Citrus yellow vein clearing virus (CYVCV) is a member of the Alphaflexiviridae family that causes yellow vein clearing symptoms on citrus leaves. A total of 118 leaf samples from nine regions of six provinces in Korea were collected from various citrus species in 2020 and 2021. Viral diagnosis using next-generation sequencing and reverse transcription polymerase chain reaction (RT-PCR) identified four viruses: citrus tristeza virus, citrus leaf blotch virus, citrus vein enation virus, and CYVCV. A CYVCV incidence of 9.3% was observed in six host plants, including calamansi, kumquat, Persian lime, and Eureka lemon. Among the citrus infected by CYVCV, only three samples showed a single infection; the other showed a mixed infection with other viruses. Eureka lemon and Persian lime exhibited yellow vein clearing, leaf distortion, and water-soak symptom underside of the leaves, while the other hosts showed only yellowing symptoms on the leaves. The complete genome sequences were obtained from five CYVCV isolates. Comparison of the isolates reported from the different geographical regions and hosts revealed the high sequence identity (95.2% to 98.8%). Phylogenetic analysis indicated that all the five isolates from Korea were clustered into same clade but were not distinctly apart from isolates from China, Pakistan, India, and Türkiye. To develop an efficient diagnosis system for the four viruses, a simultaneous detection method was constructed using multiplex RT-PCR. Sensitivity evaluation, simplex RT-PCR, and stability testing were conducted to verify the multiplex RT-PCR system developed in this study. This information will be useful for developing effective disease management strategies for citrus growers in Korea.

Since the List of Plant Diseases in Korea (DisList) was first published in 1986, the 6th edition appeared 36 years later. In 2023, the 6.1 edition, a revised and improved version of the 6th edition, was released to the public on the web free of charge. The contents of DisList increased, with the number of hosts increasing from 437 taxa to 1,420 taxa and the number of disease species increasing from 1,539 to 6,680. Among these, tree diseases are 3,586 species and their hosts include 504 taxa, providing much help to experts who need them. Meanwhile, the importance of accurate disease names continues to grow with the legalization of tree care, but many disease names are still inappropriate or misused, causing confusion. Disease names that do not follow the naming regulations are still registered, and even if the same pathogen infects hosts of the same taxa, the disease names are given differently, and there are many disease names that do not indicate the characteristics of the disease. Also, there are diseases reported without Korean names. In order to make DisList better, the review committee for disease names should establish the regulations to review and register disease names, and establish a system to review new disease names before publishing papers.

In 2020, within the Dongbaekdongsan area in Jeju Island, a Septobasidium sp. associated with a felt disease in Castanopsis sieboldii (Makino) Hatus. ex T. Yamaz. & Mashiba was identified. The symptom included the presence of brown, thin, and silk-like mycelial mats attached to the tree's bark, displaying variations in size from large to small. To induce hyphal growth, the samples collected were incubated in a moist chamber, and the newly formed hyphae were subjected to genomic DNA extractions. The nucleotide sequences of the internal transcribed spacer and small subunit rDNA genes were determined, and molecular characteristics among the isolates were investigated through polymerase chain reaction-based restriction fragment length polymorphism analysis. This Septobasidium sp. exhibited distinct morphological and phylogenetic features compared to those that were previously reported in South Korea. Consequently, this strain is taxonomically classified as a provisionally novel species of Septobasidium. Furthermore, the observed felt disease exhibited a high degree of host specificity, as it was exclusively identified in C. sieboldii without occurrence in other tree species at the time of observation.

Cucurbit chlorotic yellows virus (CCYV) is a plant virus that causes damage to cucurbit crops such as watermelon and cucumber, and is transmitted by an insect vector known as the whitefly. Since CCYV was first detected on cucumber in Chungbuk in 2018, it has been reported in other areas including Gyeongsang in Korea. In 2020, we performed field surveys of yellowing diseases in the greenhouses growing melon and watermelon in Chungbuk (Jincheon and Eumseong). Reverse transcription-polymerase chain reaction analysis of 79 collected samples including melon, watermelon, and weeds resulted in detection of CCYV in 4 samples: Three samples were singly infected with CCYV and one samples was mixed infected with CCYV, Cucurbit aphid borne yellows virus, and Watermelon mosaic virus. The complete genome sequences of the four collected CCYV melon isolates (ES 1–ES 4) were determined and genetically compared with those of previously reported CCYV isolates retrieved from GenBank. Phylogenetic analyses of RNA 1 and 2 sequences revealed that four ES isolates were clustered in one group and closely related to the CCYV isolates from China. The analysis also revealed very low genetic diversity among the CCYV ES isolates. In general, CCYV isolates showed little genetic diversity, regardless of host or geographic origins. CCYV has the potential to pose a serious threat to melon, watermelon, and cucumber production in Korea. Further studies are needed to examine the pathogenicity and transmissibility of CCYV in weeds and other cucurbits including watermelon.

In early spring, water-soaked lesions appeared on the petals and leaves of gaenari (Forsythia koreana), and the tissues were necrotic and dry. Cankers appeared on the infected branches around late spring and the above part of a branch withered and died. However, it was very rare that the base of the cankered-branch died. The identical fungi were isolated from the lesions on various tissues, and they grew with white colonies on potato dextrose agar medium. The fungus grew most actively at 23oC and produced many sclerotia of various sizes. In a pathogenicity assay in which mycelial and sclerotial suspensions were inoculated on each organ of forsythia, it was found that the pathogen infects the flower only, but not the leaves or branches. Symptoms on the flowers spread to the next leaves and branches over time and the infected branches were eventually withered. To identify the isolates, DNA sequences of four phylogenetic markers including ITS, LSU, Tub2, and CAL were analyzed and all isolates were identified as a species in the genus Septotinia. This is not only the first report of gaenari (forsythia) shoot blight caused by the fungus Septotinia sp., but also the first report on the genus Septotinia as a plant pathogen in Korea.

Patterns of occurrence of tomato yellow leaf curl virus (TYLCV) and tomato chlorosis virus (ToCV) with whitefly on summer-cultivated tomato in Gwangju-si, Gyeonggi Province were surveyed using multiplex reverse transcription-polymerase chain reaction in 2020. In addition, distribution of the whiteflies species and their viral transmission rates were investigated throughout the tomato growing season. The infection rates of TYLCV and ToCV increased sharply during harvest, and the single infection rates were 30.9% and 5.0%, respectively, with a mixed infection rate of the two viruses being the highest at 52.2%. Single infection with TYLCV and double infections with TYLCV and ToCV accounted for the majority with 83.1%. Bemisia tabaci were dominant over Trialeurodes vaporariorum in greenhouse grown plants, and all of the investigated B. tabaci biotypes were identified as Mediterranean (MED, formerly known as Q biotype). The transmission rate of TYLCV, detected in every sampled B. tabaci MED population, was 21.4%, and the mixed transmission rate with ToCV was 35.5%. Viruliferous MED whiteflies with ToCV showed a higher rate than that of T. vaporariorum. In the transplant stage, viruliferous rate of both TYLCV and ToCV of B. tabaci was 42.7%; this rate was highest in the harvest stage. In examination of tomato yield, the increase in the mixed infection rate of TYLCV and ToCV led to complete yield loss. When the mixed infection rate increased by 10%, the yield decreased by 405.4 kg/10a.

Recently, several in vitro studies have reported antiviral activity of agents of systemic acquired resistance against plant virus infection, but the approach has not been applied in a wide range of agricultural fields. The objective of this study was to evaluate the inhibitory effect of the exogenous application of salicylic acid (SA), chitosan (CH), or eugenol (EG) in tomato yellow leaf curl virus (TYLCV) infection of greenhouse-grown tomato plants. In vitro, the initial time of symptom was observed in TYLCV-infected plants (VP) of the resistant cultivar ‘Superdotaerang’ at 12 days post inoculation (dpi) after application of antiviral agents. At 32 dpi, the disease rate of TYLCV in the CHT+VP (0.1% chitosan and virus infected control) treated plants was 87.5%, lower than that of the other treatment. However, the virus content in the CHT+VP treated plants was higher than those of the other treatments, and SA, EG, and CH did not show significant effect on plant height or shoot and root fresh weight. Our results from summer-cultivated greenhouse-grown tomatoes show that none of the tested agents had an inhibitory activity on viral infection or yield of tomato ‘Dotaerangsola’cultivar. In contrast, all treated ‘TY Giants’ cultivars that possessed TYLCV resistance genes Ty-1 and Ty-3a did not show typical symptoms and the virus content was remarkably lower than those in the TYLCV treated plants in ‘Superdotaerang’. The results of this research indicated that the planting of resistant tomato cultivars was effective method instead of using SA, EG, and CH (known as resistance-inducing factors for control) of TYLCV in the field.

Programmed cell death (PCD), a characteristic feature of hypersensitive response (HR) in plants, is an important cellular process often associated with the defense response against pathogens. Here, the involvement of LytB, a gene encoding 4-hydroxy-3-methylbut-2-enyl diphosphate reductase that participates in the final step of the plastid methylerythritol phosphate (MEP) pathway, in plant HR cell death was studied. In Nicotiana benthmiana plants, silencing of the NbLytB gene using virus-induced gene silencing (VIGS) caused plant growth retardation and albino leaves with severely malformed chloroplasts. In NbLytB-silenced plants, HR-related cell death mediated by the expression of either the human proapoptotic protein gene Bax or an R gene with its cognate Avr effector gene was inhibited, whereas that induced by the nonhost pathogen Pseudomonas syringae pv. syringae 61 was enhanced. To dissect the isoprenoid pathway and avoid the pleiotropic effects of VIGS, chemical inhibitors that specifically inhibit isoprenoid biosynthesis in plants were employed. Treatment of N. benthamiana plants with fosmidomycin, a specific inhibitor of the plastid MEP pathway, effectively inhibited HR-related PCD, whereas treatment with mevinolin (a cytoplasmic mevalonate pathway inhibitor) and fluridone (a carotenoid biosynthesis inhibitor) did not. Together, these results suggest that the MEP pathway as well as reactive oxygen species (ROS) generation in the chloroplast play an important role in HR-related PCD, which is not displaced by the cytosolic isoprenoid biosynthesis pathway.

Sung-Hee Lee*, Hyunman Shin, Who-Bong Chang, Kyoung-Yul Ryu, Heung Tae Kim, Byeongjin Cha, and Jae-Soon Cha Bureau of Research & Development, Chungcheongbuk-do Agricultural Research and Extension Services, Cheongju 28130, Korea Department of Agro-food Safety and Crop Protection, National Institute of Agricultural Sciences, Rural Development Administration, Wanju 55365, Korea Department of Plant Medicine, Chungbuk National University, Cheongju 28644, Korea

Ilex integra, also called Mochi tree, is an woody ornamental common in Asia, particularly in Korea, China, Japan, and Taiwan. Anthracnose, caused by Colletotrichum spp., is an economically important disease worldwide, affecting both fruit and seed quality. In April 2019, symptoms of Anthracnose were observed on leaves from several Mochi trees in an urban planting in Wando-gun, South Korea. Irregularly shaped, light-to-dark brown spots of 1-4mm were observed on young leaves. The lesions coalesced as each spot enlarged, flat and black fruiting bodies (acervuli) occurred on the brown lesions. Four symptomatic leaves were collected; fractions were cut from symptomatic tissue, including healthy tissue, then were disinfected with 1% sodium hypochlorite and 70% ethanol, and placed on potato dextrose agar (PDA). After dark-incubation at 25℃ for 7 days two isolates were obtained, the fungal colonies appeared as white to light gray mycelium, then becoming dark and orange to pink on the underside. After acervuli were produced on the plate, orange-red conidial masses erupted. Conidia observed from two isolates were hyaline, 1-celled, and oblong with round to acute apices, and measured 7 to 12 × 2 to 5 μm (mean ± SD: 9.29 ±2.26 × 3.68± 1.31 μm) (n=30). Genomic DNA was extracted and multi-locus sequencing was performed with one representative isolate using the internal transcribed spacer (ITS) (White et al. 1990), actin (ACT) genes, chitin synthase 1 gene (CHS-1) (Carbone and Kohn 1999), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Calmodulin (CAL) (Weir et al. 2012) and submitted. Blast search results showed that the isolate had 100%, 98.45%, 99.74%, 100%, and 100% nucleotide sequence identity with those of C. fioriniae (MT607651, MH717601, MG666441, MN895544, MN974144) respectively (Jamin and Mateu 2008). The five sequences were deposited in NCBI GenBank (Accession No: MT457472, MT465884, MT465885, MT465886, MT465887), which were assigned to ITS, ACT, CHS-1, GAPDH, and CAL regions, respectively. Based on the morphology (Shivas and Tan 2009) and molecular characterization (Guerber et al. 2003), the isolate was identified as C. fioriniae. To confirm pathogenicity, a conidial suspension (10⁶ conidia/ml) of the sequenced isolate was used to inoculated, young and mature leaves of a 4-year-old Mochi tree. Ten leaves of the seedling were disinfected with 70% ethanol, then were wounded with a toothpick. The conidial suspension (20 µl) was placed on the wound. The inoculated plant and control plants were tested with sterilized water and incubated at 25℃ in a moist chamber. The pathogenicity test was repeated three times. Typical spots were observed on the young leaves 2 days after inoculation, whereas they were observed on the mature leaves 7 days after inoculation. Acervuli developed on both young and mature leaves 5 and 20 days after treatment, respectively. The control plants did not show symptoms, and the fungus was re-isolated from the inoculated plant; thus, fulfilling Koch's Postulates. In Korea, C. fioriniae has been recorded as a pathogen of fruit (apple, eggplant and peach), but this is the first report of the fungus causing anthracnose on Mochi tree. The pathogen has been reported on leaves of a different Ilex species in the eastern USA (Farr and Rossman 2020). Although this new disease of I. integra is limited occurrence, C. fioriniae may be able to infect other plant species in South Korea.

Our study investigated the available chlorine content, contact time and difference among strains of each pathogen for sodium hypochlorite (NaOCl) to control chemically against soil-borne fungal pathogens, such as Phytophthora rot by Phytophthora cactorum, violet root rot by Helicobasidium mompa, and white root rot by Rosellinia necatrix, causing die-back symptom on apple trees. As a result, the colony growth of Phytophthora cactorum was inhibited completely by soaking over 5 s in 31.25 ml/l available chlorine content of NaOCl. Those of H. mompa and R. necatrix were inhibited entirely by soaking over 160 s in 62.5 and 125 ml/l available chlorine content in NaOCl, respectively. Also, inhibition effect on available chlorine in NaOCl among strains of each soil-borne pathogen showed no significant difference and was similar to or better than that of fungicides.

HomePlant DiseaseVol. 103, No. 2First Report of Watermelon mosaic virus on Malva verticillata in Korea PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Watermelon mosaic virus on Malva verticillata in KoreaJ.-E. Kim, H.-R. Kwak, H.-S. Choi, M. Kim, W.-K. Jung, J.-K. Seo, J.-S. Kim, and B. ChaJ.-E. KimSearch for more papers by this author, H.-R. KwakSearch for more papers by this author, H.-S. ChoiSearch for more papers by this author, M. Kim†Corresponding author: M. Kim; E-mail: E-mail Address: mkim00@korea.krhttp://orcid.org/0000-0003-3154-8178Search for more papers by this author, W.-K. JungSearch for more papers by this author, J.-K. Seohttp://orcid.org/0000-0003-4363-1462Search for more papers by this author, J.-S. KimSearch for more papers by this author, and B. ChaSearch for more papers by this authorAffiliationsAuthors and Affiliations J.-E. Kim H.-R. Kwak H.-S. Choi M. Kim † , Crop Protection Division, National Institute of Agricultural Science, Wanju 55365, South Korea W.-K. Jung , Organic Agriculture Research Institute, Gyeongsangbuk-do Agricultural Research Extension Services, Euiseong, 37339, South Korea J.-K. Seo , Graduate School of International Agricultural Technology, Seoul National University, Pyeongchang 25354, South Korea J.-S. Kim , Department of Plant Medicine, Andong National University, Andong 36729, South Korea B. Cha , Department of Plant Medicine, Chungbuk National University, Cheongju 28644, South Korea. Published Online:21 Dec 2018https://doi.org/10.1094/PDIS-07-18-1159-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Watermelon mosaic virus (WMV; genus Potyvirus) is one of the most prevalent and widespread viruses affecting cucurbit crops. Symptoms of chlorosis and mosaic were reported on ginseng (Panax ginseng) leaves from South Korea and were found to be caused by WMV; however, the isolate (WMV-Insam) was not mechanically transmissible to cucurbit plants (Jung et al. 2013). In June 2013, during a survey of viral diseases in fields on ginseng farms in Gyeongsangbuk-do, Korea, WMV was detected by reverse transcription polymerase chain reaction (RT-PCR) on 43 out of 44 samples including ginseng, cluster mallow (Malva verticillata), and squash (Cucurbita moschata) using the WMV-specific primer set WMV-UNI-1F (CAGTTTGAATCATGGTACAGCGC) and WMV-UNI-1R (TGTGCTATTGCTTCTCTTGCCC). One of two cluster mallow plants, collected at Yeongju City and testing positive for WMV and showing yellow and mosaic foliar symptoms, was used for sap transmission with phosphate buffer to four different indicator host plants including C. pepo, C. moschata, Chenopodium quinoa, and C. amaranticolor. Additionally, ginseng and squash (C. moschata) plants collected from the same area and testing positive for WMV were used to mechanically inoculate the virus to the same set of indicator plants. Systemic symptoms were observed on leaves of C. pepo and C. moschata within 2 weeks of inoculation with tissue from systemically infected leaves of cluster mallow and squash (C. moschata), respectively; however, the indicator host plants inoculated with infected ginseng leaves did not show any symptoms. Plant infection was confirmed by nucleic acid extraction and RT-PCR using the primers WMV-UNI-1F and WMV-UNI-1R and subsequent sequencing. Results demonstrated that the symptomatic indicator plants were positive for the presence of WMV but not the asymptomatic plants. To genetically characterize the WMV cluster mallow isolate, RT-PCR was performed using primers designed to amplify the full-length WMV genomic RNA, using methods modified from Seo et al. (2009). DNA sequencing was performed by Geno Tech (Daejeon, Korea). The full-length genome of WMV-YJ7-2(cm) was 10,046 nucleotides, and the sequence was deposited into GenBank under accession KT992089. BLAST analysis showed that complete genes of the WMV-YJ7-2(cm) isolate have nucleotide identities of 95 and 96% with Yeongju2-3 (KT992085, ginseng) and Uiseong3-5(sq) (KT992080, squash) from Korea, respectively, and it shares 92 to 93% similarity with WMV isolates VE10-099 (KC292915, Cucumis anguria L.), CHN (DQ399708, watermelon), and CHI87-620 (EU660580, zucchini). To determinate the possibility of mixed infections with other viruses, cluster mallow samples were also analyzed by RT-PCR for cucumber mosaic virus, beet western yellow virus, Malva vein clearing virus, and turnip mosaic virus, which are known to infect plant of the Malvaceae family (Lunello et al. 2009; Valouzi et al. 2017), but all were negative. To our knowledge, this is first report of natural infection of WMV in M. verticillata in Korea. Since WMV was first reported in Korea (Chang et al. 1980), the virus has become one of most economically important viruses of cucurbits and ginseng. This report demonstrates that cluster mallow could be a potentially important host for transmission of WMV to cucurbits; however, further studies will be needed to characterize the epidemiological importance of WMV-infected ginseng.References:Chang, M.-U., et al. 1980. Kor. J. Plant Prot. 19:193. Google ScholarJung, W.-K., et al. 2013. Res. Plant Dis. 19:331. https://doi.org/10.5423/RPD.2013.19.4.331 Crossref, Google ScholarLunello, P., et al. 2009. Virus Res. 140:91. https://doi.org/10.1016/j.virusres.2008.11.006 Crossref, ISI, Google ScholarSeo, J.-K., et al. 2009. Virology 393:91. https://doi.org/10.1016/j.virol.2009.07.007 Crossref, ISI, Google ScholarValouzi, H., et al. 2017. New Dis. Rep. 35:15. https://doi.org/10.5197/j.2044-0588.2017.035.015 Crossref, Google ScholarJ.-E. Kim, H.-S. Choi, W.-K. Jung, and B. Cha contributed equally to this work.Funding: This research was supported by grants from the Agenda Program funded by the Rural Development Administration of Korea (PJ01253402).DetailsFiguresLiterature CitedRelated Vol. 103, No. 2 February 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 24 Jan 2019Published: 21 Dec 2018First Look: 20 Sep 2018Accepted: 17 Sep 2018 Page: 380 Information© 2019 The American Phytopathological SocietyFundingAgenda Program funded by the Rural Development Administration of KoreaGrant/Award Number: PJ01253402Cited byFirst Report of Watermelon Mosaic Virus Naturally Infecting Coriander (Coriandrum sativum) and causing a leaf mottling disease in CaliforniaMargaret K. Cespedes, Tomas A. Melgarejo, Peter Montgomery Henry, Maher Al Rwahnih, and Robert Gilbertson21 September 2022 | Plant Disease, Vol. 0, No. jaComplete genome sequence of malva-associated soymovirus 1: a novel virus infecting common mallow26 April 2022 | Virus Genes, Vol. 58, No. 4Watermelon mosaic virus (watermelon mosaic)CABI Compendium, Vol. CABI Compendium

The 4 viruses, the Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV), and Apple mosaic virus (ApMV) and 1 viroid, Apple scar skin viroid (ASSVd) are known major viral pathogens of apple trees in Korea. Infection degree of the 5 viral pathogens in the commercial nursery trees of major apple cultivars, ‘Hongro’, ‘Fuji’ and bud mutation of ‘Fuji’ was investigated. Infection ratio of the ACLSV, ASPV and ASGV for scion of an apple cultivar ‘Hongro’ were 100%, 81.3% and 100%, respectively. On the other hand, no infection for either ApMV and ASSVd detected. For the root stock of the cultivar, infection ratio of ACLSV, ASPV and ASGV showed 87.5%, 81.3% and 100% as well as ApMV and ASSVd were 12.5% and 6.3%, respectively. From the scion of apple cultivars ‘Fuji’ and bud mutation of ‘Fuji’, infection ratio of ACLSV, ASPV and ASGV showed 86.7%, 86.7% and 100%, respectively. Whereas, no infection for either ApMV or ASSVd detected. From the root stock of the cultivars, infection ratio of ACLSV, ASPV and ASGV showed 86.7%, 93.3% and 93.3% as well as ApMV and ASSVd were 12.5% and 6.3%, respectively. Result of our study indicates that most of commercial nursery apple trees were supplied with multiple infections by apple viruses causing potential losses for apple growers and, henceforth, agricultural policy for supply of the virus-free trees should be employed as soon as possible.

In December of 2016, ‘The Forest Protection Act’ was amended partly in The National Assembly and the socalled ‘Tree Doctor Act’ was promulgated. Tree Doctor Act will be enforced from June 28, 2018. Under the new Act, none other than ‘Tree Hospital’ can do disease and pest management work for trees in public living space. The only exclusive qualification for tree hospital is a ‘Tree Doctor’, the government registered license which is newly established by the Act. To become a tree doctor, he/she must complete the tree doctor training courses in the designated ‘Tree Doctor Academy’ and pass the qualification test. Currently, Korea Forest Service is drafting the enforcement ordinances and regulations for the implement of Tree Doctor Act. When taking into consideration that the most fundamental and important discipline of the plant and tree health care is the plant pathology, and that the tree health care is a promising business for young plant pathology people, Korean Society of Plant Pathology is ought to be actively involved in the preparation of the enforcement ordinances and regulations, and help the early establishment of the new tree health care system in living spaces of Korea.

Restricted usage of chemical nematicides has led to development of environmentally safe alternatives. A culture filtrate of Aspergillus niger F22 was highly active against Meloidogyne incognita with marked mortality of second-stage juveniles (J2s) and inhibition of egg hatching. The nematicidal component was identified as oxalic acid by organic acid analysis and gas chromatography-mass spectroscopy (GC-MS). Exposure to 2 mmol/L oxalic acid resulted in 100% juvenile mortality at 1 day after treatment and suppressed egg hatching by 95.6% at 7 days after treatment. Oxalic acid showed similar nematicidal activity against M. hapla, but was not highly toxic to Bursaphelenchus xylophilus. The fungus was incubated on solid medium and dried culture was used for preparation of a wettable powder-type (WP) formulation as an active ingredient. Two WP formulations, F22-WP10 (ai 10%) and oxalic acid-WP8 (ai 8%), were prepared using F22 solid culture and oxalic acid. In a field naturally infested with M. incognita, application of a mixture of F22-WP10 + oxalic acid-WP8 at 1,000- and 500-fold dilutions significantly reduced gall formation on the roots of watermelon plants by 58.8 and 70.7%, respectively, compared to the non-treated control. The disease control efficacy of the mixture of F22-WP10 + oxalic acid-WP8 was significantly higher than that of a chemical nematicide, Sunchungtan (ai 30% fosthiazate). These results suggest that A. niger F22 can be used as a microbial nematicide for the control of root-knot nematode disease.

Control of nematode has become difficult owing to the restricted use of effective soil fumigant, methyl bromide, and other non-fumigant nematicides. Therefore, it is urgently necessary to develop microbial nematicide to replace chemical nematicides. In this study, the 50% aqueous methanol extraction solution of fermentation broths of 2,700 actinomycete strains were tested for their nematicidal activity against second stage of juveniles (J2s) of Meloidogyne incognita. As the results, only the 50% aqueous methanol extraction solution of AN110065, at 20% equivalent to 10% fermentation broth, showed strong nematicidal activity with 78.9% of mortality 24 h after treatment and 94.1% of mortality at 72 h. The 16S rRNA gene sequencing showed that the strain sequence was 99.78% identical to Streptomyces netropsis. The extract of S. netropsis AN110065 fermentation broth was successively partitioned with ethyl acetate and butanol and then the ethyl acetate, butanol and water layers were investigated for their nematicidal activity against the M. incognita. At 1,000 mg/ml, ethyl acetate layer showed the strongest activity of 83.5% of juvenile mortality 72 h after treatment. The pot experiment using the fermentation broth of AN110065 on tomato plant against M. incognita displayed that it evidently suppressed gall formation at a 10-fold diluent treatment. The tomato plants treated with the fermentation broth of S. netropsis AN110065 did not show any phytotoxicity. The results suggest that S. netropsis AN110065 has a potential to serve as microbial nematicide in organic agriculture.

Colletotrichum gloeosporioides탄저병균은 우리나라 감 재배지 주요 병의 하나이다. 2013년 상주 지역 감(Diosprosi kaki) 과원에서 C. gloeosporioides에 의하여 감염된 신초, 과일 및 잎으로부터 병원균을 분리하여 prochloraz manganese complex, tebuconazole, mancozeb+myclobutanil, fluquinconazole+prochloraz, tebuconazole+tolyfluanid 등 총 5종의 살균제에 대한 반응을 조사하였다. 분리된 67 균주 모두 공시 약제의 포장적용 농도에서 균사생육이 완전히 억제되었다. Tebuconazole의 $EC_{50}$값의 범위는 $0.02-1.04{\mu}g/ml$이었으며 평균 $0.31{\mu}g/ml$이었다. Pochloraz manganese complex의 $EC_{50}$값의 범위는 $0.02{\sim}0.23{\mu}g/ml$이었으며 평균 $EC_{50}$값은 $0.078{\mu}g/ml$이었다. Fluquinconazole+Prochloraz(FP)에 대한 $EC_{50}$값을 조사한 결과, 평균 $0.029{\mu}g/ml$이었다. $EC_{50}$값에 기초한 약제간 상관계수 r은 tebuconazole과 prochloraz manganese complex간에는 0.42이었으며, prochoraz manganese complex와 FP 합제 간에는 0.44, tebuconazole과 FP 합제 간은 0.27이었다. Colletotrichum gloeosporioides is one of the most serious pathogens of persimmon in Korea. In 2013, 67 isolates of C. gloeosporioides were isolated from infected fruits, leaf and twigs of persimmon (Diosprosi kaki) at Sangju, Gyeongsangbukdo and fungal responses against five fungicides (prochloraz manganese complex, tebuconazole, mancozeb+myclobutanil, fluquinconazole+prochloraz, and tebuconazole+tolyfluanid) were evaluated by their growth on the fungicide-medium. All isolates were inhibited mycelium growth on the medium with each recommended application concentration of flied. $EC_{50}$ (${\mu}g/ml$) of tebuconazole was from 0.02 to 1.04 and average was 0.31. $EC_{50}$ (${\mu}g/ml$) of prochloraz manganese complex was 0.02~0.23 average was 0.078. Average $EC_{50}$ values (${\mu}g/ml$) of Fluquinconazole+Prochloraz (FP) was 0.029. On the basis $EC_{50}$ (${\mu}g/ml$), the correlation coefficient (r) between tebuconazole and prochloraz manganese complex, prochloraz manganese complex and FP, tebuconazole and FP were 0.42, 0.44 and 0.27, respectively.

A viral disease causing severe mosaic, necrotic, and yellow symptoms on Vigna angularis var. nipponensis was prevalent around Suwon area in Korea. The causal virus was characterized as Cucumber mosaic virus (CMV) on the basis of biological and nucleotide sequence properties of RNAs 1, 2 and 3 and named as CMV-wVa. CMV-wVa isolate caused mosaic symptoms on indicator plants, Nicotiana tabacum cv. Xanthi-nc, Petunia hybrida, and Cucumis sativus. Strikingly, CMV-wVa induced severe mosaic and malformation on Cucurbita pepo, and Solanum lycopersicum. Moreover, it caused necrotic or mosaic symptoms on V. angularis and V. radiate of Fabaceae. Symptoms of necrotic local or pin point were observed on inoculated leaves of V. unguiculata, Vicia fava, Pisum sativum and Phaseolus vulgaris. However, CMV-wVa isolate failed to infect in Glycine max cvs. ‘Sorok’, ‘Sodam’ and ‘Somyeong’. To assess genetic variation between CMV-wVa and the other known CMV isolates, phylogenetic analysis using 16 complete nucleotide sequences of CMV RNA1, RNA2, and RNA3 including CMV-wVa was performed. CMV-wVa was more closely related to CMV isolates belonging to CMV subgroup I showing about 85.1–100% nucleotide sequences identity to those of subgroup I isolates. This is the first report of CMV as the causal virus infecting wild Vigna angularis var. nipponensis in Korea.

Glycine max (Soybean) is the most important edible crop in Korea. In Korea, eight viruses have been reported to infect soybean, including Alfalfa mosaic virus (AMV), Cowpea mosaic virus (CPMV), Cucumber mosaic virus (CMV), Soybean dwarf virus (SbDV), Soybean mosaic virus (SMV), Soybean yellow common mosaic virus (SYCMV), Soybean yellow mottle virus (SYMMV), and Peanut stunt virus (PSV) (1). In 2012, Glycine max were observed in Daegu, South Korea, with mosaic and mottling symptoms on leaves. Samples with virus-like symptoms (n = 151) were collected from Daegu including legume genetic resource field. Virus particles were filamentous rod shaped, average length 760 nm, and were analyzed by RT-PCR using specific primers for several Potyviruses and previously reported viruses infecting soybean. Only two samples showing mosaic and mottling symptoms were identified as Clover yellow vein virus (ClYVV) based on RT-PCR using primers specific for ClYVV (5′-GTTGGCTTGGTTGACACTGA-3′ and 5′-CTTCGATCATGGATGCACA-3′). The sequences of amplified fragments were 97 to 98% similar with ClYVV. ClYVV is a distinct species in the genus Potyvirus and family Potyviridae. ClYVV is transmitted by several species of aphids and by mechanical inoculation (2). ClYVV was first reported on Gentiana scabra, and the disease has never been reported in soybean fields in Korea. The biological properties and full genome sequence of the selected ClYVV isolate of apparent virus symptoms between two samples were analyzed. The ClYVV isolate was inoculated to local lesion plants, re-isolated from local lesions three times, and propagated in Nicotiana benthamiana, and then named ClYVV-Gm. The ClYVV-Gm induced local lesions on inoculated leaves of N. tabacum cv. Xanthi-nc, Tetragonia expansa, and systemic symptoms on upper leaves of Chenopodium amaranticolor, C. quinoa, and N. clevelandii. The ClYVV-Gm caused mosaic and mottling symptoms on Glycine max cv. Kwangan and Phaseolus vulgaris. The genome of ClYVV-Gm was determined to be 9,584 nucleotides in length (GenBank Accession No. KF975894), and it shared 83% to 97% nucleotide identity with the sequences of 27 previously reported ClYVV isolates including Vicia fava and Pisum sativum. Despite low occurrence of ClYVV in Glycine max, ClYVV has a broad host range including tobacco, weed species, and soybean, which can lead to spreading of the virus. Our results indicate that emergence of ClYVV could become a problem to Leguminosae in Korea. To our knowledge, this is the first biological and molecular report of ClYVV infecting Glycine max in Korea. References: (1) Y. H. Lee et al. Korea Soybean Digest 29:7, 2012. (2) T. Sasaya et al. Phytopathology 87:1014, 1997.