We describe a series of novel simultaneous EEG and diffuse optical imaging studies of newborn infants. These experiments provide evidence of large, transient haemodynamic events which occur repeatedly and consistently within and across several infants with neurological damage, all of whom were diagnosed with seizures. A simple but independent process of rejecting artifacts and identifying events within diffuse optical imaging data is described, and this process is applied to data from 4 neurologically damaged neonates and from 19 healthy, age-matched controls. This method results in the consistent identification of events in three out of four of the neurologically damaged infant group which are dominated by a slow (>30s) and significant increase in oxyhaemoglobin concentration, followed by a rapid and significant decrease before a slow return to baseline. No comparable events are found in any of our control data sets. The importance and physiological implications of our findings are discussed, as is the suitability of a combined EEG and diffuse optical imaging approach to the study and monitoring of neonatal brain injury.

Animal models of neurodegenerative disease are excellent tools for studying pathogenesis and therapies including cellular transplantation. In this chapter, we describe different models of Huntington's disease and Parkinson's disease, stereotactic surgery (used in creation of lesion models and transplantation) and finally transplantation studies in these models.

It is generally accepted that while inflammatory demyelinating neuropathies often cause patchy demyelination resulting in conduction block, temporal dispersion and variation in conduction velocities, demyelinating hereditary neuropathies such as Charcot–Marie–Tooth (CMT) disease type 1A are usually characterised by homogeneous slow conduction. X-linked CMT is caused by mutations in the gap junction beta 1 ( GJB1 ) gene encoding connexin 32, a gap junction protein, resulting in intermediate conduction velocities. At our institution, mean median nerve conduction velocity in men with GJB1 mutations is 33.2 ± 7.5 m/s (n = 13) and 47.7 ± 7.0 m/s in women (n = 8), similar to other recent series.1 2 There is increasing evidence that nerve conduction is not always homogeneous in GJB1 associated CMT.1–4 Here we present three cases in which the neurophysiology suggested an inflammatory demyelinating neuropathy, but who failed to respond to treatment and were subsequently found to have mutations in GJB1 . ### Case No 1 A 23-year-old man presented with parasthesia affecting both feet that progressed to mild hand parasthesia and weakness over 6 months. Although slightly clumsy, he had been good at sport as a teenager. He had minimal wasting but normal power in his hands, he was areflexic and had reduced vibration and pinprick distally. CSF was acellular, with a raised protein of 0.78 g/l. His initial nerve conduction studies (NCS) (done elsewhere) suggested chronic …

Huntington’s disease (HD) is a severe neurodegenerative condition in which the impairment in voluntary movement is related to functional disability. Clinical assessment of motor deficit currently relies largely on subjective rating scales without objective measurement. We have developed a quick and easy-to-use hand tapping device that enables measurement of (a) the number of taps in 30 seconds, (b) variability in tapping rhythm and (c) fatigue over the testing period. Initial cross-sectional testing of 178 consecutive HD clinic patients using an early model of the device showed that the total number of taps in 30 seconds correlated with the motor UHDRS (Spearmann’s rho, rs = –0.81, p < 0.0001) and independence scores (rs = 0.78, p = 0.01). Longitudinal data from a small cohort followed over 10 years reveals a correlation between total number of taps in 30 seconds and motor UHDRS over time (rs = –0.49, p < 0.001), and suggests the technique may provide an objective measure of disease progression. Further tests on 15 HD patients and 9 controls were repeated three times in a single day using an updated device. The HD group made significantly fewer taps in 30 seconds (median HD = 79, control = 104, p = 0.009) and had greater variability of inter-tap interval (mean interdecile range HD = 148, control = 56, p = 0.016) compared to controls. Both the total number of taps and variability of inter-tap interval correlated with motor UHDRS. Of vital importance for any potential marker of disease progression is that these tapping parameters were reproducible with repeated measurement. Given that hand tapping parameters differ between HD and control populations, they correlate with motor UHDRS over time and are reproducible, we propose that assessment of hand tapping represents a useful objective adjunct to the clinical assessment of HD patients.

α-Synuclein is thought to play an important role in the pathology of Parkinson's disease (PD). Truncated forms of this protein can be found in PD brain extracts, and these species aggregate faster and are more susceptible to oxidative stress than the full-length protein. We investigated the effect of truncated α-synuclein on dopaminergic cells using a transgenic mouse expressing α-synuclein (1–120) driven by the rat tyrosine hydroxylase promoter on a mouse α-synuclein null background. We found a selective reduction in the yield of dopaminergic cells from transgenic embryonic ventral mesencephalic cell cultures. However, in vivo the substantia nigra/ventral tegmentum dopaminergic cell counts were not reduced in transgenics, although these mice are known to have reduced striatal dopamine. When transplanted to the striatum in the unilateral 6-hydroxydopamine-lesioned mouse model of PD, dopaminergic cells derived from transgenic embryonic ventral mesencephala were significantly smaller at 6 weeks, and showed a trend towards being less effective at ameliorating rotational asymmetry than those from control α-synuclein null mice. These results suggest that α-synuclein (1–120) renders dopaminergic cells more susceptible to stress, which may have important implications as to how this truncated protein might contribute to dopaminergic cell death in sporadic PD.

There has been considerable progress recently towards developing therapeutic strategies for Huntington's disease (HD), with several compounds showing beneficial effects in transgenic mouse models. However, human trials in HD are difficult, costly and time-consuming due to the slow disease course, insidious onset and patient-to-patient variability. Identification of molecular biomarkers associated with disease progression will aid the development of effective therapies by allowing further validation of animal models and by providing hopefully more sensitive measures of disease progression. Here, we apply metabolic profiling by gas chromatography-time-of-flight-mass spectrometry to serum samples from human HD patients and a transgenic mouse model in a hypothesis-generating search for disease biomarkers. We observed clear differences in metabolic profiles between transgenic mice and wild-type littermates, with a trend for similar differences in human patients and control subjects. Thus, the metabolites responsible for distinguishing transgenic mice also comprised a metabolic signature tentatively associated with the human disease. The candidate biomarkers composing this HD-associated metabolic signature in mouse and humans are indicative of a change to a pro-catabolic phenotype in early HD preceding symptom onset, with changes in various markers of fatty acid breakdown (including glycerol and malonate) and also in certain aliphatic amino acids. Our data raise the prospect of a robust molecular definition of progression of HD prior to symptom onset, and if validated in a genuinely prospective fashion these biomarker trajectories could facilitate the development of useful therapies for this disease.

Huntington’s disease (HD) is a neurodegenerative disorder characterised by progressive motor, cognitive and psychiatric symptoms. Objective measurement of disease severity is of increasing importance for detecting symptomatic disease, as well as monitoring disease progression and the response to novel therapeutic interventions. Using a newly-developed infra-red scleral oculometer, we measured saccadic latencies and durations in HD patients exhibiting a broad range of symptoms ( n =24) and control subjects of comparable ages ( n =20) to see whether these parameters might reflect the presence or severity of HD. Latency distributions were characterised by creating reciprobit plots for each subject, whilst parametric statistics were applied to durations. Compared with the control group, we found the HD group had a significantly increased median latency, and early saccades were more prominent. In addition, HD patients exhibited an increased saccadic duration and variability of duration. Using Bayesian (likelihood) analysis, we obtained saccadic support values for the presence of clinical HD, which correlated with the motor Unified Huntington’s Disease Rating Scale (UHDRS) score in these patients. A sensitivity/specificity analysis of all 44 participants showed that the use of this multivariate support measure was highly successful in predicting HD status, correctly diagnosing 75% of the HD patients, and (95%) of the controls; with a different criterion, these figures were 96 and 15%. Furthermore, we correctly predicted absence of disease in two additional subjects subsequently confirmed to be genetically unaffected. This strongly suggests that multivariate support values derived from saccadic parameters may provide an objective, quantitative biomarker of HD, especially the degree of motor impairment. However, larger longitudinal studies are required to determine whether they can reliably detect the earliest presymptomatic disease, or faithfully reflect disease progression.

Parkinson’s disease (PD) is associated with a loss of central dopaminergic pathways in the brain leading to an abnormality of movement, including saccades. In PD, analysis of saccadic latency distributions, rather than mean latencies, can provide much more information about how the neural decision process that precedes movement is affected by disease or medication. Subject to the constraints of intersubject variation and reproducibility, latency distribution may represent an attractive potential biomarker of PD. Here we report two studies that provide information about these parameters, and demonstrate a novel effect of dopamine on saccadic latency, implying that it influences the neural decision process itself. We performed a detailed cross-sectional study of saccadic latency distributions during a simple step task in 22 medicated patients and 27 age-matched controls. This revealed high intersubject variability and an overlap of PD and control distributions. A second study was undertaken on a different population specifically to investigate the effects of dopamine on saccadic latency distributions in 15 PD patients. l -dopa was found to prolong latency, although the magnitude of the effect varied between subjects. The implications of these observations for the use of saccadic latency distributions as a potential biomarker of PD are discussed, as are the effects of l -dopa on neural decision making, where it is postulated to increase the criterion level of evidence required before the decision to move is made.

Parkinson's disease (PD) is a heterogeneous disease that can be difficult to diagnose, and for which we have no simple effective biomarker. In this study we have investigated whether peripheral α-synuclein might represent a useful biomarker given that it has a central role in the pathogenesis of PD. We found that full length and truncated α-synuclein is present in platelets, but the amount is very variable and does not correlate with disease presence or severity. Furthermore, we show that α-synuclein can be detected by immunoblotting in some, but not all, human skin biopsies, but again its level does not correlate with disease presence or severity. We conclude that skin or platelet α-synuclein would not be an appropriate diagnostic biomarker for PD.

A case of late onset sporadic Parkinson's disease with an A53T mutation in a-synuclein Parkinson's disease is a common progressive neurological disorder characterised by loss of nigral dopaminergic neurones.Rare autosomal dominant familial cases have been associated with point mutations in a-synuclein, 1 2 but the vast majority of cases occur sporadically in older patients without an obvious cause.We now report a unique case of typical late onset Parkinson's disease without a family history which was associated with an A53T mutation in a-synuclein. Case reportA war veteran of Polish origin was initially referred for assessment of his parkinsonian condition in 1997 at the age of 74.At presentation his history was of progressive bradykinesia, difficulty in rising from his chair, a tendency to fall, and mild tremor.He was a smoker and had been treated for hypertension and hypercholesterolaemia, but he gave no clear history of cerebrovascular disease.His Austrian mother died at 91 years of age and his French father lived to 89, neither suffering from symptoms of Parkinson's disease.He had four brothers and three sisters, none of whom had symptoms of Parkinson's disease (two died in their 20s during the war, the others died at ages 68, 76, 78, and 86, and one has lost touch with the family).Furthermore, his three children, each now in their sixth decade, currently have no diagnosis of Parkinson's disease.The family know of no relatives of Italian or Greek origin.Examination was consistent with Parkinson's disease, with a typical shuffling gait, bilateral cogwheel rigidity, and mild tremor, but no pyramidal or cerebellar signs.Investigations were normal, but magnetic resonance imaging of his brain was not possible because of metal shrapnel in his left orbit, face, and nose from the second world war.Computed tomography of the brain showed only mild age related cerebral atrophy without evidence of vascular disease.Before presentation he had been prescribed co-beneldopa 62.5 mg three times a day with some symptomatic benefit.In July 1997 a five week trial off levodopa caused a deterioration in his symptoms, therefore his co-beneldopa was restarted and increased to 125 mg three times daily, and selegiline was started.On this treatment his symptoms remained stable for the next three years, and a second trial without levodopa or a dopamine agonist was attempted in May 2000, which again provoked marked bradykinesia and deterioration in his gait.His treatment was restarted after only five days, following which the symptoms once again resolved, showing the clear levodopa responsive element to his condition.He died in August 2002 but a necropsy examination of the brain was not undertaken. Genetic analysisPCR primers were designed from 59 untranslated region (UTR) and 39UTR spanning each exon of a-synuclein (from NACP/a-synuclein sequences submitted to NCBI database; accession number U46896-U46901; primer pairs designed to amplify exon 3 were 3F: GAGGACCTCCTGTTAGCTGG, and 3R: GACT GATATGTTCTTAGATGCTC. Polymerase chain reaction (PCR) products were purified using QIAquick columns and sequenced according to the manufacturer's protocols by dye terminator (BigDye) methods using an ABI 377 automated sequencer (Applied Biosystems, Foster City, California, USA).All sequences were edited and confirmed by entering them into the BLAST algorithm database at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast).A single mutation from G to A was found at nucleotide 209 in exon 3 of the a-synuclein gene from this patient (fig 1A).The sample was reanalysed twice following this observation, and also verified in the reverse direction.Restriction digest of the PCR products was carried out with Tsp45 I (New England BioLabs, Beverly, Massachusetts, USA), and digested products were separated by electrophoresis on a 2% agarose gel (fig 1B).The results correspond to an alanine to threonine shift at position 53 of a-synuclein (an A53T mutation).

This year’s skiing trip had an unusually neurological flavour, reminding us of what we once knew – the neuroanatomy of the foot. And what we should have known – the dangers of colourful new ski boots. NICK – THE ONCOLOGIST After many a year just failing to keep my carving skis on their edges I finally decided to buy some new ski boots (Fig. 1). On their first day of use, after an enthusiastic start, I began to experience increasing pain just below my left ankle, but inevitably chose to continue skiing, blissfully unaware that by evening I was to provide a revision crash course in the neuroanatomy of the foot. ANDY – THE NEUROLOGIST That evening a fireside examination revealed an area of exquisite tenderness just inferior and posterior to Nick’s left medial malleolus, with a clearly dysaesthetic area affecting the medial plantar surface of the foot including the great toe but not

Exosomes are small vesicles released from cells into extracellular space. We have isolated exosomes from neuroblastoma cells and investigated their influence on the aggregation of α-synuclein, a protein associated with Parkinson disease pathology. Using cryo-transmission electron microscopy of exosomes, we found spherical unilamellar vesicles with a significant protein content, and Western blot analysis revealed that they contain, as expected, the proteins Flotillin-1 and Alix. Using thioflavin T fluorescence to monitor aggregation kinetics, we found that exosomes catalyze the process in a similar manner as a low concentration of preformed α-synuclein fibrils. The exosomes reduce the lag time indicating that they provide catalytic environments for nucleation. The catalytic effects of exosomes derived from naive cells and cells that overexpress α-synuclein do not differ. Vesicles prepared from extracted exosome lipids accelerate aggregation, suggesting that the lipids in exosomes are sufficient for the catalytic effect to arise. Using mass spectrometry, we found several phospholipid classes in the exosomes, including phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, phosphatidylinositol, and the gangliosides GM2 and GM3. Within each class, several species with different acyl chains were identified. We then prepared vesicles from corresponding pure lipids or defined mixtures, most of which were found to retard α-synuclein aggregation. As a striking exception, vesicles containing ganglioside lipids GM1 or GM3 accelerate the process. Understanding how α-synuclein interacts with biological membranes to promote neurological disease might lead to the identification of novel therapeutic targets.Background: Cell-to-cell transmission of α-syn via exosomes has been proposed to propagate Parkinson disease pathology.Results: Exosomes contain gangliosides, several other lipid classes, and proteins. Exosomes and ganglioside vesicles accelerate α-syn aggregation. Vesicles made of other membrane lipids do not.Conclusion: Exosomes provide catalytic environments for nucleation of α-syn aggregation.Significance: Revealing factors that promote α-syn aggregation may provide insight into Parkinson disease pathogenesis.

Biomarkers are characteristics that can be measured as an indicator of a normal biological process, and they have special relevance in Parkinson's disease. Parkinson's disease is a chronic neurodegenerative disorder that is difficult to study, given the site of pathology and because the resultant clinical phenotype fluctuates over time. We currently have no definitive diagnostic test, and thus for the clinician there is hope that biomarkers will help diagnose symptomatic and presymptomatic disease or provide surrogate end-points to demonstrate clinical efficacy of new treatments, such as neuroprotective therapies, and help stratify this heterogeneous disease. No biomarker is likely to fulfil all these functions, so we need to know how each has been validated in order to understand their uses and limitations, and be aware of potential pitfalls. In this review we discuss the current potential biomarkers for Parkinson's disease, highlight the problems with their use, and conclude with a discussion of future alternatives.

Neurodegenerative diseases such as Parkinson's disease (PD), Huntington's disease and Alzheimer's disease are common and disabling, causing great suffering for those affected and their families, and resulting in a very significant financial burden on the state. Unfortunately at present we can only prescribe symptomatic therapy for these diseases given the absence of truly disease modifying treatments. Furthermore, even extremely effective symptomatic treatments, such as levodopa for PD, tend to become less effective over time, together with the development of unwanted side effects such as dyskinesias and motor fluctuations. There is therefore a great need for neuroprotective or neurorestorative treatments that affect disease progression.Repairing the degenerating brain represents a great challenge, not least because it is increasingly recognised that the pathology found in these disorders is dispersed throughout the nervous system. Thus in PD, although the hallmark pathology is degeneration of dopaminergic neurons in the substantia nigra, there is evidence for diffuse pathology throughout the brain (Braak et al 2002) affecting noradrenergic, serotonergic and cholinergic neurotransmission, and even affecting peripheral autonomic nerves and the gut (Edwards et al 1992). Thus, although an effective treatment could simply target a site of maximal pathology, a curative therapy will need to have a very much more diffuse action.