BACKGROUND:Carbapenem-resistant Klebsiella pneumoniae (CRKp) is the most prevalent carbapenem-resistant Enterobacterales in the United States. We evaluated CRKp clustering in patients in US hospitals. METHODS:From April 2016 to August 2017, 350 patients with clonal group 258 CRKp were enrolled in the Consortium on Resistance Against Carbapenems in Klebsiella and other Enterobacteriaceae, a prospective, multicenter, cohort study. A maximum likelihood tree was constructed using RAxML. Static clusters shared ≤21 single-nucleotide polymorphisms (SNP) and a most recent common ancestor. Dynamic clusters incorporated SNP distance, culture timing, and rates of SNP accumulation and transmission using the R program TransCluster. RESULTS:Most patients were admitted from home (n = 150, 43%) or long-term care facilities (n = 115, 33%). Urine (n = 149, 43%) was the most common isolation site. Overall, 55 static and 47 dynamics clusters were identified involving 210 of 350 (60%) and 194 of 350 (55%) patients, respectively. Approximately half of static clusters were identical to dynamic clusters. Static clusters consisted of 33 (60%) intrasystem and 22 (40%) intersystem clusters. Dynamic clusters consisted of 32 (68%) intrasystem and 15 (32%) intersystem clusters and had fewer SNP differences than static clusters (8 vs 9; P = .045; 95% confidence interval [CI]: -4 to 0). Dynamic intersystem clusters contained more patients than dynamic intrasystem clusters (median [interquartile range], 4 [2, 7] vs 2 [2, 2]; P = .007; 95% CI: -3 to 0). CONCLUSIONS:Widespread intrasystem and intersystem transmission of CRKp was identified in hospitalized US patients. Use of different methods for assessing genetic similarity resulted in only minor differences in interpretation.

We report successful treatment of a case of disseminated blastomycosis originating in the right lung, with involvement of the right pleural space, multiple ribs and vertebral bodies, and the pericardium and mitral valve endocarditis. The 22-year-old patient presented with a 13-month history of right lower lobe pneumonia associated with fevers, night sweats, rib pain, and 27-kg weight loss. Pathology examination revealed Blastomyces from multiple biopsies of inflammatory masses in the right thorax. After a 4-week induction with liposomal amphotericin followed by oral itraconazole, the patient had complete resolution of the clinical and laboratory findings of blastomycosis.

Background Patients with bacteremia due to carbapenem-resistant Enterobacterales (CRE) experience delays until appropriate therapy and high mortality rates. Rapid molecular diagnostics for carbapenemases and new beta-lactam/beta-lactamase inhibitors may improve outcomes. Methods We conducted an observational study of patients with CRE bacteremia from 2016 to 2018 at 8 New York and New Jersey medical centers and assessed center-specific clinical microbiology practices. We compared time to receipt of active antimicrobial therapy and mortality between patients whose positive blood cultures underwent rapid molecular testing for the Klebsiella pneumoniae carbapenemase (KPC) gene (bla(KPC)) and patients whose cultures did not undergo this test. CRE isolates underwent antimicrobial susceptibility testing by broth microdilution and carbapenemase profiling by whole-genome sequencing. We also assessed outcomes when ceftazidime-avibactam and polymyxins were used as targeted therapies. Results Of 137 patients with CRE bacteremia, 89 (65%) had a KPC-producing organism. Patients whose blood cultures underwent bla(KPC) PCR testing (n = 51) had shorter time until receipt of active therapy (median: 24 vs 50 hours; P = .009) compared with other patients (n = 86) and decreased 14-day (16% vs 37%; P = .007) and 30-day (24% vs 47%; P = .007) mortality. bla(KPC) PCR testing was associated with decreased 30-day mortality (adjusted odds ratio: .37; 95% CI: .16-.84) in an adjusted model. The 30-day mortality rate was 10% with ceftazidime-avibactam monotherapy and 31% with polymyxin monotherapy (P = .08). Conclusions In a KPC-endemic area, bla(KPC) PCR testing of positive blood cultures was associated with decreased time until appropriate therapy and decreased mortality for CRE bacteremia, and ceftazidime-avibactam is a reasonable first-line therapy for these infections. In this multicenter observational study of bacteremias caused by carbapenem-resistant Enterobacterales, use of a molecular assay that detects the Klebsiella pneumoniae carbapenemase gene directly from positive blood culture broths was associated with shorter delays in appropriate therapy and decreased mortality.

Abstract Background Patients with bloodstream infections (BSIs) due to carbapenem-resistant Enterobacteriaceae (CRE) have long delays until receipt of appropriate antimicrobial therapy and high mortality rates. Rapid molecular diagnostics and novel therapies, such as ceftazidime–avibactam (CAZ-AVI), offer promise to improve outcomes, but their clinical impact is unclear. Methods We conducted an observational study of patients with CRE BSI from January 2016 to June 2018 at 8 New York and New Jersey medical centers. Patient demographics, comorbidities, clinical presentations, diagnostic methods, and treatments were compared between patients who died within 30 days of BSI onset and survivors. Independent risk factors for mortality were identified using logistic regression. We then compared time to receipt of active antimicrobial therapy between patients whose positive blood culture bottles underwent testing for the Klebsiella pneumoniae carbapenemase gene (blaKPC PCR) and patients where this test was not used. Results We identified 178 patients with CRE BSI (K. pneumoniae: n = 104, 58%; Enterobacter cloacae: n = 26, 15%; Escherichia coli: n = 26, 15%). The 30-day mortality rate was 38%. An increasing Acute Physiology and Chronic Health Evaluation II score (adjusted odds ratio [aOR] 1.06, P = 0.005) was independently associated with increased 30-day mortality; whereas, use of blaKPC PCR (aOR 0.31, P = 0.005), urinary tract source (aOR 0.12, P = 0.001), and source control (aOR 0.25, P = 0.001) were independently associated with survival. Initial targeted therapy with CAZ-AVI was associated with a 28% 30-day mortality rate, compared with a 49% 30-day mortality rate among patients who received a polymyxin or aminoglycoside (P = 0.036). Patients whose blood culture underwent blaKPC PCR were more likely to receive active antimicrobial therapy within 24 hours of BSI onset (42% vs. 28%; P = 0.07) and had a decreased median time until receipt of active therapy (25 hours vs. 46 hours; P = 0.07), although these differences did not achieve statistical significance. Conclusion The use of PCR to rapidly identify blood cultures with blaKPC and definitive therapy with CAZ-AVI instead of polymyxins or aminoglycosides were associated with decreased mortality after CRE bacteremia. Disclosures All Authors: No reported Disclosures.

Background: Environmental sources have been implicated as a potential source for exogenous acquisition of Candida species, particularly the emerging multidrug-resistant Candida auris. However, limited information is available on environmental reservoirs of Candida species in healthcare facilities. Methods: During a 6-month period, cultures for Candida species were collected from high-touch surfaces in patient rooms and from portable equipment in 6 US acute care hospitals in 4 states. Additional cultures were collected from sink drains and floors in one of the hospitals and from high-touch surfaces, portable equipment, and sink drains in a hospital experiencing an outbreak due to C. auris. Candida species were identified using matrix-assisted laser desorption/ionization time-of-flight mass spectometry. Results: Candida species were recovered from patient rooms in 4 of the 6 hospitals. Seven of 147 patient room cultures (4.8%) and 1 of 57 (1.8%) portable equipment cultures were positive, with the most common species being C. parapsilosis. For the hospital where additional sites were sampled, Candida species were recovered from 8 of 22 (36.4%) hospital room floors and 4 of 17 (23.5%) sink drains. In the facility with a C. auris outbreak, Candida species were frequently recovered from sink drains (20.7%) and high-touch surfaces (15.4%), but recovery of C. auris was uncommon (3.8% of high-touch surfaces, 3.4% of sink drains, and 0% of portable equipment) and only present in rooms that currently or recently housed a patient with C. auris. Conclusion: Candida species often contaminate surfaces in hospitals and may be particularly common on floors and in sink drains. However, C. auris contamination was uncommon in a facility experiencing an outbreak, suggesting that current cleaning and disinfection practices can be effective in minimizing environmental contamination.

Objectives To examine the epidemiology of β-lactam resistance in 'clonal group 258' (CG258), a successful KPC clonal group, over 14 years. Methods Isolates were collected from 1999 to 2013 for a study of antibiotic resistance in Enterobacteriaceae in New York City; 515 bloodstream isolates had antibiotic susceptibility data available and 436 were available for a CG258 PCR assay. The 56 resulting CG258 isolates were characterized by MLST, capsular type and ESBL and KPC carriage. KPC-positive isolates were assessed for common KPC plasmid types, KPC subtype and Tn4401 isoform. Results RT-PCR revealed 56 isolates were CG258. Seventeen of the 56 CG258 isolates were phenotypically susceptible to all carbapenems (all KPC negative). Five out of 17 susceptible isolates were of the cps-2 (wzi154) capsule type; none was cps-1 (wzi29). Nineteen out of 28 KPC-2 isolates were cps-1 (wzi29) and 8/10 KPC-3 isolates carried cps-2 (wzi154); however, cps-2 (wzi154) predominated among KPC-2-positive isolates in 2003 and 2004. KPC-2 was first detected in 2003 and KPC-3 was first detected in 2006. KPC-harbouring plasmids pKpQIL (all Tn4401a) and pBK30683 (all Tn4401d) were detected in 16/38 and 6/38 carbapenem-resistant isolates, respectively. Discussion CG258-lineage Klebsiella pneumoniae isolates were completely absent in 1999, but common in 2003. Twenty-one percent of CG258 isolates were susceptible to carbapenems in addition to lacking both common ESBL and blaKPC-mediated resistance. The cps-2 (wzi154) capsule type was common in both these susceptible isolates and in early KPC-2-harbouring isolates, suggesting it was the initial capsule type in CG258. Carbapenem-resistant isolates carried common KPC-harbouring plasmids with the same KPC and Tn4401 isoforms, suggesting frequent clonal spread.

Ceftazidime-avibactam (CAZ-AVI) is a novel cephalosporin beta lactamase inhibitor combination that has shown activity against carbapenem-resistant Enterobactericeae. Data are limited on its utilization in the treatment of carbapenem-resistant Klebsiella pneumoniae osteomyelitis in solid organ transplant patients. We describe a case report on the use of CAZ-AVI in the treatment of vertebral osteomyelitis in a renal transplant recipient.

Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacteriaceae have now become a global public health threat. However, the origin of this pandemic and the characterization of pre-2003 bla(KPC)-harboring plasmids remain unknown. Here we used next-generation sequencing to characterize two KPC-2producing K. pneumoniae and K. michiganensis isolates collected from a New York City hospital in 1997. Although identified in two different Klebsiella species, the bla(KPC)-(2) gene was harbored by Tn4401b transposons on two highly similar IncN plasmids.

BACKGROUND:Patients on chronic intermittent renal replacement therapy (RRT) are at risk for infection with carbapenem-resistant Enterobacteriaceae (CRE). However, the impact of RRT on outcomes after CRE infections remains to be defined. Here we perform a comparison of outcomes for CRE-infected patients with preserved renal function compared with CRE-infected patients on RRT. METHODS:Cases and controls were defined from a prospective cohort of CRE-infected patients from the Consortium on Resistance against Carbapenems in Klebsiella and other Enterobacteriaceae (CRACKLE). Cases were defined as CRE-infected patients on RRT at hospital admission, while controls were defined as CRE-infected patients with serum creatinine <2 mg/dL and not receiving RRT at admission. Risk factors for 28-day in-hospital mortality were assessed using multivariable logistic regression. An ordinal ranking of outcomes by desirability analysis was performed. RESULTS:Patients on RRT were more likely to have diabetes mellitus and cardiac disease than controls. Urinary sources of infection were less common in the RRT group. In RRT patients, 28-day in-hospital mortality was increased as compared with controls: 22/71 (31%) vs 33/295 (11%). RRT remained significantly associated with 28-day in-hospital mortality after adjustment for source of infection, prehospitalization origin, and severity of illness (adjusted odds ratio, 2.27; 95% confidence interval [CI], 1.09-4.68; P = .03). Using univariable desirability of outcome ranking analysis, RRT status was associated with a 68% (95% CI, 61%-74%) chance of a worse disposition outcome. CONCLUSIONS:Chronic RRT in CRE-infected patients is associated with increased in-hospital mortality and worse disposition outcomes at 28 days.

Ceftazidime–avibactam (caz-avi) is a new treatment option for carbapenem-resistant Enterobacteriaceae (CRE). The Consortium on Resistance Against Carbapenems in Klebsiella and other Enterobacteriaceae (CRACKLE-2) is a multi-center, prospective, observational study of 60 hospitals in all five regions of the USA. Hospitalized patients with CRE isolated from clinical cultures are enrolled in CRACKLE-2. CRE was defined per CDC guidelines. Pitt Bacteremia score (PBS) and Charlson comorbidity score (CMS) were calculated. caz–avi susceptibility was tested as clinically indicated in participating clinical laboratories. From June 1, 2016–April 4, 2017, 568 unique patients with 591 admissions and 681 culture episodes (42% infection, 58% colonization) were included. The distribution of 252 first CRE infections per unique patient was 78 (31%) blood, 67 (27%) urine, 37 (15%) respiratory, 34 (13%) intra-abdominal, 30 (12%) wound, and 6 (2%) other. Patients with CRE infections were chronically ill (CMS median [IQR] 3 [1,5]) and acutely ill (PBS median [IQR] 3 [2,6]). Outcomes were available for 198 patients with infections; all-cause mortality was 29/198 (15%) at 14 days, and 55/198 (28%) at 90 days. K. pneumoniae (62%), E. cloacae (17%), and E. coli (13%) were the top three CRE species. A total of 124 isolates were tested for carbapenemase genes; 62/124 (50%), and 29/124 (23%) were positive for blaKPC-2, and blaKPC-3, respectively. Within 96 tested CR K. pneumoniae (CRKP) isolates, 22/96 (23%), 36/96 (38%), 38/96 (40%) were ST258-1, ST258-2, and non-ST258 clades, respectively. Antibiotic data were available for 224 patients with infections. In various combinations, 37/224 (16%) patients received polymyxins, 74/224 (33%) aminoglycosides, 111/224 (49%) carbapenems, 47/224 (21%) ceftazidime/avibactam, and 26/224 (12%) tigecycline. A total of 111 CRE were tested for caz–avi susceptibility; 32/111 (29%) were non-susceptible. All-cause mortality by caz–avi susceptibility did not differ among 62 patients with outcomes (P = 0.74). In this national sample of hospitalized patients with CRE, 29% of tested isolates were caz–avi non-susceptible. Results need to be confirmed by central laboratory testing. D. Van Duin, Astellas: Scientific Advisor, Consulting fee. Achaogen: Scientific Advisor, Consulting fee. Allergan: Scientific Advisor, Consulting fee. MedImmune: Scientific Advisor, Consulting fee. Shionogi: Scientific Advisor, Consulting fee. S. S. Richter, bioMerieux: Investigator, Research support. BD Diagnostics: Investigator, Research support. Roche: Investigator, Research support. BioFire: Investigator, Research support. OpGen: Investigator, Research support. K. S. Kaye, Xellia: Consultant, Consulting fee. Merck: Consultant and Grant Investigator, Consulting fee and Research support. The Medicines Company: Consultant and Grant Investigator, Consulting fee and Research support. C. Arias, Bayer Global: Consultant and Speaker’s Bureau, Consulting fee and Speaker honorarium. Medicines Company: Consultant, Grant Investigator and Speaker’s Bureau, Consulting fee, Grant recipient and Speaker honorarium. Merck: Consultant, Grant Investigator and Speaker’s Bureau, Consulting fee, Grant recipient and Speaker honorarium. Pfizer: Consultant and Speaker’s Bureau, Consulting fee and Speaker honorarium. Theravance: Consultant, Grant Investigator and Speaker’s Bureau, Consulting fee, Grant recipient and Speaker honorarium. Allergan: Consultant, Grant Investigator and Speaker’s Bureau, Consulting fee, Grant recipient and Speaker honorarium.

ST171 was identified as the most prevalent ST in carbapenem-resistant Enterobacter in 26/106 typed isolates from New York City by Gomez-Simmonds et al. There is no study of prevalence of this ST over time. To evaluate a large sample of Enterobacter, we designed a PCR assay to identify ST171 isolates rapidly. Isolates were collected in NYC as part of a cross-sectional Gram-negative antibiotic resistance assessment in the years, 2001, 2003–2004, 2006, 2009, and 2013. Agar dilution MIC were obtained for all isolates as part of these studies. We assayed 284 clinical Enterobacter isolates for ST171 using a novel PCR assay, forward primer AGAAGGACGATTTTGGCGCGGT and reverse ACTACGGTGGTAAAGAATGATCGCCA. Following amplification, ST171 positive isolates were identified by gel electrophoresis. Enterobacter isolates were also assessed for the presence of blaKPC using a previously described RT-PCR assay. ST171 was identified in 17/284 (6%) Enterobacter isolates. This sample collection was heavily antibiotic-resistant with 83/284 Enterobacter isolates harboring blaKPC.Of the 284 isolates, 142 (50%) were resistant to any carbapenem and 113 (40%) were resistant to ceftazidime. Of 17 ST171 positive Enterobacter isolates, 14(82%) were also contained blaKPC. These isolates were highly resistant, with 10/17(59%) exhibiting phenotypic resistance to carbapenems and 14/17(82%) were phenotypically resistant to ceftazidime. Twelve of the 17 isolates occurred in clusters of isolates of the same species occurring in a single hospital at the same time. There were 2 clusters of 3 cases and 3 clusters of 2 patients each. The oldest ST171 strain identified was an Enterobacter cloacae isolate collected in 2001. Prevalence of ST171 was calculated for each year of data: 1/40(2.5%) in 2001, 0/20 in 2003-04, 7/73(9.6%) in 2006, 6/38(15.8%) in 2009, and 3/113(2.7%) in 2013. Each sample collection year included a different group of participating hospitals. Here we evaluate a novel PCR assay for ST171 in Enterobacter spp. The oldest ST171 identified from 2001 was carbapenem susceptible suggesting that this strain type later acquired plasmid mediated carbapenem resistance. Prevalence of ST171 tracks with the prevalence of carbapenem resistance with a peak observed in 2009 for both and a decrease in 2013 All authors: No reported disclosures.

BACKGROUND Fluoroquinolone resistance in Mycobacterium tuberculosis is often conferred by DNA gyrase mutations. However, a substantial proportion of fluoroquinolone-resistant M. tuberculosis isolates do not have such mutations. METHODS Ofloxacin-resistant and lineage-matched ofloxacin-susceptible M. tuberculosis isolates underwent WGS. Novel candidate resistance mutations were confirmed by Sanger sequencing and conferral of resistance was assessed via site-directed mutagenesis and allelic exchange. Ofloxacin MIC was determined by resazurin microtitre assay (REMA) and the effects on MICs of efflux pump inhibitors (CCCP, reserpine and verapamil) were determined. RESULTS Of 26 ofloxacin-resistant isolates, 8 (31%) did not have resistance-conferring DNA gyrase mutations. The V762G mutation in Rv1783 (eccC5, encoding a protein in the ESX-5 membrane complex secretion system) was present on WGS in 8/26 (31%) resistant isolates and 0/11 susceptible isolates (P = 0.005). The mutation was identified in five isolates without DNA gyrase mutations and three isolates with such mutations; it was identified in both European-American and East Asian M. tuberculosis lineages. The ofloxacin MIC increased from 1 to 32 mg/L after introduction of the V762G mutation into M. tuberculosis H37Rv. In this strain with the V762G mutation, ofloxacin MIC did not change in the presence of efflux pump inhibitors. CONCLUSIONS A novel V762G mutation in Rv1783 conferred ofloxacin resistance in M. tuberculosis by a mechanism other than drug efflux. This occurred in a substantial proportion of resistant isolates, particularly those without DNA gyrase mutations.

ABSTRACT Heteroresistance is the coexistence of populations with differing nucleotides at a drug resistance locus within a sample of organisms. Although Sanger sequencing is the gold standard for sequencing, it may be less sensitive than deep sequencing for detecting fluoroquinolone heteroresistance in Mycobacterium tuberculosis . Twenty-seven fluoroquinolone monoresistant and 11 fluoroquinolone-susceptible M. tuberculosis isolates were analyzed by Sanger and Illumina deep sequencing. Individual sequencing reads were analyzed to detect heteroresistance in the gyrA and gyrB genes. Heteroresistance to fluoroquinolones was identified in 10/26 (38%) phenotypically fluoroquinolone-resistant samples and 0/11 ( P = 0.02) fluoroquinolone-susceptible controls. One resistant sample was excluded because of contamination with the laboratory strain M. tuberculosis H37Rv. Sanger sequencing revealed resistance-conferring mutations in 15 isolates, while deep sequencing revealed mutations in 20 isolates. Isolates with fluoroquinolone resistance-conferring mutations by Sanger sequencing all had at least those same mutations identified by deep sequencing. By deep sequencing, 10 isolates had a single fixed (defined as >95% frequency) mutation, while 10 were heteroresistant, 5 of which had a single unfixed (defined as <95% frequency) mutation and 5 had multiple unfixed mutations. Illumina deep sequencing identified a higher proportion of fluoroquinolone-resistant M. tuberculosis isolates with heteroresistance than did Sanger sequencing. The heteroresistant isolates frequently demonstrated multiple mutations, but resistant isolates with fixed mutations each had only a single mutation.

Journal of Hospital MedicineVolume 3, Issue 5 p. 430-430 Images Dx Purple like a glove Brandon Eilertson, Corresponding Author Brandon Eilertson beilert@emory.edu Department of Medicine, Emory University School of Medicine, Atlanta, Georgia609 Virginia Avenue NE 3303, Atlanta, GA 30306Search for more papers by this author Brandon Eilertson, Corresponding Author Brandon Eilertson beilert@emory.edu Department of Medicine, Emory University School of Medicine, Atlanta, Georgia609 Virginia Avenue NE 3303, Atlanta, GA 30306Search for more papers by this author First published: 24 October 2008 https://doi.org/10.1002/jhm.364Citations: 1Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat No abstract is available for this article.Citing Literature Volume3, Issue5September/October 2008Pages 430-430 RelatedInformation

ABSTRACT The importance in vivo of P2X7 receptors in control of virulent Mycobacterium tuberculosis was examined in a low-dose aerosol infection mouse model. P2X7−/− mice controlled infection in lungs as well as wild-type mice, suggesting that the P2X7 receptor is not required for control of pulmonary M. tuberculosis infection.

The study of antigen processing and presentation by human antigen presenting cells (APC) has been limited by difficulties of producing and maintaining human T-cell clones. Murine T-cell hybridomas have advantages for detecting specific peptide-MHC complexes on APC. Human antigen-specific immortalized T-cell lines have not been successfully produced. We report and validate the use of transgenic mice with human MHC genes for HLA-A2, DR1 and DR4 to produce murine T-cell hybridomas that are restricted to human HLA alleles and respond to human macrophages, dendritic cells (DC), and B-cell lines. Hybridomas restricted by human MHC-I and -II specific for influenza matrix protein, tetanus toxoid, diphtheria antigen CRM(197), and various M. tuberculosis antigens were produced. Epitope specificity was determined for several hybridomas. T hybridomas recognized peptide-MHC complexes on fixed APC for analysis of kinetics or susceptibility to inhibitors of antigen processing. T hybridomas restricted by human MHC represent convenient and powerful tools for the study of antigen processing by human APC.