Spinal muscular atrophy with respiratory distress type 1 (SMARD1), a notably common form of non-5q-spinal muscular atrophy, can be confused with infantile spinal muscular atrophy and is characterized by the early onset of diaphragmatic palsy and predominantly distal muscle weakness. The defective gene, immunoglobulin mu-binding protein 2 (IGHMBP2), is located on chromosome 11q13-q21. In this study, we screened the IGHMBP2 gene in 53 unrelated Han Chinese non-5q-spinal muscular atrophy patients and 100 healthy controls. Two novel mutations (c.711_1G>C and c.1817G>A) and 5 nucleotide polymorphisms (c.57T>C, c.1554C>T, c.1914G>A, c.2080C>T, and c.2270G>C) were identified. However, only 1 patient harbored the compound heterozygous mutations (c.711+1G>C, c.1817G>A). Furthermore, the homozygous c.2636C>A (p.T879 K) variation, which has been included as a mutation in the Human Gene Mutation Database, was found both in patients and healthy individuals. In conclusion, the IGHMBP2 gene was not found to be a major causative gene linked to Han Chinese non-5q-spinal muscular atrophy patients.

Neuromyelitis optica (NMO) is a disease distinct from multiple sclerosis in terms of clinical and magnetic resonance imaging (MRI) manifestations. Antibody to aquaporin-4 (AQP4) has been identified as a specific biomarker and part of the diagnostic criteria for NMO. Although it is relatively common in Asia, a comprehensive clinical and imaging evaluation of NMO has not been reported in Chinese patients. Here, we reviewed data from 57 Chinese cases. The patients had an obvious female preponderance (female/male = 8.5:1), and transverse myelitis (82.5%) and optic neuritis (56.1%) were the most common manifestations. In MRI, longitudinally extensive transverse myelitis (6.9 ± 2.3 segments) dominated the spinal cord lesions, which were mainly (69.7%) distributed in cervical and thoracic cord. However, the length of the lesions was not correlated with onset age, paralysis severity, relapse rate, or duration. Among 29 patients who underwent AQP4 antibody assay, 17 (58.6%) were positive. There was no difference between seropositive and seronegative patients in terms of female preponderance, onset age, relapse rate, and Expanded Disability Status Scale score. However, seropositive patients had significantly more damaged segments (8.3 ± 3.5) than did seronegative patients (4.5 ± 1.6) (p < 0.001). The data revealed the clinical and MRI characteristics and AQP4 antibody status of NMO in Chinese patients and the correlations between them, which may have important implications for the diagnosis of the disease.

Many major inherited neurological disorders are characterized by early childhood onset, high lethality rate, and the absence of effective treatments. A poor understanding of the underlying mechanisms of such disorders is partly because of the scarcity of patient-specific samples. In this study, we cultured the urine sediments of such patients, aiming to explore the capacity of urine cell cultures to obtain specimens from patients suffering from rare inherited neurological diseases. We collected fresh urine from a variety of neurogenetic patients; cultured the specimens; generated different urine cell lines; and classified these cell lines through morphology, reverse transcription-PCR, and immunofluorescence. We then used these cell lines to detect the affected genes in spinal muscular atrophy and Duchenne muscular dystrophy. We successfully established cell lines from patients with spinal muscular atrophy, Duchenne muscular dystrophy, paroxysmal kinesigenic dyskinesia, and Wilson’s disease. All established cell lines consisted of urinary tract epithelial cells and podocytes, and had the same gene defects as the blood specimens. Urine cell culture is thus a new, simple, and noninvasive avenue for getting patient-specific samples not only for genetic diagnosis, but also for storing the samples from patients with rare neurological inherited diseases.

Spinal muscular atrophy (SMA) is a common and lethal autosomal recessive neurodegenerative disorder, which is caused by mutations of the survival motor neuron 1 (SMN1) gene. Additionally, the phenotype is modified by several genes nearby SMN1 in the 5q13 region. In this study, we analyzed mutations in SMN1 and quantified the modifying genes, including SMN2, NAIP, GTF2H2, and H4F5 by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), TA cloning, allele-specific long-range PCR, and Sanger sequencing in 157 SMA patients. Most SMA patients (94.90%) possessed a homozygous SMN1 deletion, while 10 patients demonstrated only the absence of exon 7, but the presence of exon 8. Two missense mutations (c.689 C>T and c.844 C>T) were identified in 2 patients who both carried a single copy of SMN1. We found inverse correlations between SMN2, the NAIP copy number, and the clinical severity of the disease. Furthermore, 7 severe type I patients possessed large-scale deletions, including SMN1, NAIP, and GTF2H2. We conclude that SMN1 gene conversion, SMN1 subtle mutations, SMN2 copy number, and the extent of deletion in the 5q13 region should all be considered in the genotype–phenotype analysis of SMA.

Idiopathic basal ganglia calcification (IBGC) is a rare neuropsychiatric disorder characterized by bilateral and symmetric cerebral calcifications. Recently, SLC20A2 was identified as a causative gene for familial IBGC, and three mutations were reported in a northern Chinese population. Here, we aimed to explore the mutation spectrum of SLC20A2 in a southern Chinese population. Sanger sequencing was employed to screen mutations within SLC20A2 in two IBGC families and 14 sporadic IBGC cases from a southern Han Chinese population. Four novel mutations (c.82G > A p.D28N, c.185T > C p.L62P, c.1470_1478delGCAGGTCCT p.Q491_L493del and c.935-1G > A) were identified in two families and two sporadic cases, respectively; none were detected in 200 unrelated controls. No mutation was found in the remaining 12 patients. Different mutations may result in varied phenotypes, including brain calcification and clinical manifestations. Our study supports the hypothesis that SLC20A2 is a causative gene of IBGC and expands the mutation spectrum of SLC20A2, which facilitates the understanding of the genotype–phenotype correlation of IBGC.

Background: Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation.Methods: Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers.Results: Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C > T, c.2302C > T, c.7148dupT, c.10855C > T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype-phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons.Conclusion: The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations. (C) 2013 Elsevier B.V. All rights reserved.

Background: As a lethal autosomal recessive hereditary disorder, childhood spinal muscular atrophy (SMA) is caused by mutations of the survival motor neuron 1 (SMN1) gene. Most of the patients died at early stage or were seriously disabled, which accounts partly for the scarcity of two continuous generations with SMA Increasing evidence indicated that SMN2 copy number was a modifier of SMA, but in majority of sporadic patients, the bias of phenotype judgments may largely reduce the accuracy of genotype-phenotype analysis.Methods: We presented two families with SMN1-deleted individuals in two continuous generations, the father and daughter of family 1 and the mother and daughter of family 2 were determined to be hornozygous for the deletion of the SMN1 gene. Quantitative analysis of SMN1 and SMN2 was carried out by real-time fluorescence quantitative PCR and multiplex ligation-dependent probe amplification.Results: Quantitative analysis showed that the father of family 1 possessed three copies of SMN2, and his daughter had only two SMN2 copies: the slightly affected mother of family 2 had three copies of SMN2, but her sick daughter had only two copies of SMN2: we also performed prenatal prediction for family 1 and a healthy boy was born under our suggestion.Conclusion: For the phenotypes of patients from different generations within the same family are obviously different, the results of a genotype-phenotype analysis may be more convincing, which strongly support the hypothesis that SMN2 is an important modifier for SMA, and SMN2 copy number should be considered in the prenatal diagnosis situation. (C) 2012 Elsevier B.V. All rights reserved.

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of "AGGGAACAGATCCTGGTAAAGCA" fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Multiple acyl-CoA dehydrogenation deficiency (MADD) is an autosomal recessive disease affecting amino acid, fatty acid, and choline metabolisms and is a common genetic defect responsible for lipid storage myopathy. Most forms of MADD are caused by a deficiency of electron transfer flavoprotein (ETF) or ETF dehydrogenase (ETFDH). However, its molecular feature has not been found uniformly in previous reports of Chinese patients. A large cohort of 56 late-onset MADD patients from 51 unrelated pedigrees in southern China was recruited to investigate a clear correlation between clinical phenotype and molecular genetic basis. All exons of ETFA, ETFB, and ETFDH, including the intron–exon boundaries, and 5′ and 3′ untranslated regions were directly sequenced. ETFDH deficiencies affected 94.1% (48/51) of the pedigrees. ETFDH-c.250G>A is the most common mutation, representing a high allelic frequency of 83.3% (80/96). Carrier frequency of c.250G>A is estimated to be 1.35% (7/520) in the normal population. A significant reduced expression of ETFDH was identified in the muscle of ETFDH-deficient patients. ETFDH deficiency is a major cause of riboflavin-responsive MADD in southern China, and c.250G>A is an important mutation that could be employed as a fast and reliable screening method.

The association of R219K and V825I polymorphisms of ABCA1 gene with cerebral infarction has been rarely reported. Here we wish to address this issue. A total of 476 subjects from Chinese Han ethnic population were investigated, including 152 control individuals and 324 patients with cerebral infarction. Genotyping of R219K and V825I were performed by PCR-RFLP analysis. Data were analyzed using a statistical package. The R219K genotype frequency distributions were significantly different between patients with atherothrombotic cerebral infarction (ACI) and control individuals, with fewer KK genotypes and more RR genotypes in ACI patients (chi(2)=9.89, P<0.01). The K allele is less frequent among ACI patients than in controls (chi(2)=9.16, P<0.005). A significant association of KK with decreased ACI risk was exhibited, especially in male patients, aged patients and individuals with hypertension. These results indicate that the K allele of R219K polymorphism is an independent protective factor against ACI. In addition, though there is no association of V825I with ACI, this polymorphism may have certain synergistic effect with hypertension in susceptibility to ACI.

DNA methylation is a work of adding a methyl group to the 5th carbon atom of cytosine in DNA sequence under the catalysis of DNA methyltransferase (DNMT) to produce 5-methyl cytosine. Some current studies have elucidated the mechanism of lung cancer occurrence and causes of lung cancer progression and metastasis from the perspective of DNA methylation. Moreover, many studies have shown that smoking can change the methylation status of some gene loci, leading to the occurrence of lung cancer, especially central lung cancer. This review mainly introduces the role of DNA methylation in the pathogenesis, early diagnosis and screening, progression and metastasis, treatment, and prognosis of lung cancer, as well as the latest progress. We point out that methylation markers, sample tests, and methylation detection limit the clinical application of DNA methylation. If the liquid biopsy is to become the main force in lung cancer diagnosis, it must make efficient use of limited samples and improve the sensitivity and specificity of the tests. In addition, we also put forward our views on the future development direction of DNA methylation.

BACKGROUND:Machado-Joseph disease (MJD), caused by a CAG repeat expansion located in exon10 of the ATXN3 gene, is now regarded as one of the most common spinocerebellar ataxia (SCA) in the world. The relative frequency of MJD among SCA has previously been estimated at about 50% in the Chinese population and has been reported to be related to the frequency of large normal alleles in some populations. Taq polymerase has been used for PCR in nearly all studies reported previously.METHODS:Normal and expanded alleles of ATXN3 were detected via PCR using LA Taq DNA polymerase (better for GC-rich sequences) and denaturing polyacrylamide gel electrophoresis in 150 normal individuals and 138 unrelated probands from autosomal dominant SCA families. To compare reaction efficiency, 12 MJD patients' expanded alleles were amplified with La Taq and Taq polymerase respectively in the same amplifying systems and reaction conditions.RESULTS:Normal alleles ranged from 12 to 42 CAG repeats. The most common allele contained 14 repeats with a frequency of 23.3%, which corroborates previous reports. The frequency of large normal alleles (>27 repeats) was 0.28, which was very high relative to previous reports. The frequency of MJD in SCA patients was 72.5%, which was significantly higher than those in previous reports about the Chinese and other Asian populations. This frequency was one of the highest reported worldwide, with only Portuguese and Brazilian populations exhibiting higher proportions. All 12 expanded alleles were amplified in PCR with La Taq polymerase, whereas only 2 expanded alleles were amplified with Taq polymerase.CONCLUSION:We have first reported the highest relative frequency of MJD in Asia, and we attribute this high frequency to a more efficient PCR using LA Taq polymerase and hypothesized that large ANs may act as a reservoir for expanded alleles in the Southeastern Chinese population.

Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.

OBJECTIVE:To investigate the characteristics of gene structure in facioscapulohumeral muscular dystrophy (FSHD)-related 4q35 subtelomere, to analyze the distribution of 2 alleles (4qA and 4qB) distal to D4Z4 of this locus, and to further elucidate the genotype-phenotype correlation in Chinese Han FSHD patients. METHODS:Peripheral blood samples were collected from 52 unrelated families including 62 FSHD-affected and 57 unaffected members. Genomic DNA was extracted from the lymphocytes according to the specific procedure designed to minimize DNA shearing, then digested with EcoRI or HindIII, or double digested with EcoRI and BlnI. The cleaved DNA was separated by pulsed field electrophoresis (PFGE) and Southern blotting with the probes p13E-11, 4qA, and 4qB. The size of FSHD-causing 4qA allele and its distribution was analyzed by "curve fitting". Then the characteristics of translocation and mosaicism, the frequencies of two allelic variants of chromosome 4q and their genotypes were calculated to analyze the genotype-phenotype correlation. RESULTS:It was found that 69 patients carried a short chromosome 4-type allele of 4qA origin with the length 10-38 kb. The mean length of these pathogenic EcoRI/4qA arrays was 20 kb+/-7 kb, without significant difference between the sporadic cases and familial cases (t=1.413, P>0.05). Three different translocation types were observed with a translocation rate of 14.49%. The rate of 4q-->10q translocation was 13.04%, significantly higher than that of 10q-->4q translocation (1.45%, chi2=6.900, P<0.05). Somatic mosaicism was detected in a male sporadic case and a female asymptomatic familial case. In 57 cases with standard configuration distribution, the frequency of 4qA/4qB heterozygote was 61.40%, significantly higher than that of 4qA/4qA homozygote (38.60%, (chi2=5.930, P<0.05). There were not significant differences in the repeat size distributions and assessment of clinical severity between the sporadic and familial cases (t=-0.039, P>0.05; H=0.693, P>0.05). CONCLUSION:About 95% of Chinese FSHD patients carry a pathogenic 4-type allele of 4qA origin less than 30 kb long. The frequent translocations between chromosome 4q and 10q may play an essential role for FSHD mechanism. The frequency of 4qA/4qB heterozygote is significantly higher than that of 4qA/4qA homozygote, while the allelic variant genotypes do not contribute to modify FSHD manifestations.

Objective To investigate distribution of CAG repeat in the CACNA1A gene in theChinese Han population and its application in molecular diagnosis of spinocerebellar ataxia type 6(SCA6).Methods The trinucleotide repeats of CAG were detected by two-step polymerase chain reaction(PCR).denaturing polyacrylamide gel electrophoresis(DPAGE)and DNA sequencing in 300 normal individuals and 109 unrelated SCA patients.Results In normal individuals.the number of CAG repeats ranged from 3 to 18 with 13 being the most frequent repeats.In 109 SCA patients,one patient was identified of 24 repeats and was diagnosed with SCA6.This patient's mother and elder brother were also SCA6 patients.They all showed slowly progressive cerebellar ataxia,dysarthria,nystagmus,minor impairment in vibration sensation and proprioeeptive sensation in clinical manifestation with obvious anticipation.Conclusions SCA6 is rare in the Chinese Population.Mutation analysis of the CACNA1A gene is helpful for clinical diagnosis of SCA6.Two-step PCR increases the efficieney of molecular diagnosis in SCA6.

Objective To screen the mutation and analysis its characteristics of SPG4 and SPG3A in Chinese patients with hereditary spastic paraplegia (HSP).Methods Mutation and polymorphism of the SPG4 and SPG3A were screened in the index eases of 26 autesomal dominant families (AD-HSP) and 30 sporadic cases by combination of DHPLC and sequencing analysis, then the index cases of 26 AD-HSP were further confirmed with direct sequencing.Results One novel mutation of SPG4, 1616 + 1g→t, was identified in the index ease from an AD-HSP family.Three symptomatic patients and 2 pre-symptomatic patients were found in this family by sequencing analysis.No mutation of SPG3A was detected.In addition, 8 novel SPG4 polymorphisms and 3 novel SPG3A polymorphisms were identified.Conclusions The study has broadened the mutation and polymorphism spectrums of SPG4 and SPG3A.Mutation of these two genes is less common in this group of patients.

Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.

Background: To date, 81 mutations of ATP-binding cassette transporter 1 (ABCA1) have been reported. However, no ABCA1 mutation has been reported in the Chinese population. Methods: We used direct sequencing to screen for ABCA1 mutations in 72 patients with both atherosclerotic cerebral infarction (ACI) and plasma high-density lipoprotein cholesterol (HDL-C) < 0.8 mmol/l. The functionality of the mutation was verified using 200 unrelated controls and 76 patients with ACI and normal HDL-C by PCR-RFLP analysis. Results: One patient with dementia prior to ACI was found to carry the heterozygous Y2206D mutation, which has not been reported previously. The patient had a medical history of atherosclerosis in the coronary and carotid arteries going back 40 years and splenohepatomegalia for 13 years, with a low plasma HDL-C level (0.66 mmol/l) and apolipoprotein A1 level (0.61 mmol/l). During the past decade, he had developed symptoms of dementia. Sixteen months prior to the study, he was admitted to hospital for an ACI. Conclusion: The results suggest that this patient is most likely a patient with familial hypoalphalipoproteinemia and that the Y2206D mutation may be associated with not only a lower level of HDL-C, but also with dementia.

Background Neuroglobin ( Ngb ), one of novel members of the globin superfamily, is expressed predominantly in brain neurons, and appears to modulate hypoxic-ischemic insults. The mechanisms underlying Ngb -mediated neuronal protection are still unclear. For it is one of the candidate protective factors for ischemic stroke, we conducted a case-control study to clarify the association of Ngb polymorphisms with ischemic stroke in the Southern Chinese Han population. Methods 355 cases and 158 controls were recruited. With brain imaging, cases were subdivided into large-artery atherosclerosis (LVD) and small-vessel occlusion (SVD) stroke. PCR amplified all the four exons of Ngb and flanking intron sequence for each exon. Genotyping for Ngb was achieved by direct sequencing and mismatched PCR-RFLP. Polymorphisms were studied both individually and as haplotypes in each group and subgroup which subdivided according to gender or age. Results Two intronic polymorphisms 89+104 c>t and 322-110 (6a)>5a were identified. The allele frequency of 89+104 t was decreased in stroke cases. The protective effect seems to be more pronounced in subgroups of female patients and age > 60 years. Also, we have confirmed decreased LDL-C level and reduced hypertension and hypercholesterolemia in 89+104 t allele carriers. In contrast, the 322-110 (6a)>5a genotype distribution was similar between cases and controls. However, the haplotype 89+104 c>t/322-110 (6a)>5a was related with LVD and SVD stroke. The haplotype c-5a was more frequent in both LVD and SVD groups while t-6a was more frequent in controls. Conclusion Ngb polymorphism 89+104 t had protective effects on LVD and SVD in the Southern Chinese Han population. A "hitchhiking" effect was observed for the 89+104 t/322-110 (6a) genotype combination especially for LVD.

<正>Sp3(specific protein3)基因是一种广泛存在于人体组织的核转录因子,属于Sp家族成员之一[1],它通过GC/GT盒与受其调控的基因启动子相结合[2,3],从而调控这些基因的表达,这些基因中许多与免疫反应有关,包括诱导凋亡的Fas基因,转化生长因子-(TGF-)、T细胞受体可变区Vα(TCRVα)基因及艾滋病毒1型(HIV-1)等[4￣6]。