A highly divergent isolate of rice stripe virus (RSV, Tenuivirus oryzaclavatae) was identified by high-throughput sequencing (HTS) of volunteer durum wheat (Triticum turgidum subsp. durum (Desf.) Husn.) plants collected in summer 2023 in Loir-et-Cher (France). The complete sequence of all four genomic RNAs was obtained from a single plant, showing a genomic organization similar to that of known RSV isolates but with significant indel polymorphism in non-coding regions. Genomic RNAs showed between 81.6% (RNA4) and 88.3% (RNA3) nucleotide identity with RSV reference isolates, while encoded proteins showed between 86.3% (NSvc2) and 97.4% (L and NSvc4 (movement protein)) with those of the reference RSV isolate. The 97.4% identity in the L protein should be compared with the average pairwise identity of 99.0% +/- 0.1% among all RSV isolates present in GenBank, as well as with the ICTV species demarcation threshold of 5% divergence. This demonstrates that the French wheat variant is indeed an RSV isolate but a highly divergent one, which questions our current understanding of RSV geographic distribution, diversity and evolution history.

Analysis of French Poaceae pools collected in 2023 identified spartina mottle virus (SpMV, Phragmivirus spartinae) infection in green foxtail (Setaria viridis). RNASeq of two plants yielded near complete SpMV genomes and a complete barley yellow striate mosaic virus genome (BYSMV, Betacytorhabdovirus hordei). The novel SpMV genomes show only 79.3-80.4% nt identity with those of German and USA isolates (92-92.6% aa identity), while the BYSMV sequence is 94% identical with the only complete BYSMV genome available. Besides providing novel information of the genetic variability of these two viruses, these results extend the known natural host range and distribution of SpMV.

Privet leaf blotch-associated virus (PLBaV) is an Idaeovirus discovered by high-throughput sequencing (HTS) in privet (Ligustrum japonicum L) in southern Italy in 2017 (Navarro et al., 2017). In privet, it causes a leaf blotch disease with yellowish or whitish chlorotic blotches or ringspots. Since this initial discovery, there have been no further reports of PLBaV and a single genomic sequence is available in GenBank (LT221868-9). A GenBank entry (HM153080) suggests that PLBaV might also infect ash (Fraxinus excelsior L.). In June 2024, a lilac (Syringa vulgaris L.) showing poor growth and leaf symptoms of light green chlorotic rings and lines was observed near Bordeaux, France. Total RNAs were extracted (Khalili et al., 2022) from symptomatic leaf tissue and analyzed by HTS (2x150 nucleotides (nt) paired reads, Illumina NovaSeq) following ribodepletion (Ribo-off rRNA Depletion Kit(Plant) and VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina, Nanjing Vazyme Biotech Co, Nanjing, China). The obtained reads were trimmed, de novo assembled or mapped against references using CLC Genomics Workbench 24.0 with default settings (Candresse et al., 2018) and contigs annotated by blastx against GenBank. Two contigs were identified with very high homology with the genomic RNAs of the PLBaV reference isolate from privet. No other virus or viroid contig was identified from the lilac dataset. The RNA1 contig (5354 nt) misses only 17 nt at the 5' end and 6 nt at the 3' end and is 97.9% identical to the RNA1 of the reference isolate (LT221868). It involves 67,742 reads (0.25% of the total of 24.9 million reads of an average length of 148.6 nt), for an average coverage of 1741x. The RNA2 contig (2335 nt) misses 14 nt at the 5' end and is complete at the 3' end. It is 98.2% identical to the reference isolate (LT221869) and involves 75,140 reads (0.3% of total reads) for a 4769x average coverage. The sequences of these two contigs, representing the second near complete PLBaV genome have been deposited in GenBank (PQ786942-43). To confirm PLBaV presence in the original lilac sample, specific primers were designed for both genomic RNAs. RNA1 was amplified using primer pair PLBaV-RNA1-R1 5' TCGATTCTCAGCAATGAGATG 3' and PLBaV-RNA1-F1 5' CTGTGTGCGTTGGTCTGAGT 3' while RNA2 was amplified using the pair PLBaV-RNA2-R1 5' TGGTTGAGGTCGAGAGGTG 3' and PLBaV-RNA2-F1 5' ACTCAAGCGTAAGATGGCGTC 3'. Using the RNA purification and RT-PCR protocols of Khalili et al. (2022), both primer pairs were used at a 57°C annealing temperature, yielding amplicons of the expected size (respectively 392 and 301 nt) showing 100% identity with the HTS contigs. To the best of our knowledge, this is the first report of PLBaV in lilac in France and the second report of PLBaV ever, representing the identification of a new natural host and an extension of the known geographical distribution. Lilac, similar to privet and ash is a member of the Oleaceae family, further strengthening the association between PLBaV and this family. Since no other viral agent was identified in the HTS analysis, the chlorotic ringspot symptoms that prompted this investigation were most likely caused by PLBaV. The affected plant has since died but whether the initial poor growth and later death were caused by PLBaV is not known as these symptoms might have had another cause. Raspberry bushy dwarf virus (RBDV) the best known Idaeovirus is transmitted by pollen and seed (Isogai et al., 2014), raising the question of whether PLBaV might be similarly transmitted in its various hosts. The rarity of PLBaV reports since its discovery in 2017 suggest it should be of low concern but data is needed to better evaluate its presence in and pathogenicity to lilac.

A novel capulavirus was identified by high-throughput sequencing in four sugar beet (Beta vulgaris L.) plants collected in April 2023 in Normandy (France). The complete genome of 2744 nucleotides (nt) was sequenced and found to have an organization similar to that of known capulaviruses, with which it showed close phylogenetic relationships. In addition, data mining of a publicly available Thalictrum thalictroides whole-genome shotgun sequence assembly allowed the identification of a contig (JABWDY010003008.1) representing a longer-than-unit length, likely episomal, genome with 99.4% nt sequence identity to the genome of the French beet isolate. The genome of the novel virus shares only 60.7-66.9% nt sequence identity with known capulaviruses, which is well below the species demarcation threshold of 78%, suggesting that a new species should be created to accommodate it. The common name "beet capulavirus 1" (BCV1) is proposed for this novel virus. Given that BCV1 was identified in plants that were coinfected with beet yellows virus, no conclusions can be drawn at this stage about its potential pathogenicity.

Viral exchanges between crops and wild plants are important considerations in virus ecology and epidemiology but remain poorly understood. To investigate such exchanges, we compared the viromes of wild and farmed carrots (Daucus carota subsp.) growing near each other in France. Farm populations included cultivated varieties and off-type carrots (resembling wild ones) growing among them. This crop-wild relative pathosystem offers notable opportunities for virus exchange due to the hosts' genetic closeness and geographic proximity. High-throughput sequencing found that viral taxonomic richness was greatest in wild carrots. However, hierarchical clustering and bipartite network analyses revealed that wild and farm carrot viromes differed in their seedborne and vector-borne components. About 50% of viral taxa were shared among population types, whereas others were uniquely associated with either wild or farm carrots. Individual-plant RT-PCR testing of 16 aphid-borne agents from the shared core virome found that their prevalence was generally greatest in farm populations, with some geographic variability in virus pressure. The viromes of off-type and cultivated carrots were most similar, suggesting that proximity and/or management practices influence virome properties. For some aphid-borne viruses, similar isolates were found in wild and cultivated carrots, suggesting exchanges between them or with a shared source. However, isolates of other aphid-borne viruses clustered by carrot type, indicating barriers to viral fluxes that might involve differential susceptibility of populations, vector preferences, or unidentified factors. To improve virus management, we need better understanding of how specific facilitators and barriers of viral exchange can be manipulated to reduce negative viral impacts.Copyright (c) 2025 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Here, we report the discovery of a new beny-like virus in winter wheat (Triticum aestivum L.) plants collected in the Brittany and Burgundy regions of France in spring 2022, using a high-throughput sequencing approach. A complete genome sequence, comprising two genomic RNAs of 6734 nt (RNA1) and 4856 nt (RNA2) was obtained. This genome shows a typical benyvirus organization, with the RNA1 encoding a large replication-associated protein and the RNA2 encoding, from 5' to 3', the coat protein and its readthrough domain and a triple gene block. Pairwise sequence comparisons and phylogenetic analysis showed that the new virus is a member of the family Benyviridae and that its closest relatives are the recently described beny-like virus wheat stripe mosaic virus and, somewhat more distantly, other recognized benyviruses. Creation of a new species to accommodate the new virus, with the proposed common name "wheat beny-like virus 1" (WBLV1), is suggested, either in the genus Benyvirus or in another genus to be created within the family Benyviridae. Given that WBLV1 was identified in plants that were coinfected by other viruses, no conclusions can be drawn at this stage on its potential pathogenicity.

In Spring 2024, a symptomatic plant of China rose ( Hibiscus rosa-sinensis) ) showing leaf yellowing and deformation, located in the province of Naples (South Italy), was re-sampled for further investigations. Total RNAs were purified from leaves and subjected to Illumina HTS analysis. Results confirmed that the plant was infected by hibiscus chlorotic ringspot virus (HCRSV), citrus exocortis viroid (CEVd), and citrus viroid VI (CVd-VI). The two viroids had not been previously detected in China rose. HTS results were confirmed by RT-PCR in the re-sampled plant, and in three nearby China rose plants with the same symptoms, using specific primer pairs for the three pathogens, followed by Sanger sequencing and BLAST analysis of the sequences. Different results obtained can be due to differing sensitivity and specificity in HTSbased detection of plant viruses. This is the first report of multiple infections by HCRS, CEVd and CVd-VI in China rose, which is also a new host for both of the viroids.

There is limited information on the compared performances of biological, serological. and molecular assays with high-throughput sequencing (HTS) for viral indexing in temperate fruit crops. Here, using a range of samples of predetermined virological status, we compared two performance criteria (inclusivity and analytical sensitivity) of enzyme-linked immunosorbent assay (ELISA), molecular hybridization, reverse transcription (RT)-PCR, and double-stranded RNA (dsRNA) HTS for the detection of a total of 14 viruses (10 genera) and four viroids (three genera). When undiluted samples from individual plants were used, ELISA had the lowest performance, with an overall detection rate of 68.7%, followed by RT-PCR (82.5%) and HTS (90.7%; 100% if considering only viruses). The lower performance of RT-PCR reflected the inability to amplify some isolates as a consequence of point mutations affecting primer-binding sites. In addition, HTS identified viruses that had not been identified by other assays in nearly two-thirds of the samples. Analysis of serial dilutions of fruit tree samples allowed comparison of analytical sensitivities for various viruses. ELISA showed the lowest analytical sensitivity, but RT-PCR showed higher analytical sensitivity than HTS for most of the samples. Overall, these results confirm the superiority of HTS over biological indexing in terms of speed and inclusivity and show that while the absolute analytical sensitivity of RT-PCR tends to be higher than that of HTS, PCR inclusivity is affected by viral genetic diversity. Taken together, these results make a strong case for the implementation of HTS-based approaches in fruit tree viral testing protocols supporting quarantine and certification programs.

Using a high-throughput sequencing (HTS) approach, we report the discovery of a new alphasatellite identified in a winter barley plant collected in France in 2022 that was also infected by wheat dwarf virus (WDV). The presence of the satellite and of WDV was confirmed by several independent PCR assays, and the complete genome sequence was determined. The circular satellite genome is 1424 nt long and shows typical hallmarks of members of the subfamily Geminialphasatellitinae, including a replication-associated hairpin with a CAGTATTAC sequence and a Rep-encoding open reading frame (ORF). It also possesses a second ORF, embedded in a different frame within the Rep ORF, which is also observed in clecrusatellites and a few other members of the family Alphasatellitidae. Pairwise sequence comparisons and phylogenetic analysis showed that this satellite represents a novel species. Its closest relatives are in the genus Colecusatellite, but it likely represents a new genus given its divergence from other genera of the subfamily Geminialphasatellitinae. Given that WDV was the only virus observed in coinfection with the satellite, the name "wheat dwarf virus-associated alphasatellite" is proposed for this novel agent.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Botryosphaeriaceae are fungi involved in the decay of various woody species, including the grapevine, leading to significant production losses. This fungal family is largely ubiquitous, and seven species of Botryosphaeriaceae have been identified in French vineyards, with variable levels of aggressiveness, both in vitro and in planta. Mycoviruses can impact the life traits of their fungal hosts, including aggressiveness, and are one of the factors influencing fungal pathogenicity. In this study, the RNA mycovirome of fifteen Botryosphaeriaceae isolates was characterized through the high-throughput sequencing of double-stranded RNA preparations from the respective samples. Eight mycoviruses were detected, including three potential novel species in the Narnaviridae family, as well as in the proposed Mycobunyaviridae and Fusagraviridae families. A large collection of Botryosphaeriaceae isolates was screened using RT-PCR assays specific for 20 Botryosphaeriaceae-infecting mycoviruses. Among the mycoviruses detected, some appeared to be specialists within a single host species, while others infected isolates belonging to multiple Botryosphaeriaceae species. This screening allowed us to conclude that one-third of the Botryosphaeriaceae isolates were infected by at least one mycovirus, and a significant proportion of isolates (43.5%) were found to be coinfected by several viruses, with very complex RNA mycoviromes for some N. parvum isolates.

The complete genome sequences of two poorly studied Prunus-infecting nepoviruses, apricot latent ringspot virus (ALRSV) and myrobalan latent ringspot virus (MLRSV) were determined, confirming that they are members of subgroup C. Serological, biological, and molecular data, in particular a low level (58.8%) of amino acid sequence identity in the coat protein, suggest that ALRSV and MLRSV should be considered taxonomically distinct. In addition, data mining of public RNASeq data from wild and ornamental Prunus identified two contigs representing the nearly complete genome of a new subgroup A nepovirus from a smooth stone peach (Prunus mira) dataset (SRR8369794) from the Himalayas, for which the name "Prunus mira virus A" is proposed.

High-throughput sequencing (HTS) and sequence mining tools revolutionized virus detection and discovery in recent years, and implementing them with classical plant virology techniques results in a powerful approach to characterize viruses. An example of a virus discovered through HTS is Solanum nigrum ilarvirus 1 (SnIV1) ( Bromoviridae), which was recently reported in various solanaceous plants from France, Slovenia, Greece, and South Africa. It was likewise detected in grapevines ( Vitaceae) and several Fabaceae and Rosaceae plant species. Such a diverse set of source organisms is atypical for ilarviruses, thus warranting further investigation. In this study, modern and classical virological tools were combined to accelerate the characterization of SnIV1. Through HTS-based virome surveys, mining of sequence read archive datasets, and a literature search, SnIV1 was further identified from diverse plant and non-plant sources globally. SnIV1 isolates showed relatively low variability compared with other phylogenetically related ilarviruses. Phylogenetic analyses showed a distinct basal clade of isolates from Europe, whereas the rest formed clades of mixed geographic origin. Furthermore, systemic infection of SnIV1 in Solanum villosum and its mechanical and graft transmissibility to solanaceous species were demonstrated. Near-identical SnIV1 genomes from the inoculum ( S. villosum) and inoculated Nicotiana benthamiana were sequenced, thus partially fulfilling Koch's postulates. SnIV1 was shown to be seed-transmitted and potentially pollen-borne, has spherical virions, and possibly induces histopathological changes in infected N. benthamiana leaf tissues. Overall, this study provides information to better understand the diversity, global presence, and pathobiology of SnIV1; however, its possible emergence as a destructive pathogen remains uncertain. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

Jiviruses are a group of recently described viruses characterized with a tripartite genome and having affinities with Virgaviridae (RNA1 and 2) and Flaviviridae (RNA3). Using a combination of high-throughput sequencing, datamining and RT-PCR approaches, we demonstrate here that in grapevine samples infected by grapevine-associated jivivirus 1 (GaJV-1) up to 7 additional molecules can be consistently detected with conserved 5′ and 3′ non-coding regions in common with the three previously identified GaJV-1 genomic RNAs. RNA4, RNA5, RNA6, RNA7, RNA8 and RNA10, together with a recombinant RNArec7-8, are all members of a family sharing a previously non recognized conserved protein domain, while RNA9 is part of a distinct family characterized by another conserved motif. Datamining of pecan (Carya illinoinensis) public transcriptomic data allowed the identification of two further jiviviruses and the identification of supplementary genomic RNAs with homologies to those of GaJV-1. Taken together, these results reshape our vision of the divided genome of jiviviruses and raise novel questions about the function(s) of the proteins encoded by jiviviruses supplementary RNAs.

The analysis by high throughput sequencing (HTS) and RT-PCR of Spanish pomegranate fruits showing yellow rings revealed the presence of viroid isolates closely related to fig isolates of apple dimple fruit viroid (ADFVd). The analysis of pomegranate public RNASeq data (Sequence Reads Archives, SRAs) from Israel provided evidence for the presence of similar ADFVd isolates in pomegranate trees in this country. In addition, reads or contigs of plum viroid I (PVd-I) isolates were also identified in two of the analyzed SRA datasets from Israel, suggesting the presence of this second viroid in pomegranate. Full length ADFVd genomic sequences have been recovered, increasing knowledge on the diversity of this viroid and on the pomegranate virome in which only four viruses and one viroid had previously been reported.

Members of the genus Luteovirus are responsible for economically destructive plant diseases worldwide. Over the past few years, three luteoviruses infecting Prunus trees have been characterized. However, the biological properties, prevalence, and genetic diversity of those viruses have not yet been studied. High-throughput sequencing of samples of various wild, cultivated, and ornamental Prunus species enabled the identification of four novel species in the genus Luteovirus for which we obtained complete or nearly complete genomes. Additionally, we identified another new putative species recovered from Sequence Read Archive data. Furthermore, we conducted a survey on peach-infecting luteoviruses in eight European countries. Analyses of 350 leaf samples collected from germplasm, production orchards, and private gardens showed that peach-associated luteovirus (PaLV), nectarine stem pitting-associated virus (NSPaV), and a novel luteovirus, peach-associated luteovirus 2 (PaLV2), are present in all countries; the most prevalent virus was NSPaV, followed by PaLV. The genetic diversity of these viruses was also analyzed. Moreover, the biological indexing on GF305 peach indicator plants demonstrated that PaLV and PaLV2, like NSPaV, are transmitted by graft at relatively low rates. No clear viral symptoms have been observed in either graft-inoculated GF305 indicators or different peach tree varieties observed in an orchard. The data generated during this study provide a broader overview of the genetic diversity, geographical distribution, and prevalence of peach-infecting luteoviruses and suggest that these viruses are likely asymptomatic in peach under most circumstances.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

High-throughput sequencing of two lettuces showing virus-like symptoms in France provided evidence of infection by members of the family Secoviridae. One plant (JG1) had a complex mixed infection that involved, among others, a novel waikavirus (lettuce waikavirus 1) and two isolates of a sequivirus related to lettuce mottle virus (LeMoV). The second lettuce plant (JG2) was singly infected by LeMoV. Complete genomic sequences were obtained for all four isolates and, in addition, near complete genome sequences were obtained for other LeMoV or LeMoV-related isolates (from French cultivated and wild lettuces and from a Brazilian cultivated lettuce) and for two isolates of another family Asteraceae-infecting sequivirus, dandelion yellow mosaic virus (DaYMV). Analysis of these genomic sequences allows the proposal of tentative genome organization for the various viruses and clarification of their phylogenetic relationships. Sequence and host range comparisons point to significant differences between the two sequivirus isolates identified in the JG1 plant and LeMoV isolates from France and Brazil, suggesting they belong to a novel species for which the name lettuce star mosaic virus is proposed.