0 cm3 were treated to1400 cGy in a single fraction, while 12 (20%) lesions with a median volume of 15.6 cm3 received 2500 cGy in 5 fractions. Lesions within or abutting critical structures were treated with conventionally fractionated IGRT with grade I lesions receiving 5220 cGy, grade II lesions received 5400-5580 cGy and grade III lesions 5940 cGy at 180cGy/fraction. The mean planning target volume (PTV) of the lesions was 31.9 ± 44.8 cm3 (range, 0.7-259 cm3). PTV correlated with both total treatment dose and fractionated therapy (p < 0.0001). Median follow-up was 40 ± 24 weeks. Two (3%) patients had tumor progression despite therapy and one of the two succumbed to the disease. Patients commonly required long-term low dose steroids post IGRT and only one patient experienced severe edema requiring hospitalization. No other significant treatment-related toxicities were observed. ConclusionsIGRT is a viable strategy to treat intracranial meningiomas, alone or in combination with surgery. Tumor progression was similar to previous studies. Acute toxicity was minimal over the broad range of fraction schemes employed. IGRT is a viable strategy to treat intracranial meningiomas, alone or in combination with surgery. Tumor progression was similar to previous studies. Acute toxicity was minimal over the broad range of fraction schemes employed.

In 1990, an RNA molecule was designed that bound to a nucleic acid binding protein to act as a decoy, thereby preventing HIV replication. That same year, two research groups identified a high-throughput method to select for nucleic acids to protein targets and the field of aptamer therapeutics was born. Over the lost 20 years, numerous aptamers to therapeutic targets have been isolated and undergone in vitro and ex vivo analysis before in vivo testing. Aptamer therapeutics represents a promising new class of agents to treat disease. The capability to extensively modify these compounds provides a potential broader spectrum of clinical applications than antibodies and small molecules. A brief historical review of aptamers is presented and the therapeutic aptamers currently in clinical development are described.

Thrombus formation is initiated by platelets and leads to cardiovascular, cerebrovascular, and peripheral vascular disease, the leading causes of morbidity and mortality in the Western world. A number of antiplatelet drugs have improved clinical outcomes for thrombosis patients. However, their expanded use, especially in surgery, is limited by hemorrhage. Here, we describe an antiplatelet agent that can have its activity controlled by a matched antidote. We demonstrate that an RNA aptamer targeting von Willebrand factor (VWF) can potently inhibit VWF-mediated platelet adhesion and aggregation. By targeting this important adhesion step, we show that the aptamer molecule can inhibit platelet aggregation in PFA-100 and ristocetin-induced platelet aggregation assays. Furthermore, we show that a rationally designed antidote molecule can reverse the effects of the aptamer molecule, restoring platelet function quickly and effectively over a clinically relevant period. This aptamer-antidote pair represents a reversible antiplatelet agent inhibiting a platelet specific pathway. Furthermore, it is an important step towards creating safer drugs in clinics through the utilization of an antidote molecule.

A recent pilot study in patients with paroxysmal nocturnal hemoglobinuria (PNH), using a humanized monoclonal antibody that binds human complement C5 and inhibits terminal complement protein activation, suggests that blocking complement is a potentially effective therapeutic option for PNH. However, since C5 is critical for proper regulation of inflammatory responses as well as complement activation, terminal complement proteins with more restricted function may represent better targets. The pore-forming C5-9 complex includes several protein targets, but persons with C9 deficiency have measurable evidence of in vitro complement activation, indicating that the C5b-8 complex can cause lysis in the absence of C9. Blocking complement at C9 may not, therefore, completely prevent complement-mediated hemolysis and adequately protect PNH erythrocytes. Accordingly, we used in vitro selection methodology to identify high affinity nuclease-resistant RNA aptamers that bind specifically to human complement C8. Aptamers bound C8 with a Kd of 1.4nM and 54.1% after round 7. C8 aptamers identified after rounds 4 to 7 of selection were cloned and sequenced, and aptamer clones were screened for in vitro binding and complement-inhibitory activity. Aptamers were first incubated with purified C8 at a concentration sufficient to induce 50–70% hemolysis, then antibody-sensitized erythrocytes and C8-depleted serum were added. One C8 aptamer clone (4–101) had strong inhibitory hemolytic activity with 91.9% inhibition at 250nM, compared to only 12.3% inhibition observed with random aptamers at 250nM. Aptamer clone 4–101 bound C8 with a Kd of 15nM and a Bmax of 74.2%. Inhibition of hemolysis by C8 aptamer clone 4–101 was enhanced by adding a previously published C5 aptamer clone f8/c11, (TCTCATGCGCCGAGTGTGAGTTTACCTTCGT, Immunopharmacology 42:219, 1999) in a modified human serum hemolytic assay using total human serum: 54.4% inhibition was observed using C8 aptamer 4–101 at 500nM, versus 83.0% inhibition using C8 aptamer 4–101 with C5 aptamer f8/c11 in combination at 500nM. Thus, C8 aptamer clones can efficiently inhibit complement-mediated lysis, with enhanced activity in combination with a known C5 aptamer. These data indicate that combinatorial blocking aptamers that bind terminal human complement proteins can efficiently inhibit the complement pathway, and therefore represent a novel potential therapeutic option for patients with PNH. Based on these in vitro data, therapeutic C8 aptamers should be considered for the in vivo treatment of PNH patients with massive hemolysis. C5 inhibitors could still be useful, however, as an adjunct therapy if C8 aptamers insufficiently inhibit complement-mediated lysis.

αvβ3 integrin is a crucial factor involved in a variety of physiological processes, such as cell growth and migration, tumor invasion and metastasis, angiogenesis, and wound healing. αvβ3 integrin exerts its effect by regulating endothelial cell (EC) migration, proliferation, and survival. Inhibiting the function of αvβ3 integrin, therefore, represents a potential anti-cancer, anti-thrombotic, and anti-inflammatory strategy. In this study, we tested an RNA aptamer, Apt-αvβ3 that binds recombinant αvβ3 integrin, for its ability to bind endogenous αvβ3 integrin on the surface of cells in culture and to subsequently affect cellular response. Our data illustrate that Apt-αvβ3 binds αvβ3 integrin expressed on the surface of live HUVECs. This interaction significantly decreases both basal and PDGF-induced cell proliferation as well as inhibition of cell adhesion. Apt-αvβ3 can also reduce PDGF-stimulated tube formation and increase HUVEC apoptosis through inhibition of FAK phosphorylation pathway. Our results demonstrate that by binding to its target, Apt-αvβ3 can efficiently inhibit human EC proliferation and survival, resulting in reduced angiogenesis. It predicts that Apt-αvβ3 could become useful in both tumor imaging and the treatment of tumor growth, atherosclerosis, thrombosis, and inflammation.

From the Department of Surgery, Division of Experimental Surgery, Duke University Medical Center, Durham, NC. Reprints: Bruce A. Sullenger, Box 2601 MSRB, Duke University Medical Center, Durham, NC 27710. E-mail: [email protected].

PURPOSE:We analyzed the practice of mandatory surgical intensive care unit admission after radical cystectomy, and defined objective criteria to predict active treatment requirements and surgical intensive care unit stay.MATERIALS AND METHODS:We retrospectively reviewed the records of 115 consecutive patients admitted to the surgical intensive care unit after radical cystectomy and urinary diversion during the 36-month study period of January 1996 to December 1998. An Acute Physiology and Chronic Health Evaluation II score was calculated from postoperative patient parameters at admission to the unit. Active treatment mandating admission was defined as postoperative invasive cardiopulmonary monitoring, administration of vasopressors or inotropic medications, monitoring or treatment for life threatening complications, or mechanical ventilation for longer than 12 hours. We analyzed the correlation of outcome variables with the requirements for active treatment and surgical intensive care unit stay, and developed a stratification model of low versus high risk. Low risk was defined as a calculated likelihood of less than 10% for requiring active treatment postoperatively.RESULTS:Mean stay in the surgical intensive care unit plus or minus standard error was 34.4 +/- 3.1 hours. No active treatment was required in 63.5% of patients during the stay. The evaluation score, intraoperative complications and number of intraoperative transfusions were the strongest predictors of required postoperative active treatment. By combining these variables we developed a clinically applicable algorithm to stratify patients into a low and a high risk category. In patients at low and high risk the active treatment rate was 5.9% and 42.8% (p = 0.001), and the mean stay was 24.6 +/- 2.2 and 38.7 +/- 4.5 hours (p = 0.039), respectively.CONCLUSIONS:Mandatory surgical intensive care unit admission of all patients after radical cystectomy and urinary diversion does not appear indicated. A subset of patients at low risk for requiring active treatment may be identified who may be safely treated in an intermediate care setting after initial postoperative observation in the recovery room. The results of our retrospective analysis and risk stratification model should be validated in a prospective trial.