Adaptive immunity is well-established in lupus pathogenesis, yet the clinical significance of innate immune components, particularly natural killer (NK) cells, remains underexplored. This study aims to evaluate the clinical relevance of NK cell levels in treatment-naïve, infection-free patients with childhood-onset systemic lupus erythematosus (cSLE). We conducted a retrospective cohort study among 96 treatment-naïve, infection-free cSLE patients diagnosed during 2015–2025. Logistic regression was applied to compare patients of moderate-to-severe disease activity (SLEDAI > 9) versus low disease activity (SLEDAI ≤ 9), and to assess the associations between NK cell levels and organ involvement. Cox regression analysis was performed to evaluate the effect of baseline NK cell counts on the time to first remission. To evaluate whether longitudinal changes in absolute NK cell counts are associated with the timing of initial remission, we performed a linear mixed-effects model analysis in the subset of patients with serial NK cell data. Both absolute NK cell counts and percentages were lower than healthy references. Anti-dsDNA positivity (OR = 5.107, 95

Background Autosomal dominant tubulointerstitial kidney disease (ADTKD) is a rare genetic disorder characterized by tubular damage and interstitial fibrosis, with inescapable progression to end-stage renal disease. SEC61A1-related ADTKD has long been neglected and underrecognized because of its rarity, insidious onset and variable clinical manifestations. Results A 13-year-old boy was referred to the pediatric nephrology clinic due to renal insufficiency, which had been found unexpectedly while visiting the hospital because of growth retardation. He had normocytic normochromic anemia since early childhood and was recently found to have agranulocytosis. The evaluation suggested elevated serum creatinine, hyperuricemia, bland urinary sediment, the absence of proteinuria, and renal cysts. A novel de novo heterozygous missense variant in SEC61A1, Ser71Pro, was found. So far fifteen patients with SEC61A1-related ADTKD have been reported, most of whom presented with early-onset chronic kidney disease and hyperuricemia. The extrarenal features included growth retardation, hematological abnormalities, cognitive impairment, and immunological abnormalities. There is no specific treatment for the SEC61A1-related ADTKD. Most reported patients survived to adulthood with supportive treatment. Conclusions This is the first case of SEC61A1-related ADTKD of Chinese origin, extending its phenotype and mutation spectrum. The diagnosis of SEC61A1-related ADTKD should be considered in patients with early-onset or familial chronic kidney disease, hematological abnormalities and growth retardation, and mutation analysis of SEC61A1 is needed.

OBJECTIVE:To investigate the association between genetic polymorphisms (CYP2B6, CYP2C19, GSTP1) and haplotypes of cyclophosphamide (CTX)-metabolizing enzymes with therapeutic efficacy and adverse drug reactions (ADRs) in pediatric patients with lupus nephritis (LN). METHODS:A retrospective cohort study was conducted on 46 childhood-onset LN patients treated with CTX pulse therapy at Peking Union Medical College Hospital. Genetic polymorphisms of CYP2B6, CYP2C19, and GSTP1 were analyzed using blood samples. Patients were stratified into effective (n = 38) versus ineffective (n = 8) groups based on 3-month clinical outcomes, and adverse reaction (n = 13) versus control (n = 33) groups. Genotype/allele frequencies and haplotype distributions were compared using χ2 tests, Hardy-Weinberg equilibrium, and PHASE 2.1 software. RESULTS:Mutations in CYP2C19 (rs4244285) and GSTP1 (rs1695) were associated with reduced therapeutic efficacy (p < 0.05). No significant differences in genotype/allele frequencies were observed between adverse reaction and control groups (p > 0.05). Haplotype distribution frequencies showed no association with ADRs and efficacy. CONCLUSION:CYP2C19 × 2 and GSTP1 polymorphisms may reduce CTX efficacy in pediatric LN patients. Genetic variations showed no correlation with ADRs. These findings highlight the potential of pharmacogenetic testing to guide CTX therapy, though larger prospective studies are needed for validation. CLINICAL TRIAL NUMBER:Not applicable.

Monoclonal antibodies have greatly changed the treatment of pediatric immune-mediated diseases (PIMDs) and have become the main treatment method for patients who do not respond to conventional therapy. However, there are many challenges in developing pediatric dosing regimens. The pharmacokinetics of monoclonal antibodies differ between adults and children due to dynamic, age-related physiological changes that affect target-mediated clearance, FcRn-mediated recycling, and fluid volume distribution. Pediatric dosing regimens typically employ weight-based and weight-stratified dosing that are extrapolated based on adult data and often result in subsequent treatment failure. This review provides a comprehensive analysis of current research on the pharmacokinetics of pediatric monoclonal antibodies, discussing the application of population pharmacokinetics and physiologically based pharmacokinetic modeling. In addition, the exposure-response relationship and the role of therapeutic drug monitoring in dose optimization are summarized. Overall, the current understanding of pharmacokinetics and pharmacodynamic behaviors specific to the child population is not comprehensive, and clinical translation remains hindered by the diversity of reported endpoints and the lack of external validation for existing models. Therefore, the future of precision dosing lies in moving beyond simple exposure matching to pharmacodynamic (PD) endpoint-based treatment regimens. Finally, we propose a feasible pathway that integrates next-generation mechanistic models with artificial intelligence (AI) and clinical decision support systems (CDSS) to bridge the gap between computational evidence and clinical applications.

Objectives We identified a case of early-onset systemic lupus erythematosus (SLE) characterised by acute immune thrombocytopenia, recurrent fever, pneumonia, myocardial damage, thyroid dysfunction, lymphadenopathy, hepatosplenomegaly, and intracranial calcification. Our objective was to investigate the genetic and molecular mechanisms underlying the disease. Methods Whole exome sequencing and targeted sequencing were performed and a somatic mutation in TLR7 was identified. RNA sequencing, quantitative polymerase chain reaction (qPCR), intracellular cytokine staining, and phospho-flow cytometry were performed to characterise inflammatory signatures. In addition, nuclear factor κB dual-luciferase reporter assays, qPCR, and RNA pull-down assays were performed to assess the functional impact of the TLR7 mutation on immune signalling. Results We identified a novel somatic TLR7 mutation (p.Phe506Ser) that is likely to arise during early embryonic development. This mutation led to transcriptional upregulation of proinflammatory cytokines and interferon-stimulated genes, such as TNF and IFI27, with significant increases in intracellular cytokine expression, including TNF, following stimulation with the ligand single-stranded RNA (ssRNA) and the agonist R848 in the patient's peripheral blood mononuclear cells (PBMCs). In addition, functional analysis in HEK293T cells demonstrated that the mutant TLR7 exhibited increased binding affinity for ssRNA and enhanced responsiveness to agonists, resulting in hyperactivation of TLR7-mediated signalling. Conclusions We report the first case of early-onset SLE caused by a somatic TLR7 gain-of-function mutation. Our findings demonstrate that the TLR7 F506S mutation drives excessive proinflammatory signalling in the patient's PBMCs, contributing to disease pathogenesis.

The structural complexity arising from diverse glycosidic linkages in oligosaccharides hinders the elucidation of their biological functions. Existing analytical methods often lack the necessary feasibility and accessibility for comprehensive linkage analysis. To address this, we developed Derivatization-Enhanced EIEIO-Driven Glycosidic Linkage Sequencing (DEED-GL-Seq), a novel strategy leveraging differential electron density modulation around glycosidic bonds upon N2,N2,N4,N4-tetraethyl-6-hydrazineyl-1,3,5-triazine-2,4-diamine (T3) derivatization. This method integrates EIEIO MS2 to identify glycosidic bond-specific diagnostic fragments for linkage determination. Validation confirmed DEED-GL-Seq's specificity, sensitivity, reliability, and standard-independence. Coupling with fine-tuned HILIC separation further enhanced its analytical power for complex matrices. We applied DEED-GL-Seq to profile oligosaccharides derived from partially hydrolyzed glycogen, validating our results against reference standards. By analyzing the abundance ratios of specific trisaccharides, we predicted the branching degrees of glycogen and amylopectin, corroborating existing literature. Notably, DEED-GL-Seq identified established (Glc₄) and novel (HEX-1, HEX-2, HEPTA-1, HEPTA-2) potential glycosidic biomarkers for GSD-II in urine, with the novel oligosaccharides showing superior diagnostic performance. The unique structure of HEX-2 suggests distinct biosynthetic pathways in GSD-II pathophysiology. DEED-GL-Seq represents a significant advancement in glycomics, offering a powerful tool for comprehensive oligosaccharide profiling and laying a foundation for in-depth functional investigations. This work presents a novel application paradigm for EIEIO technology.

Hepatocellular adenoma (HCA) can occur in patients with glycogen storage disease type Ia (GSDIa), which is caused by mutations in the glucose-6-phosphatase gene (G6PC). Studies on HCA in GSDIa patients are limited and show variable results. Larger cohorts of GSDIa patients with HCA should be investigated. In this study, we examined the clinical characteristics and G6PC genotypes of 50 patients with HCA among 164 GSDIa cases. The incidence of HCA in GSDIa patients was 30.5

Juvenile systemic sclerosis (jSSc) can lead to permanent and irreversible anatomical or physiological dysfunction. The Scleroderma Clinical Trials Consortium-Damage Index (SCTC-DI), which has been employed and validated in adult patients, can quantify organ damage and predict mortality and morbidity. However, its application in paediatric patients remains unexplored. Clinical data, laboratory results, and prognostic information were collected for patients with jSSc at Peking Union Medical College Hospital (PUMCH) from January 2012 and January 2024. Differences between the SCTC-DI and the juvenile systemic sclerosis severity score (J4S) were recorded and compared. Furthermore, we compared the SCTC-DI between jSSc and adult systemic sclerosis (SSc) patients. A total of 64 jSSc patients were included. Facet joint contractures, fingertip ulcers and interstitial lung disease are common manifestations. Compared with adult SSc patients, jSSc patients had a lower incidence of gastrointestinal and urinary system involvement. The baseline J4S levels were significantly correlated with SCTC-DI levels at follow-up. A higher baseline SCTC-DI score was associated with a greater progression of organ damage (P = 0.001). There are differences in clinical presentations between adult SSc patients and jSSc patients. The SCTC-DI can be applied to JSSc patients, and it is recommended that JSSc patients undergo regular evaluations of the J4S as well as the SCTC-DI.

Systemic juvenile idiopathic arthritis (sJIA) is an autoinflammatory disorder characterized by systemic immune dysregulation, yet reliable biomarkers to predict its unpredictable disease course are lacking. Identifying immune cell subsets and molecular drivers of disease progression is essential for improving prognosis and developing targeted therapies. Here, we performed comprehensive immunophenotypic profiling of PBMCs from sJIA patients across five clinical centers. We identified an unrecognized CD14+CXCL10+ monocyte subset in sJIA distinguished by a unique transcriptomic signature enriched in immune regulatory genes. Deconvolution analysis with longitudinal follow-up in the Chongqing cohort revealed a previously unrecognized CD14+CXCL10+ monocyte subset that was markedly expanded during active sJIA and diminished during remission, correlating strongly with disease activity. Flow cytometry confirmed its dynamic changes, and in vitro inflammatory stimulation promoted the differentiation of monocytes into the CXCL10 phenotype. To validate these observations in vivo, we used Ube2d1 knockout mice, which exhibit impaired CXCL10 induction and attenuated arthritis severity, highlighting the pivotal role of Ube2d1 in driving this inflammatory program. Furthermore, a cross-disease single-cell reference atlas demonstrated that this monocyte subset displayed a distinct expression profile in sJIA compared with other JIA subtypes and inflammation-related diseases. Collectively, our findings indicate that UBE2D1-driven CD14+CXCL10+ monocytes are central to sJIA pathogenesis and may represent both a biomarker and a therapeutic target for disease monitoring and intervention.

AIMS:Research on hydroxychloroquine (HCQ) for children with chronic immune thrombocytopenia (ITP) is limited. The association between antinuclear antibody (ANA) positivity and its efficacy remains unclear. METHODS:This retrospective cohort study compared the clinical characteristics of children with chronic ITP who received HCQ with those who did not, as well as patients who responded to HCQ at 3 months with those who did not. Mixed-effects models were performed to assess the effect of HCQ on platelet counts and the association between ANA and its efficacy. Records of HCQ-related side effects were reviewed. RESULTS:A total of 191 children with chronic ITP were included in this study, including 42 patients who received HCQ. At the last follow-up, 69.0% of patients treated with HCQ achieved complete response or response, with a median follow-up time of 56 months (range: 17-146 months), a higher frequency compared to 48.3% of patients who were not treated with HCQ (odds ratio [OR], 2.39; 95% confidence interval [CI], 1.15-4.95). The overall response rates to HCQ were 56.8% (21/37) at 3 months and 40.5% (15/37) at 1 year. HCQ was effective for increasing platelet counts (mean difference: 23.82 × 109/L; 95% CI: 7.44-40.21), but the association between ANA positivity and its efficacy was not found. Side effects were recorded in six patients (14.3%). CONCLUSIONS:HCQ was associated with increased platelet counts in chronic ITP children. The baseline ANA level was not found to be associated with the efficacy of HCQ. Side effects of HCQ warrant consideration.

Objective: To investigate the safety, efficacy and effective dose of empagliflozin in the treatment of glycogen storage disease type Ⅰb (GSD Ⅰb). Method: This was a cross sectional study. A total of 28 children with GSDⅠb who started oral empagliflozin treatment from January 2021 to June 2023 in the WeChat group of patients with glycogen storage disease were selected as the study objects. Clinical data such as general situation, current situation of medication and adverse reactions of the children were collected through questionnaires from June 18 to 30, 2023. The differences of symptoms and laboratory tests before and after empagliflozin treatment were compared by using paired chi-square test and Wilcoxon signed rank sum test. Results: Totally 28 children with GSD Ⅰb were from 12 different provinces, autonomous regions and municipalities in China. There were 14 males and 14 females. Empagliflozin treatment was started at the age of 4.8 (2.4, 10.8) years, the time of treatment was 14.5 (11.3, 21.5) months, the initial dosage was (0.23±0.11) mg/(kg·d), and the maintenance dosage was (0.28±0.12) mg/(kg·d). Empagliflozin showed positive effects on neutropenia, severity of inflammatory bowel disease like symptoms(Z=-3.70, -2.65, both P<0.05), The proportion of recurrent oral ulcers, recurrent bacterial infections and anemia was significantly lower than that before medication (18% (5/28) vs. 46% (13/28), 14% (4/28) vs. 46% (13/28), 21% (6/28) vs. 46% (13/28), χ²=4.05, 5.26, 3.05, all P<0.05). Granulocyte colony-stimulating factor (GCSF) was once used in 5 children with GSD Ⅰb, all of them had completely stopped GCSF after empagliflozin treatment. The most common adverse events during empagliflozin treatment were hypoglycemia (5 children) and urinary infection (3 children). All 28 patients had no serious adverse reactions. Conclusions: Empagliflozin can increase the neutrophil count of children with GSD Ⅰb, and had a favorable effect on symptoms such as recurrent oral ulcers, and recurrent infection. The common adverse events during empagliflozin treatment were hypoglycemia and urinary infection.

Background Childhood-onset systemic lupus erythematosus (SLE) is a complex autoimmune disorder that can lead to serious organ damage. Despite the prevalence of SLE among children in Asian countries, treatment guidelines, prognosis, and clinical decision making for children with SLE are limited by gaps in region-specific epidemiological data. The aim of this study was to analyse epidemiological characteristics of childhood-onset SLE and associated organ involvement and in-hospital mortality in China. Methods In this nationwide study, we searched standardised hospital discharge records submitted to the Hospital Quality Monitoring System (HQMS) between Jan 1, 2016, and Dec 31, 2021, for patients with a diagnosis of childhood-onset SLE based on the 2019 American College of Rheumatology or 2012 Systemic Lupus International Collaborating Clinics classification criteria. We selected records for patients aged 18 years and younger containing relevant ICD 10th revision diagnostic codes (specifically M32) among discharge diagnostic codes. We excluded records for patients younger than 5 years, whose SLE diagnosis was presumed to be monogenic lupus, and for patients with overlap syndromes or unidentified sex. Date of diagnosis (equal to the first hospital discharge date), age, organ involvement, intensive care unit (ICU) treatment, and in-hospital mortality were extracted from the records. Incidence rates for 2017, 2018, 2019, 2020, and 2021 were identified with five washout periods ranging from 12 months (Jan 1-Dec 31, 2016) to 60 months (Jan 1, 2016-Dec 31, 2020). Data were stratified by sex, age relative to puberty onset, organ involvement and concurrent infection at time of diagnosis, human development index of region of residence, hospital level, and hospital type. Incidence trends by sex, age relative to puberty onset, and year were derived by joinpoint regression analysis, with 95% CIs calculated by the Poisson exact method. Major organ involvement was assessed according to definitions in the British Isles Lupus Assessment Group 2004 disease activity index. Outcomes of ICU admission after first diagnosis and in-hospital death after ICU admission were analysed in Cox proportional hazards models, with p values and 95% CIs calculated with the parametric method. Findings Between Jan 1, 2016, and Dec 31, 2021, the HQMS received 134 956 hospital discharge records containing the M32 discharge diagnostic code for patients aged 18 years or younger. 6286 records were excluded, leaving 128 670 records representing 54 338 patients aged 5-18 years; of these, 43 756 patients (36 153 girls and 7603 boys) received their childhood-onset SLE diagnosis on or after Jan 1, 2017. Between Jan 1, 2017, and Dec 31, 2021, the SLE incidence rate was 3 center dot 97 (95% CI 3 center dot 93-4 center dot 01) per 100 000 person-years, with a declining trend during the 5-year period. Joinpoint analysis showed sex-dependent and age-dependent incidence patterns. After a relatively stable incidence rate among prepubertal children aged 5-7 years, the incidence rate increased among peripubertal children aged 8-12 years by 0 center dot 92 cases per 100 000 person-years with each 1-year increase in age (p<0 center dot 0001). Among peripubertal children aged 8-12 years, girls showed the largest change in incidence rate, with an increase of 1 center dot 64 per 100 000 person-years with each 1-year increase in age (p<0 center dot 0001), compared with 0 center dot 40 per 100 000 person-years with each 1-year increase in age among boys (p=0 center dot 013). The organ systems most affected in patients with childhood-onset SLE were the kidneys (56 center dot 8%) and the haematological system (27 center dot 8%). Among the 2471 patients admitted to the ICU, 213 (9%) of whom died in ICU, the three organ-related risk factors at initial diagnosis that showed greatest association with progression to critical illness were cardiovascular involvement (adjusted hazard ratio 2 center dot 50 [95% CI 2 center dot 18-2 center dot 87]; p<0 center dot 0001), neuropsychiatric SLE (2 center dot 10 [1 center dot 87-2 center dot 37]; p<0 center dot 0001), and serositis (2 center dot 03 [1 center dot 78-2 center dot 30]; p<0 center dot 0001). Other prominent risk factors for progression to critical illness were concurrent infections with Epstein-Barr virus (1 center dot 52 [1 center dot 16-1 center dot 98]; p=0 center dot 0020) or fungi (1 center dot 49 [1 center dot 22-1 center dot 83]; p=0 center dot 0001). In total, 396 (0 center dot 7%) of 54 338 patients with childhood-onset SLE died in hospital; the most common causes of death were pneumonia (146 [37%]), multiorgan dysfunction syndrome (99 [25%]), and renal failure (75 [19%]). Risk of in-hospital mortality was highest among pubertal children (hazard ratio 2 center dot 16 [95% 1 center dot 14-4 center dot 09]) compared with prepubertal children, and risk of ICU admission was highest among prepubertal children (2 center dot 95 [2 center dot 16-4 center dot 03]) compared with postpubertal children. Interpretation These nationwide data on the epidemiology of childhood-onset SLE in the Chinese paediatric population show for the first time a declining trend in incidence rates, rapid rise in puberty-onset rates, and the distinct involvement of vital organs from disease onset to mortality in China. They underscore the complexity of childhood-onset SLE pathogenesis and emphasise the imperative for stratified precision treatment, informed interventions, and health-care planning for childhood-onset SLE.

Monogenic lupus is defined as systemic lupus erythematosus (SLE)/SLE-like patients with either dominantly or recessively inherited pathogenic variants in a single gene with high penetrance. However, because the clinical phenotype of monogenic SLE is extensive and overlaps with that of classical SLE, it causes a delay in diagnosis and treatment. Currently, there is a lack of early identification models for clinical practitioners to provide early clues for recognition. Our goal was to create a clinical model for the early identification of pediatric monogenic lupus, thereby facilitating early and precise diagnosis and treatment for patients. This retrospective cohort study consisted of 41 cases of monogenic lupus treated at the Department of Pediatrics at Peking Union Medical College Hospital from June 2012 to December 2022. The control group consisted of classical SLE patients recruited at a 1:2 ratio. Patients were randomly divided into a training group and a validation group at a 7:3 ratio. A logistic regression model was established based on the least absolute shrinkage and selection operator to generate the coefficient plot. The predictive ability of the model was evaluated using receiver operator characteristic curves and the area under the curve (AUC) index. A total of 41 cases of monogenic lupus patients and 82 cases of classical SLE patients were included. Among the monogenic lupus cases (with a male-to-female ratio of 1:1.05 and ages of onset ranging from birth to 15 years), a total of 18 gene mutations were identified. The variables included in the coefficient plot were age of onset, recurrent infections, intracranial calcifications, growth and developmental delay, abnormal muscle tone, lymphadenopathy/hepatosplenomegaly, and chilblain-like skin rash. Our model demonstrated satisfactory diagnostic performance through internal validation, with an AUC value of 0.97 (95

Background This study investigates the clinical characteristics and outcomes of pediatric patients with rheumatic diseases infected with COVID-19 in China. Methods We conducted a retrospective analysis of pediatric patients with rheumatic diseases who contracted COVID-19. Data were collected via a comprehensive questionnaire with a 14-day follow-up. Multivariable logistic regression was used to assess severe outcomes, and network analyses evaluated symptom correlations. Results A total of 1070 cases were collected. Fever (88.05%) and cough (62.75%) were the most common symptoms. Cough, nasal congestion, and runny nose exhibited a stronger correlation with each other. A higher incidence of fever reduced the incidence of two single symptoms (nasal congestion [r = -0.833], runny nose [r = -0.762]). Vaccinated children showed a shorter time to negative COVID-19 conversion (7.21 days vs. 7.63 days, p < 0.05) and lower hospitalization rates (p = 0.025). Prolonged symptom duration was associated with older age (OR: 1.07 [1.04-1.11]; p < 0.001) and systemic lupus erythematosus (OR: 1.47 [1.01-2.12]; p = 0.046). Conclusions Pediatric patients with rheumatic diseases exhibited a wide range of clinical symptoms after COVID-19 infection. The infection generally did not lead to severe outcomes in this study. COVID-19 vaccination was associated with reduced hospitalization risk and expediting the time to negativity for virus. Impacts This manuscript demonstrates a comprehensive analysis of the clinical characteristics and outcomes of COVID-19 infection in pediatric patients with rheumatic diseases in China. It provides critical insights into the specific challenges faced by this vulnerable population and offers practical recommendations for improving patient management during periods of increased infectious risk.

Familial hypercholesterolemia (FH) is an inherited disorder mainly marked by increased low-density lipoprotein cholesterol (LDL-C) concentrations and a heightened risk of early-onset arteriosclerotic cardiovascular disease (ASCVD). This study seeks to characterize the genetic spectrum and genotype‒phenotype correlations of FH in Chinese pediatric individuals. Data were gathered from individuals diagnosed with FH either clinically or genetically at multiple hospitals across mainland China from January 2016 to June 2024. In total, 140 children and adolescents (mean age of 6.00 years) with clinically and genetically diagnosed FH were enrolled in the study, with 87 distinct variants identified in the LDLR, APOB and PCSK9 genes. Among the variants, 11 variants were newly identified worldwide, with 9 classified as “pathogenic” or “likely pathogenic”, and 2 classified as “variants of uncertain significance”. Additionally, the 5 most common variants in the study were c.1448G > A (p.W483*), c.1879G > A (p.A627T), c.1216C > A (p.R406R), and c.1747C > T (p.H583Y) in the LDLR gene, as well as c.10579C > T (p.R3527W) in the APOB gene, accounting for 49.29

Prader-Willi syndrome (PWS) is a genetically imprinted disorder characterized by intellectual impairment, obesity, metabolic disorders, and behavioral abnormalities. The pathological mechanisms of metabolic disorders and behavioral abnormalities are not yet clear, and the treatment effect up to now is not satisfactory. In recent years, the role of gut microbiota in metabolic regulation has gradually been recognized. This article will systematically review the research progress of gut microbiota in PWS. Compared to healthy individuals or other simply obese individuals.PWS patients show changes in the gut microbiota. The changes are related to metabolic disorders and inflammatory status in PWS patients. Intervention of gut microbiota through diet or probiotics has played a certain role in controlling weight and improving behavioral abnormalities in PWS patients.

Objective To investigate the clinical characteristics of the hepatolenticular degeneration in children,and to clarify the significance of gene diagnosis in children with hepatolenticular degeneration.Methods A total of 75 patients with hepatolenticular degeneration were enrolled in the Department of Pediatrics,Peking Union Medical College Hospital from 2011 to 2018.All of them carried out a generation of gene sequencing for ATPase Cu2+trans-porting beta polypeptide(ATP7B)gene and multiplex ligation-dependent probe amplification(MLPA)analysis.Results Among the 75 pediatric patients,55 patients were asymptomatic and had elevated aminotransferases as the incidental findings.All the pediatric patients had decreased ceruloplasmin.Seventy-two of pediatric patients had 24-hour urinary copper＞40 μg/d.There were 16 cases that had Kayser-Fleischer(K-F)rings.Sixteen six out of 75(21.33%)cases were diagnosed clinically and 15 cases were＞7 years old.All the remaining patients needed genetic diagnosis.Sixty-six patients had two mutations and 9 patients had only one mutation,1 had no mutation.Forty eight different mutations were found to be localized in ATP7B gene.These mutations included 32 missense mutations,6 splice mutations,5 deletion mutations,2 repeated mutations,2 insert mutations and 1 nonsense muta-tions.The most frequently three mutations were c.2333G＞T,p.R778L,c.2621C＞T,p.A874V,c.2975C＞T,p.P992L,whose allele frequencies were 30.49%,14.89%,9.92%.Conclusions The research showed that in young aged patients,the nervous system symptoms are not obvious and the positive rate of laboratory tests are lower than adults so is a challenge to clinical diagnosis.So Genetic testing is of great significance for the early diagnosis and early treatment of disease in pediatric patients.

BACKGROUND:As a rare mitochondrial disorder, the pyruvate dehydrogenase complex (PDC) deficiency is a rare inborn disease characterized with glucose metabolism defects, which leads to neurological dysfunction, serum lactic acid buildup and a resultant trend of metabolic acidosis. Although the ketogenic diet (KD) is the first-line treatment for PDC deficiency, there is currently no widely accepted consensus on specific implementation of KD for this condition. Due to the combined effect of pre-existing hyperlactacidemia and KD-induced ketoacidosis that can further exacerbate metabolic disturbances, maintaining metabolic homeostasis should be prioritized during the implementation of KD. CASE PRESENTATION:Herein, the authors present a 6-year-old boy with lactic acidosis, ataxia, hypotonia and neuromotor development retardation. The KD was started after the patient was diagnosed with PDC deficiency based on genetic testing. The initiation with classic KD resulted in severe non-diabetic ketoacidosis with elevated anion gap, which was promptly alleviated by dextrose supplementation and dietary modification to a less-restrictive KD. Long-term supervision demonstrated the efficacy of a modified KD in improving both clinical course and metabolic acidosis of the patient. CONCLUSIONS:This rare case adds to the limited evidence of KD application in PDC deficiency, and provides valuable insights into the importance of reasonably lowering the ketogenic ratio of KD at the start of treatment to reduce the risk of metabolic acidosis.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.