PDF file - 3024K, Time- and dose-dependent effects of KG-501 on the CREB expression and activity of HER-2/neu+ cells. (A) mRNA expression of CREB, CBP, bcl2 and bcl-xL was determined over time upon treatment with 10 M KG-501 using RT-PCR followed by agarose electrophoresis as described in Materials and Methods. Expression of β-actin served as control. (B) HER-2/neu+ cells were incubated with KG-501 for 48 h at 37{degree sign}C and analysed as described in Materials and Methods. Western blotting using a phospho(Ser-133) mAb was performed and Beta-actin mAb served as the control. The right panel demonstrate the quantified densitometry data (right) are means SD (n = 3). (C) CFSE-labeled HER-2/neu+ cells were incubated with KG-501 and fluorescence was determined 48 h later on a FACsCalibur. Red line, untreated cells.

Supplementary Figure 4: Distinct adhesion capacities of RASV12 transformants

PDF file - 101K, Supplementary Table 1. Summary of primers used Supplementary Table 2. Patients and tumor characteristics (n = 112) Supplementary Table 3. pCREB(ser133) status according to clinico-pathological parameters in T1-T2, N0 breast cancer patients (n = 112).

Supplementary Figure 1: Influence of signal transduction inhibitors and/or the farnesyltransferase inhibitor tipifarnib on the CREB activity and/or growth properties in murine and human (tumor) cells

<p>PDF file - 207K, Table S1. Cell line authentication. Table S2. Antibodies used for flow cytometry.</p>

Supplementary Figure 6: Histology, immunohistochemistry and morphology of murine tumors

Supplementary Methods, Figure Legends and Tables Supplementary Table I: Inhibitors used in this study Supplementary Table II: Summary of primers used for murine (m) and human (h) samples Supplementary Table III: Primer for murine promoter constructs and mutagenesis primer

PDF file - 6761K, Correlation of HER-2/neu with pCREB expression. (A) shHER-2 transfection strongly down-regulates HER-2/neu expression in MCF-7 cells. (B) shHER-2/neu-mediated down-regulation of HER-2/neu in HER-2/neu+ MCF-7 cells results in a reduced in CREB phophorylation. (C) Representative immunohistochemical staining and grading from breast cancer tumor lesions are shown.

Supplementary Figure 3: Altered phenotype and growth properties of RAS transformants by CREB silencing

Supplementary Figure 5: Influence of CREB on MMP promoter activity

PDF file - 8658K, Immunohistochemical analysis of HER-2/neu+ cells and shCREB-HER-2/neu+ cells following in-vivo tumorigenicity. (A) Representative images from organs of tumor-bearing mice injected with HER-2/neu+ cells and shCREB-HER-2/neu+ cells are shown. The tumors were fixed, embedded in paraffin, and 5 m slices were stained as indicated. Magnification, 20. (B) Tumor slices were stained with hematoxylin-eosin and analyzed for apoptosis (TUNEL), proliferation (Ki-67) and CREB expression. Following incubation with a horse-radish-peroxidase-linked antibody, the slices were stained with diaminobenzidine and counterstained with methylene blue. Arrows (apoptosis staining), blood vessels; arrowheads, apoptotic cells. Magnification, 20.

Supplementary Figure 2: p-CREB Ser133 expression in colorectal carcinoma lesions with known K-RAS mutation status

PDF file - 1836K, Effects of shCREB constructs on CREB protein expression. (A) Efficacy of shCREB knock-down (shCREB-HER-2/neu+ cells) was analyzed using an NC control plasmid and four different shRNA plasmid contructs targeting murine CREB1. The following shRNA sequences were amplified and cloned into a pClip plasmid construct containing a puromycin resistance gene: plasmid #1: TCAGCCGGGTACTACCATTCT; plasmid #2: ACAGGGAGGCAGCAAGAGAAT, plasmid #3: AAGTCCAAACAGTTCAGATTT and plasmid #4: TGCTCCCACTGTAACCTTAGT. Plasmid NC (GGAATCTCATTCGATGCATAC) served as a nonsense control. These plasmids were transfected into HER-2/neu+ cells and CREB protein expression was determined by Western blotting as described in Materials and Methods using an anti-CREB-specific antibody. Arrows point to plasmid constructs that were further used in this study. (B) mRNA expression of ATF-1 and CREM was analyzed in HER-2/neu+ cells and shCREB-HER-2/neu+ cells using q-PCR. Data are means plus-minus SD (n = 3).

PDF file - 252K, Figure S1. HLA-DR+ cells do not inhibit NK cells. Figure S2. PGE2 induces suppressive functions on monocytes. Figure S3. COX-2 silencing of tumor cells reduces immune suppression in mice.

The extracellular matrix component biglycan (BGN) plays an essential role in various physiological and pathophysiological processes. A deficient BGN expression associated with reduced immunogenicity was found in HER-2/neu-overexpressing cells. To determine whether BGN is suppressed by oncogene-driven regulatory networks, the expression and function of BGN was analyzed in murine and human BGNlow/BGNhigh K-RASG12V-transformed model systems as well as in different patients' datasets of colorectal carcinoma (CRC) lesions. K-RAS-mutated CRC tissues expressed low BGN mRNA and protein levels when compared to normal colon epithelial cells, which was associated with a reduced patients' survival. Transfection of BGN in murine and human BGNlow K-RAS-expressing cells resulted in a reduced growth and migration of BGNhigh vs BGNlow K-RAS cells. In addition, increased MHC class I surface antigens as a consequence of an enhanced antigen processing machinery component expression was found upon restoration of BGN, which was confirmed by RNA-sequencing of BGNlow vs. BGNhigh K-RAS models. Furthermore, a reduced tumor formation of BGNhigh versus BGNlow K-RAS-transformed fibroblasts associated with an enhanced MHC class I expression and an increased frequency of tumor-infiltrating lymphocytes in tumor lesions was found. Our data provide for the first time an inverse link between BGN and K-RAS expression in murine and human K-RAS-overexpressing models and CRC lesions associated with altered growth properties, reduced immunogenicity and worse patients' outcome. Therefore, reversion of BGN might be a novel therapeutic option for K-RAS-associated malignancies.

Progression of oral squamous cell carcinoma (OSCC) has been associated with an escape of tumor cells from the host immune surveillance due to an increased knowledge of its underlying molecular mechanisms and its modulation by the tumor microenvironment and immune cell repertoire. In this study, the expression of HLA class I (HLA-I) antigens and of components of the antigen processing machinery (APM) was analyzed in 160 pathologically classified human papilloma virus (HPV)-negative OSCC lesions and correlated to the intra-tumoral immune cell response, IFN-γ signaling and to the patient’s outcome. A heterogeneous but predominantly lower constitutive protein expression of HLA-I APM components was found in OSCC sections when compared to non-neoplastic cells. Tumoral HLA-I APM component expression was further categorized into the three major phenotypes HLA-Ihigh/APMhigh, HLA-Ilow/APMlow and HLA-Idiscordant high/low/APMhigh. In the HLA-Ihigh/APMhigh group, the highest frequency of intra-tumoral CD8+ T cells and lowest number of CD8+ T cells close to FoxP3+ cells were found. Patients within this group presented the most unfavorable survival, which was significantly evident in stage T2 tumors. Despite a correlation with the number of intra-tumoral CD8+ T cells, tumoral JAK1 expression as a surrogate marker for IFN-γ signaling was not associated with HLA-I/APM expression. Thus, the presented findings strongly indicate the presence of additional factors involved in the immunomodulatory process of HPV-negative OSCC with a possible tumor-burden-dependent complex network of immune escape mechanisms beyond HLA-I/APM components and T cell infiltration in this tumor entity.

Background: The human leukocyte antigen (HLA) class II molecules are constitutively expressed in some melanoma, but the underlying molecular mechanisms have not yet been characterized. Methods: The expression of HLA class II antigen processing machinery (APM) components was determined in melanoma samples by qPCR, Western blot, flow cytometry and immunohistochemistry. Immunohistochemical and TCGA datasets were used for correlation of HLA class II expression to tumor grading, T-cell infiltration and patients’ survival. Results: The heterogeneous HLA class II expression in melanoma samples allowed us to characterize four distinct phenotypes. Phenotype I totally lacks constitutive HLA class II surface expression, which is inducible by interferon-gamma (IFN-γ); phenotype II expresses low basal surface HLA class II that is further upregulated by IFN-γ; phenotype III lacks constitutive and IFN-γ controlled HLA class II expression, but could be induced by epigenetic drugs; and in phenotype IV, lack of HLA class II expression is not recovered by any drug tested. High levels of HLA class II APM component expression were associated with an increased intra-tumoral CD4+ T-cell density and increased patients’ survival. Conclusions: The heterogeneous basal expression of HLA class II antigens and/or APM components in melanoma cells is caused by distinct molecular mechanisms and has clinical relevance.

The transcription factor cAMP response element-binding protein (CREB1) has been shown to be involved in diverse biological pathways including the regulation of cell proliferation, apoptosis, cell cycle progression, and metastasis. In this context, aberrant expression of CREB1 and the functional consequences are well investigated in a number of hematopoietic and solid tumors. However, CREB1 expression and underlying control mechanisms are only poorly analyzed in renal cell carcinoma (RCC). The present study confirmed a deregulation of CREB1 protein in the clear cell type of RCC (ccRCC) and analysis of in-house ccRCC cell lines suggested a post-transcriptional control. The combination of miRNA enrichment assay, in silico analysis and molecular biological approaches revealed four novel CREB1-regulating miRNAs, namely miR-22-3p, miR-26a-5p, miR-27a-3p, and miR-221-3p. Categorizing RCC samples as CREB1 negative or positive, respectively, the expression of these miRNAs was found to be inversely correlated with CREB1 protein levels. Analyzing 453 consecutive RCC tumors by immunohistochemistry, weakly negative, but significant correlations of CREB1 with tumor stage and grade, vascular invasion (V1) and lymphovascular invasion (L1) were found. In this respect, ccRCC might differ from other solid tumors like esophageal squamous-cell carcinoma or glioma.

The muscle excess 3 (MEX-3) protein was first identified inCaenorhabditis elegans (C. elegans), and its respective homologues were also observed in vertebrates, including humans. It is a RNA-binding protein (RBP) with an additional ubiquitin E3 ligase function, which further acts as a post-transcriptional repressor through unknown mechanisms. In humans, MEX-3 proteins post-transcriptionally regulate a number of biological processes, including tumor immunological relevant ones. These have been shown to be involved in various diseases, including tumor diseases of distinct origins. This review provides information on the expression and function of the human MEX-3 family in healthy tissues, as well after malignant transformation. Indeed, the MEX-3 expression was shown to be deregulated in several cancers and to affect tumor biological functions, including apoptosis regulation, antigen processing, and presentation, thereby, contributing to the immune evasion of tumor cells. Furthermore, current research suggests MEX-3 proteins as putative markers for prognosis and as novel targets for the anti-cancer treatment.

BACKGROUND:The non-classical human leukocyte antigen (HLA)-G is a strong immunomodulatory molecule. Under physiological conditions, HLA-G induces immunological tolerance in immune privileged tissues, while under pathophysiological situations it contributes to immune escape mechanisms. Therefore, HLA-G could act as a potential immune checkpoint for future anti-cancer immunotherapies. Recent data suggest an aberrant expression of the cAMP response element binding protein (CREB) in clear cell renal cell carcinoma (ccRCC), which is correlated with tumor grade and stage. Furthermore, preliminary reports demonstrated a connection of CREB as a control variable of HLA-G transcription due to CREB binding sites in the HLA-G promoter region. This study investigates the interaction between CREB and HLA-G in different renal cell carcinoma (RCC) subtypes and its correlation to clinical parameters.METHODS:The direct interaction of CREB with the HLA-G promoter was investigated by chromatin immunoprecipitation in RCC cell systems. Furthermore, the expression of CREB and HLA-G was determined by immunohistochemistry using a tissue microarray (TMA) consisting of 453 RCC samples of distinct subtypes. Staining results were assessed for correlations to clinical parameters as well as to the composition of the immune cell infiltrate.RESULTS:There exists a distinct expression pattern of HLA-G and CREB in the three main RCC subtypes. HLA-G and CREB expression were the lowest in chromophobe RCC lesions. However, the clinical relevance of CREB and HLA-G expression differed. Unlike HLA-G, high levels of CREB expression were positively associated to the overall survival of RCC patients. A slightly, but significantly elevated number of tumor infiltrating regulatory T cells was observed in tumors of high CREB expression. Whether this small increase is of clinical relevance has to be further investigated.CONCLUSIONS:An interaction of CREB with the HLA-G promoter could be validated in RCC cell lines. Thus, for the first time the expression of CREB and its interaction with the HLA-G in human RCCs has been shown, which might be of clinical relevance.