• 学术搜索
  • 科研智能体
    • Research Labs
    • AI 阅读
    • AI 文库
    • 深度研究
    • 学者亮点
  • 学术资源
    • AI2000
    • 期刊/会议
    • 学者库
    • 学术API
    • 溯源树
    • 数据集
  • 知识沉淀
    • 学术空间
订阅小程序
旧版功能
aminer vip
开通会员低至0.73元/天
一次搞定AI科研
立即登录
  • English
  • 联系方式
    专

    一种隐形口罩

    126200161968B2
    发明人
    李春喜, 邓海同
    受让人
    李春喜
    申请人
    Chemtron Research LLC
    申请号
    7928678
    申请日
    2013-11-14
    公开(公告)号
    126200161968B2
    公开(公告)日
    2001-04-05
    IPC分类号
    B41J029/393B41J002/175B41J002/195
    CPC分类号
    -
    优先权号
    201210114553
    优先权日
    2012-04-17
    摘要

    NOVELTY - A method (M1) of treating or preventing diabetes or a condition related to it, a condition ameliorated by increasing a blood glucagon-like peptide-1 (GLP-1) level, or increasing a blood GLP-1 level, involves administering a composition comprising a G protein-coupled receptor 119 (GPR119) agonist and a dipeptidyl peptidase-IV (DPP-IV) inhibitor to a subject in need.

    USE - (M1) and PC are useful for treating or preventing diabetes or a condition related to it, a condition ameliorated by increasing a blood GLP-1 level, or increasing a blood GLP-1 level in a subject e.g. human, where the diabetes is Type 2 diabetes. The condition related to diabetes is chosen from hyperglycemia, impaired glucose tolerance, insulin resistance, pancreatic beta -cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, stroke, hypertension, and obesity. The condition ameliorated by increasing a blood GLP-1 level is chosen from diabetes, condition related to diabetes, myocardial infarction, learning impairment, memory impairment, and a neurodegenerative disorder. The neurodegenerative disorder is chosen from excitotoxic brain damage caused by severe epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, stroke, motor-neuron disease, learning or memory impairment, traumatic brain injury, spinal cord injury, and peripheral neuropathy. The subject is a human (all claimed).

    DETAILED DESCRIPTION - INDEPENDENT CLAIMS are also included for the following:

    (1) a composition (I) comprising a GPR119 agonist and a DPP-IV inhibitor, for use in a method of treatment of the human or animal body by therapy;

    (2) preparing (M2) a pharmaceutical composition, involves admixing a GPR119 agonist and a DPP-IV inhibitor, together with a carrier;

    (3) a pharmaceutical composition (PC) comprising a GPR119 agonist and a DPP-IV inhibitor, together with a carrier; and

    (4) identifying (M3) GLP-1 secretagogues or compounds useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level, involves (a) contacting a test compound with a host cell or with membrane of a host cell that expresses a G protein-coupled receptor (GPCR), where the GPCR comprises an amino acid sequence chosen from amino acids 1-335, 2-335 of a fully defined 335 amino acids (SEQ ID No. 2) sequence given in specification, amino acids 2-335 of (SEQ ID No. 2), where the receptor does not comprise the amino acid sequence of (SEQ ID No. 2), the amino acid sequence of a GPCR encoded by a polynucleotide comprising a nucleotide sequence, which is obtainable by a process comprising performing PCR on a human DNA sample using specific primers having a fully defined 22 and 23 base pairs (SEQ ID No. 3 and 4) sequence given in specification, the amino acid sequence of GPCR encoded by a polynucleotide comprising a nucleotide sequence, the nucleotide sequence hybridizing under stringent conditions to the complement of a fully defined 1008 base pairs (SEQ ID No. 1) sequence given in specification, and a biologically active fragment of any of the abovementioned sequences, and determining the ability of the test compound to stimulate functionality of the receptor, where the ability of the test compound to stimulate functionality of the receptor is indicative of the test compound being a GLP-1 secretagogue or a compound useful for preventing or treating a condition ameliorated by increasing a blood GLP-1 level, or (b) contacting GPCR with an optionally labeled known ligand to the receptor in the presence or absence of a test compound, detecting the complex between the known ligand and the receptor, and determining whether less of the complex is formed in the presence of the test compound than in the absence of the test compound, where the determination is indicative of the test compound being a GLP-1 secretagogue or a compound useful for preventing or treating a condition ameliorated by increasing a blood GLP-1 level.

    (SEQ ID No. 3) gtcctgccacttcgagacatgg (SEQ ID No. 4) gaaacttctctgcccttaccgtc

    DESCRIPTION OF DRAWING(S) - The figure is a graph representing the effect of GPR119 agonist AR244061 and DPP-IV inhibitor FE107542 in lowering blood glucose level in oral glucose tolerance test in mice.

    权利要求
    1 . A blower, comprising: a case comprising a first tower and a second tower which is spaced apart from the first tower; a passage provided between the first tower and the second tower; at least one motor provided in the case; a gate configured to reciprocate between inside the passage and inside of the case; and a linear actuator connected to the gate and configured to translate a driving rotational force of the motor to the gate as a linear motion force.
    2 . The blower of claim 1 , further comprising: a pinion coupled to a shaft of the motor; and a rack connected to the pinion.
    3 . The blower of claim 2 , wherein the rack is formed on a first surface of the linear actuator opposite to a second surface of the linear actuator facing the gate.
    4 . The blower of claim 1 , wherein: a first discharge port is formed in the first tower and extends in a first direction; a second discharge port is formed in the second tower and extends in the first direction, and the linear actuator is configured to move along the first direction.
    5 . The blower of claim 4 , wherein the first direction is a longitudinal direction of the first and second towers.
    6 . The blower of claim 1 , wherein the linear actuator comprises a first slit that guides a movement of the gate, and the gate includes a first protrusion which slides along the first slit when at least a portion of the first protrusion is inserted into the first slit.
    7 . The blower of claim 6 , wherein the first slit includes an inclined portion inclined downward in a direction toward the passage.
    8 . The blower of claim 6 , wherein the first slit includes an inclined portion, wherein a portion of the inclined portion closer to the passage has a lower height than a portion of the inclined portion farther from the passage.
    9 . The blower of claim 7 , wherein the first slit further includes a vertical portion which has a lower end connected to an upper end of the inclined portion and extends in a length direction of the linear actuator.
    10 . The blower of claim 1 , further comprising a guide body to guide a movement of the linear actuator.
    11 . The blower of claim 8 , wherein: the guide body includes a body protrusion protruding in a direction intersecting a length direction of the guide body, and the linear actuator includes a second slit through which the body protrusion is inserted and guided.
    12 . The blower of claim 1 , further comprising a friction reduction protrusion to prevent a surface contact between the linear actuator and the gate.
    13 . The blower of claim 12 , wherein the friction reduction protrusion is formed in the linear actuator, protrudes from a surface of the linear actuator facing the gate, and contacts the gate.
    14 . The blower of claim 12 , wherein the friction reduction protrusion is formed in the gate, protrudes from a surface of the gate facing the linear actuator, and contacts the linear actuator.
    15 . The blower of claim 13 , wherein the gate moves along a first direction, and the friction reduction protrusion extends in the first direction.
    16 . The blower of claim 12 , wherein a plurality of friction reduction protrusions are spaced apart from each other in a direction intersecting a direction in which the friction reduction protrusions extend.
    17 . The blower of claim 1 , further comprising a roller which separates the case and the gate.
    18 . The blower of claim 17 , wherein the roller is provided in a lower portion of the gate.
    19 . The blower of claim 1 , wherein the gate has a cross-section having an arc shape.
    20 . A blower, comprising: a first tower extending in a first direction; a second tower extending in the first direction and spaced apart from the first tower in a second direction; a first discharge port provided in the first tower and extending in the first direction; a second discharge port provided in the second tower and extending in the first direction; a gate configured to reciprocate between an inside and an outside of a first end of at least one of the first or second towers; a motor configured to provide a driving rotational force; and a linear actuator which is connected to the gate and configured to translate the driving rotational force of the motor to the gate as a linear motion force, wherein: the first and second discharge ports are provided between first and second ends of the first and second towers, respectively, a direction between the first ends and the second ends is a third direction, and the first and second discharge ports are configured such that air discharged through the first and second discharge ports is guided in the third direction toward the first ends.
    说明书
    [0001]CROSS-REFERENCE TO RELATED PATENT APPLICATION
    [0002]This application claims the benefit of Korean Patent Application Nos. 10-2011-0021905, filed on Mar. 11, 2011, 10-2012-0023621, filed on Mar. 7, 2012, in the Korean Intellectual Property Office, the disclosures of which are incorporated herein in their entirety by reference.
    [0003]BACKGROUND OF THE INVENTION
    [0004]1. Field of the Invention
    [0005]The present invention relates to an apparatus and method for generating a Doppler image, and more particularly, an apparatus and method for generating a Doppler image by using a plurality of in-phase/quadrature-phase (I/Q) signals.
    [0006]2. Description of the Related Art
    [0007]Ultrasound systems are essential equipment for observing an inner structure of an organic object. Ultrasound systems are non-invasive inspection devices that show structural details of the body, an inner tissue, and the flow of a fluid.
    [0008]Ultrasound systems transmit a ultrasound signal to an object through the body, receive a response signal reflected from the object, and images the inner structure of the body. In addition, ultrasound systems may measure speed and/or direction of the object by using a Doppler effect. In detail, ultrasound systems may compare a frequency of the ultrasound signal transmitted to the object with a frequency of the response signal reflected from the object, may measure a degree of a change in frequency, and may measure speed and/or direction of the object by using the measurement results. A ultrasound image that indicates speed and/or direction of the object is referred to as a Doppler image, and an inspector may check information about movement of blood steam and an organ, such as the heart, or the like, from the Doppler image.
    [0009]SUMMARY OF THE INVENTION
    [0010]The present invention provides an apparatus and method for generating a Doppler image, whereby a signal to noise ratio (SNR) of a Doppler signal is improved using a plurality of in-phase/quadrature-phase (I/Q) signals.
    [0011]The present invention also provides an apparatus and method for generating a Doppler image, whereby the quality of a Doppler image is improved.
    [0012]According to an aspect of the present invention, there is provided a method for generating a Doppler image by using a ultrasound system, the method including: transmitting a ultrasound signal to an object and receiving a response signal reflected from the object; converting the response signal into a plurality of in-phase/quadrature-phase (I/Q) signals having different frequencies; and generating a Doppler image of the object based on information about a speed of the object obtained from the plurality of I/Q signals.
    [0013]The converting the response signal into the plurality of I/Q signals may include: receiving and focusing the response signal; and converting the received and focused response signal into the plurality of I/Q signals.
    [0014]The generating the Doppler image of the object may include: applying time delay to a part or a whole of the plurality of I/Q signals; and generating the Doppler image of the object based on the information about the speed of the object obtained from the plurality of I/Q signals, of which a part or a whole time delay is applied to.
    [0015]The method may further include determining the different frequencies of the plurality of I/Q signals within a band width of the ultrasound system based on a frequency of the ultrasound signal.
    [0016]The Doppler image may include a color Doppler image or Doppler spectrum.
    [0017]The converting the response signal into the plurality of I/Q signals may include mixing a plurality of carrier signals having different frequencies with the response signal.
    [0018]According to another aspect of the present invention, there is provided an apparatus for generating a Doppler image, including: a probe for transmitting a ultrasound signal to an object and for receiving a response signal reflected from the object; an in-phase/quadrature-phase (I/Q) demodulation unit for converting the response signal into a plurality of I/Q signals having different frequencies; and an image processing unit for generating a Doppler image of the object based on information about a speed of the object obtained from the plurality of I/Q signals.
    [0019]The apparatus may further include a first beam forming unit for receiving and focusing the response signal, wherein the I/Q demodulation unit converts the received and focused response signal into the plurality of I/Q signals.
    [0020]The apparatus may further include a second beam forming unit for applying time delay to a part or a whole of the plurality of I/Q signals, wherein the image processing unit generates the Doppler image of the object based on the information about the speed of the object obtained from the plurality of I/Q signals, of which a part or a whole time delay is applied to.
    [0021]The apparatus may further include a control unit for determining the different frequencies of the plurality of I/Q signals within a band width of the ultrasound system based on a frequency of the ultrasound signal.
    [0022]The Doppler image may include a color Doppler image or Doppler spectrum.
    [0023]The I/Q demodulation unit may include a plurality of mixers for mixing a plurality of carrier signals having predetermined frequencies with the response signal.
    [0024]According to another aspect of the present invention, there is provided a computer readable recording medium having recorded thereon a program for executing the method.
    [0025]BRIEF DESCRIPTION OF THE DRAWINGS The above and other features and advantages of the present invention will become more apparent by describing in detail exemplary embodiments thereof with reference to the attached drawings in which: FIG. 1A is a block diagram of a structure of a ultrasound system according to the related art; FIG. 1B is a block diagram of a structure of an in-phase/quadrature-phase (I/Q) demodulation unit of the ultrasound system illustrated in FIG. 1A ; FIG. 2 is a block diagram of a structure of an apparatus for generating a Doppler image according to an embodiment of the present invention; FIG. 3 is a block diagram of a structure of an apparatus for generating a Doppler image according to another embodiment of the present invention; FIG. 4 is a block diagram showing the flow of a signal in the apparatus for generating a Doppler image illustrated in FIG. 3 ; FIG. 5 is a block diagram of a structure of an apparatus for generating a Doppler image according to another embodiment of the present invention; FIG. 6 is a block diagram showing the flow of a signal in the apparatus for generating a Doppler image illustrated in FIG. 5 ; and FIG. 7 is a flowchart illustrating a method for generating a Doppler image according to an embodiment of the present invention.
    [0026]DETAILED DESCRIPTION OF THE INVENTION
    [0027]The present invention will now be described more fully with reference to the accompanying drawings, in which exemplary embodiments of the invention are shown. The invention may, however, be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the invention to those skilled in the art. Like reference numerals in the drawings denote like elements.
    [0028]The term ‘unit’ used herein refers to a software element, or a hardware element, such as FPGA or ASIC, wherein a ‘unit’ performs a certain function. However, the term ‘unit’ is not limited to software or hardware. A ‘unit’ may be configured on an addressable storage medium, or configured to reproduce one or more processors. Thus, the term ‘unit’ includes elements, such as software elements, object-oriented software elements, class elements, and task elements, processes, functions, properties, procedures, sub-routines, segments of a program code, drivers, firmware, a micro-code, tables, arrays, and variables. Elements and functions of ‘unit’s may be combined with a smaller number of elements and ‘unit’s or may be subdivided into additional elements and ‘unit’s.
    [0029]In the attached drawings, ‘arrow’ represents the flow of a signal.
    [0030]FIG. 1A is a block diagram of a structure of a ultrasound system 100 according to the related art.
    [0031]Referring to FIG. 1A , the ultrasound system 100 according to the related art includes a probe 110 , a transmit/receive (T/R) switch 120 , a transmission unit 130 , a control unit 140 , a beam forming unit 150 , an in-phase/quadrature-phase (I/Q) demodulation unit 160 , an image processing unit 170 , and a display unit 180 .
    [0032]The probe 110 includes a plurality of elements including piezoelectric devices. The probe 110 transmits a ultrasound signal to an object and receives a response signal reflected from the object. There may be a plurality of response signals.
    [0033]The ‘object’ used herein refers to an embryo, all kinds of organs of the body or a particular part of the body from which a ultrasound image is to be obtained. The probe 110 converts a response signal reflected from the object into an electric signal (RF reception signal).
    [0034]The T/R switch 120 controls the ultrasound system 100 to transmit the ultrasound signal from the transmission unit 130 to the probe 110 and to transmit the response signal from the probe 110 to the beam forming unit 150 under control of the control unit 140 .
    [0035]The transmission unit 130 generates a ultrasound signal based on a transmission control signal transmitted from the control unit 140 . In detail, the transmission unit 130 may increase or decrease a beam width of the ultrasound signal by analyzing the transmission control signal transmitted from the control unit 140 .
    [0036]The beam forming unit 150 focuses a plurality of received response signals and converts the plurality of focused response signals into one signal. Since a distance between each of the plurality of elements included in the probe 110 and the object differs, the response signals reflected from the object are not received by the probe 110 at the same time. Thus, the beam forming unit 150 applies time delay to a part or the whole of the plurality of received response signals, and converts the plurality of received response signals into one response signal by adding the plurality of received response signals.
    [0037]The I/Q demodulation unit 160 detects in-phase (I) and quadrature-phase (Q) signals in the form of a complex number based on the response signal outputted from the beam forming unit 150 .
    [0038]The image processing unit 170 obtains information about a speed of the object by using the I signal and the Q signal outputted from the I/Q demodulation unit 160 and generates a Doppler image that indicates a speed or direction of the object based on the obtained information about the speed of the object. The display unit 180 displays the Doppler image generated by the image processing unit 170 to a user.
    [0039]FIG. 1B is a block diagram of a structure of an in-phase/quadrature-phase (I/Q) demodulation unit 160 of the ultrasound system 100 illustrated in FIG. 1A . The I/Q demodulation unit 160 includes a high pass filter (HPF) 162 , a mixer 164 , and a low pass filter (LPF) 166 .
    [0040]The response signal outputted from the beam forming unit 150 are transmitted to the HPF 162 , and the HPF 162 removes direct current (DC) components from an RF signal.
    [0041]The mixer 164 mixes a carrier signal e −jwt with a signal transmitted from the HPF 162 . w represents a frequency of the carrier signal e −jwt . Since, according to the Euler's formular, e −jwt is cos(wt)+sin(wt), a carrier signal cos(wt) and a carrier signal sin(wt) are mixed with the signal transmitted from the HPF 162 . Thereafter, a response signal obtained by mixing the carrier signal cos(wt) and the carrier signal sin(wt) passes through the LPF 166 . Thus, an I signal including in-phase components, and a Q signal including quadrature-phase components are generated.
    [0042]The I/Q demodulation unit 160 of the ultrasound system 100 according to the related art converts the response signal outputted from the beam forming unit 150 into a pair of I/Q signals, and the image processing unit 170 obtains the information about the speed of the object by using the pair of I/Q signals. Thus, when an error or noise exists in the I/Q signal, the Doppler image may not be precisely obtained. An apparatus for generating a Doppler image according to an embodiment of the present invention obtains a plurality of I/Q signals and compares the plurality of I/Q signals to generate the Doppler image so that the problem that occurs in the ultrasound system 100 according to the related art may be solved.
    [0043]FIG. 2 is a block diagram of a structure of an apparatus 200 for generating a Doppler image according to an embodiment of the present invention.
    [0044]Referring to FIG. 2 , the apparatus 200 for generating a Doppler image may include a probe 210 , and an I/Q demodulation unit 220 or an image processing unit 230 .
    [0045]Although not shown in FIG. 2 , the apparatus 200 for generating a Doppler image according to the present embodiment may include the structure of the ultrasound system illustrated in FIG. 1A , according to the related art.
    [0046]The probe 210 transmits a ultrasound signal to an object and receives a response signal reflected from an object. There may be a plurality of ultrasound signals and a plurality of response signals.
    [0047]The I/Q demodulation unit 220 converts the response signal into a plurality of I/Q signals having different frequencies.
    [0048]In the apparatus 200 for generating a Doppler image according to the present embodiment, the I/Q demodulation unit 220 may include a plurality of mixers that mixes a carrier signal having a predetermined frequency with the response signal. The plurality of mixers each mixes carrier signals having different frequencies with the response signal so that a plurality of I/Q signals having different frequencies may be obtained by the I/Q demodulation unit 220 .
    [0049]The image processing unit 230 obtains information about a speed of the object from the plurality of I/Q signals outputted from the I/Q demodulation unit 220 . The ‘information about the speed’ may include information about a speed or direction of the object. It would be obvious to one of ordinary skill in the art that the speed and movement direction of the object are obtained using the response signals or the I/Q signals and thus, detailed descriptions thereof are omitted.
    [0050]The image processing unit 230 generates a Doppler image of the object based on the information about the speed of the object.
    [0051]Since the apparatus 200 for generating a Doppler image according to the present embodiment generates the Doppler image by using the plurality of I/Q signals, the Doppler image having higher quality than a Doppler image generated using only one I/Q signal may be generated.
    [0052]The image processing unit 230 may obtain the information about the speed of the object in consideration of only the I/Q signals other than the I/Q signals including an error or noise from among the plurality of I/Q signals.
    [0053]The Doppler image generated by the image processing unit 230 may include a color Doppler image or a Doppler spectrum.
    [0054]The apparatus 200 for generating a Doppler image according to the present embodiment may further include an analog to digital converter (ADC)(not shown) that converts the response signal received by the probe 210 into a digital signal.
    [0055]FIG. 3 is a block diagram of a structure of an apparatus 200 for generating a Doppler image according to another embodiment of the present invention.
    [0056]Referring to FIG. 3 , the apparatus 200 for generating a Doppler image according to the present embodiment may include a probe 210 , a first beam forming unit 215 , an I/Q demodulation unit 220 , an image processing unit 230 , a control unit 240 or a display unit 250 . The probe 210 , the I/Q demodulation unit 220 , and the image processing unit 230 are the same as those of FIG. 2 and thus, detailed descriptions thereof are omitted.
    [0057]The first beam forming unit 215 receives a plurality of response signals from the probe 210 and focuses the plurality of response signals. In detail, the first beam forming unit 215 makes timing of the response signals coincident by applying time delay to a part or the whole of the plurality of response signals, adds the plurality of I/Q signals, of which a part or the whole time delay is applied to, to generate one response signal.
    [0058]The I/Q demodulation unit 220 converts the one response signal into a plurality of I/Q signals, and the image processing unit 230 generates a Doppler image based on the plurality of I/Q signals.
    [0059]The display unit 250 displays the Doppler image generated by the image processing unit 230 to a user.
    [0060]The control unit 240 sets frequencies of a plurality of carrier signals to be mixed with the one response signal. The frequencies of the plurality of carrier signals may be set differently, and the control unit 240 may set the frequencies of the plurality of carrier signals within a range of a band width that may be processed by the apparatus 200 based on a frequency of the ultrasound signal transmitted to the object. In detail, when an intermediate frequency of the ultrasound signal transmitted to the object is f 0 , the frequencies of the plurality of carrier signals may be set to f 0 +a, f 0 −a, f 0 +b, f 0 −b, and . . . .
    [0061]FIG. 4 is a block diagram showing the flow of a signal in the apparatus 200 for generating a Doppler image illustrated in FIG. 3 .
    [0062]A plurality of response signal are transmitted to the first beam forming unit 215 via elements 212 of the probe 210 , and the first beam forming unit 215 receives and focuses the plurality of response signals to output one response signal.
    [0063]The one response signal is inputted to a plurality of mixers included in the I/Q demodulation unit 220 , and a plurality of I/Q signals is outputted from the plurality of mixers and is inputted to the image processing unit 230 .
    [0064]Referring to FIG. 4 , carrier signals having different frequencies w 1 , w 2 , w 3 , and . . . may be mixed with the one response signal.
    [0065]FIG. 5 is a block diagram of a structure of an apparatus 200 for generating a Doppler image according to another embodiment of the present invention.
    [0066]Referring to FIG. 5 , the apparatus 200 for generating a Doppler image according to the present embodiment may include a probe 210 , an I/Q demodulation unit 220 , a second beam forming unit 225 , an image processing unit 230 , a display unit 250 or a control unit 240 .
    [0067]Unlike the apparatus 200 for generating a Doppler image illustrated in FIG. 3 , in the apparatus 200 for generating a Doppler image illustrated in FIG. 5 , the location of the I/Q demodulation unit and the location of the beam forming unit may be reversed.
    [0068]FIG. 6 is a block diagram showing the flow of a signal in the apparatus 200 for generating a Doppler image illustrated in FIG. 5 .
    [0069]Referring to FIG. 6 , each of a plurality of response signals is inputted from elements 212 of the probe 210 to a plurality of mixers included in the I/Q demodulation unit 220 , and the plurality of mixers outputs a plurality of I/Q signals.
    [0070]The plurality of I/Q signals is inputted to the second beam forming unit 225 , and the second beam forming unit 225 makes timing of the plurality of I/Q signals coincident by applying time delay to a part or the whole of the plurality of I/Q signals.
    [0071]The second beam forming unit 225 illustrated in FIG. 6 does not add the plurality of I/Q signals, of which a part or the whole time delay is applied to, unlike the first beam forming unit 215 illustrated in FIG. 4 , in order to improve the quality of the Doppler image generated by the image processing unit 230 by transmitting a plurality of data to the image processing unit 230 .
    [0072]FIG. 7 is a flowchart illustrating a method for generating a Doppler image according to an embodiment of the present invention. Referring to FIG. 7 , the method for generating a Doppler image according to the present embodiment includes operations to be performed by the apparatus 200 for generating a Doppler image illustrated in FIG. 2, 3 , or 5 based on a time sequence. Thus, although omitted below, the descriptions of the apparatus 200 for generating a Doppler image illustrated in FIG. 2, 3 , or 5 may apply to the method for generating a Doppler image illustrated in FIG. 7 .
    [0073]First, in operation S 10 , a ultrasound system transmits a ultrasound signal to an object.
    [0074]In operation S 20 , the ultrasound system receives a response signal reflected from the object.
    [0075]In operation S 30 , the ultrasound system converts the received response signal into a plurality of I/Q signals. In detail, the ultrasound signal may generate a plurality of I/Q signals by mixing a plurality of carrier signals having different frequencies with the response signal. The frequencies of the plurality of carrier signals may be set in a range of a band width of the ultrasound system based on a frequency of the ultrasound signal transmitted to the object.
    [0076]In operation S 40 , the ultrasound system obtains information about a speed of the object based on the plurality of I/O signals and generates a Doppler image by using the information about the speed of the object. The Doppler image may include a color Doppler image or Doppler spectrum.
    [0077]The embodiments of the present invention can be written as computer programs and can be implemented in general-use digital computers that execute the programs using a computer readable recording medium.
    [0078]As described above, in the apparatus and method for generating a Doppler image according to the one or more embodiments of the present invention, a signal to noise ratio (SNR) of a Doppler signal may be improved using a plurality of in-phase/quadrature-phase (I/Q) signals.
    [0079]In addition, in the apparatus and method for generating a Doppler image according to the one or more embodiments of the present invention, the quality of the Doppler image may be improved.
    [0080]Examples of the computer readable recording medium include magnetic storage media (e.g., ROM, floppy disks, hard disks, etc.), optical recording media (e.g., CD-ROMs, or DVDs), etc.
    [0081]While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims.
    同族专利
    暂无同族专利