HomePlant DiseaseVol. 103, No. 11First Report of Lettuce Mosaic Virus Infecting Pea in Taiwan PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Lettuce Mosaic Virus Infecting Pea in TaiwanY.-H. Cheng, C.-H. Chiang, and C.-A. ChangY.-H. Cheng†Corresponding author: Y.-H. Cheng; E-mail Address: [email protected]http://orcid.org/0000-0002-4450-7247Plant Pathology Division, Agricultural Research Institute, Taichung, TaiwanSearch for more papers by this author, C.-H. ChiangDepartment of Plant Medicine, National Pingtung University of Science and Technology, Pingtung, TaiwanSearch for more papers by this author, and C.-A. ChangGraduate Institute of Biochemical Science and Technology, Chaoyang University of Technology, Taichung, TaiwanSearch for more papers by this authorAffiliationsAuthors and Affiliations Y.-H. Cheng1 † C.-H. Chiang2 C.-A. Chang3 1Plant Pathology Division, Agricultural Research Institute, Taichung, Taiwan 2Department of Plant Medicine, National Pingtung University of Science and Technology, Pingtung, Taiwan 3Graduate Institute of Biochemical Science and Technology, Chaoyang University of Technology, Taichung, Taiwan Published Online:13 Sep 2019https://doi.org/10.1094/PDIS-03-19-0469-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Pea (Pisum sativum L.) is the fourth largest leguminous vegetable in cultivated area in Taiwan. In 2016 and 2017, pea plants with unfamiliar symptoms of foliar vein banding and mottling were collected from Miaoli (ML) and Changhua (CH) counties. These symptomatic plants also had shortened internodes and malformed pea pods. Enzyme-linked immunosorbent assay on five plants using antibodies against three viruses (cucumber mosaic virus, peanut mottle virus, and pea seed-borne mosaic virus) known to infect pea in Taiwan proved negative. Inoculation of sap extract from ML and CH samples on Chenopodium quinoa resulted in the development of chlorotic lesions on inoculated and upper leaves after 8 days. Lesions from two isolates were singly screened and reinoculated three times on C. quinoa and subsequently inoculated onto Nicotiana benthamiana and pea cultivar Farmer 162 for propagation. All inoculated pea plants showed symptoms similar to field samples from ML and CH. In a host range test, ML and CH samples caused mosaic symptoms on lettuce. Because potyviruses and tobamoviruses often cause systemic chlorotic lesions in C. quinoa, two sets of degenerate genus-specific primers against potyvirus (Chen et al. 2006) and tobamovirus (Letschert et al. 2002), respectively, were used in reverse transcription PCR (RT-PCR) to test these propagated pea samples. Only the former gave positive results, generating a 1.4-kb amplicon of expected size. Cloning and sequencing studies on two amplicons (GenBank accession nos. MH844631 and MH844632) revealed that their coat protein (CP) genes were highly homologous to the sequences of lettuce mosaic virus (LMV) isolates in the GenBank and showed nucleotide sequence identities from 87.1 to 97.5% to LMV isolates from France (KJ161185) and India (JQ794776), respectively. As for the two isolates from ML and CH, their CP genes shared 97.1 and 97.5% in their nucleotide and amino acid sequence identities, respectively. To assess the incidence of LMV in pea fields, a specific primer pair (LCP-f, 5′-ATCCCCGAAYATAAATGGAACAT-3′; and LCP-r, 5′-TTTAAATGCCWACACACGCCTTTA-3′) was designed and used in RT-PCR for field surveillance. Five original samples and 17 additional pea samples exhibiting similar symptoms from Nantou and Yunlin counties were all confirmed to be positive for LMV, giving an expected 457-bp amplification product. To our knowledge, this is the first report of LMV infecting pea in Taiwan. It is likely that the virus in the field may have come directly from infected pea seeds or from surrounding lettuce, because LMV has been reported previously in Taiwan (Chen et al. 1995). Our study suggests that LMV is a new threat for pea production in Taiwan.The author(s) declare no conflict of interest.References:Chen, C. C., et al. 2006. Bot. Stud. (Taipei, Taiwan) 947:369. Google ScholarChen, Y. K., et al. 1995. Plant Pathol. Bull. 4:60. Google ScholarLetschert, B., et al. 2002. J. Virol. Methods 106:1. https://doi.org/10.1016/S0166-0934(02)00135-0 Crossref, ISI, Google ScholarThe author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 103, No. 11 November 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionAdvanced symptoms of bacterial blotch disease on mushroom caps (Osdaghi et al.). Photo credit: C. Bull. Powdery mildew caused by Golovinomyces neosalviae on Salvia fruticosa (Soylu et al.). Photo credit: S. Soylu. Metrics Article History Issue Date: 4 Nov 2019Published: 13 Sep 2019First Look: 15 Jul 2019Accepted: 12 Jul 2019 Pages: 2971-2971 Information© 2019 The American Phytopathological SocietyKeywordslettuce mosaic viruspotyviruspeaThe author(s) declare no conflict of interest.Cited byDetection, Identification and Molecular Characterization of the 16SrII-V Subgroup Phytoplasma Strain Associated with Pisum sativum and Parthenium hysterophorus L.16 February 2023 | Plants, Vol. 12, No. 4Lettuce mosaic virus (lettuce mosaic)CABI Compendium, Vol. CABI Compendium

Orchids are appreciated for their delicate and enchantingly beautiful floral parts. Decades ago, orchids were more expensive than other ornamentals due to their limited supplies and difficulties in propagation and cultivation. Nowadays, using modern tissue culture technology, orchids are readily available commercially, and the price of plants is becoming more affordable. However, during mass propagation, virulent viruses may also be reproduced along with tissue-cultured clones and thus decrease the growth vigor and the ornamental value of the finished products. As a result, virus detection prior to orchid propagation is a vital process in modern orchid industry; in order to prevent viruses from spreading among the tissue cultured plantlets. This chapter describes a technique, namely, an enzyme-linked immunosorbent assay (HASA), which is currently widely adopted by most major orchid companies as a routine test for virus detection. The basic mechanism of the technique, materials and facilities needed, detailed protocols, result interpretation, and some tips to prevent background problems are presented in the text. We also detail and discuss some alternative methods that orchid growers can use in orchid virus detection.

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) 'Tainung No. 1' is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5'TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3'/5'CGCAGTTT CTGGAGGATATTAAG3'/5'TCGCATGCCACTTCCTCAGT3') were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

Volatile Organic Compounds (VOCs) are present in both indoor and outdoor environments, and have the potential to adversely impact the health of all age groups of people that are exposed to them. This study examines and assesses the short-term effects of VOCs on nonspecific conjunctivitis. Data were collected from outpatient visits for nonspecific conjunctivitis in air-quality monitoring areas. Air quality data were collected from the Taiwan Environmental Protection Administration’s air quality monitoring stations. To find the immediate and lag effects of VOCs, an area-specific, case-crossover analysis was performed and a meta-analysis with random effects was used to combine the area-specific results. The results show that toluene, m,p-xylene, o-xylene, propylene, and benzene had higher maximum incremental reactivity (MIR) values and concentrations in air than any of the other studied VOCs. These 5 VOCs also had the strongest short-term effects on outpatient visits for nonspecific conjunctivitis. The effect was strongest for toluene, and there was a 1.3

Purpose: Underestimation of IOP in a myopic patient may lead to misjudgment of the risk of glaucoma. This study investigated the influence of orthokeratology-induced change in CCT on IOP measured by the non-contact pneumotonometer (NCT), Goldmann applanation tonometer (GAT), and Pascal dynamic contour tonometer (PDCT). Methods: This study was conducted to examine the eyes of 34 patients who received orthokeratology for myopia. CCT and IOP were measured, and IOP was obtained with the NCT, GAT, and PDCT. The associations between changes in measured IOP and change in CCT at different orthokeratology follow-up time points were evaluated by linear regression analysis. Results: Change in IOP measured by the three tonometries correlated significantly with change in CCT after one-week application of orthokeratology. The correlation was strongest for NCT followed by GAT and PDCT. The changes in measured IOP corresponding to a 10 mm decrease in CCT were 0.7-0.9, 0.4-0.6, and 0.2-0.3 mm Hg for NCT, GAT, and PDCT, respectively. Conclusions: The IOP measured by the three methods - NCT, GAT, and PDCT - decreased as a result of the change in CCT induced by orthokeratology. The influence on NCT and GAT was greater than that on PDCT.

PURPOSE Past studies present evidence of associations between air pollution and human ocular symptoms; however, to the knowledge of the authors, research investigating the hazardous effects of air pollution on nonspecific conjunctivitis is nonexistent. This study investigates the relationship between air pollution and outpatient visits for nonspecific conjunctivitis in Taiwan. A multiarea analysis was conducted to examine and assess the risks of short-term effects of particulate matter (PM), nitrogen dioxide (NO₂), sulfur dioxide (SO₂), ozone (O₃), and carbon monoxide on nonspecific conjunctivitis. METHODS Data were collected from outpatient visits for nonspecific conjunctivitis from seven air-quality-monitoring areas. To find immediate and lag effects of air pollution, an area-specific, case-crossover analysis was performed and a meta-analysis with random effects was used to combine the area-specific RESULTS Results. The effects on outpatient visits for nonspecific conjunctivitis are strongest for O₃ and NO₂, with a 2.5% increase (95% confidence interval [CI], 0.9-4.1) for a 16.4 ppb (parts per billion) concentration rise in O₃ and a 2.3% increase (95% CI, 0.7-3.9) for an 11.47 ppb concentration rise in NO₂. Effects are also found for particulate matter with an aerodynamic diameter ≤ 10 μm (PM₁₀) and SO₂. Effects are more prominent in winter because the analysis was stratified according to season. CONCLUSIONS The air pollutants NO₂, SO₂, O₃, and PM₁₀ increase the chances of outpatient visits for nonspecific conjunctivitis and have no evident lag effects.

Calla lily (”Zantedeschia” spp.) is one of the economically important ornamental crops in Taiwan. In a field survey of calla lily conducted during 2005, plants showing symptoms of yellow spots and stripes on leaves were observed in Houli Township, one of the major areas for commercial production of ornamental crops in Taiwan. Fifteen virus isolates were collected from diseased plants of calla lily and purified via three successive local-lesion isolations on leaves of inoculated ”Chenopodium quinoa.” A 0.9 kb DNA fragment was amplified from total RNA extracted from all the fifteen virus isolates on infected plants by reverse transcription-polymerase chain reaction (RT-PCR) using the ”Tospovirus” genus-degenerate primers gL3637 and gL4510c, designed from the conserved regions of L RNA, revealing that the disease was caused by a ”Tospovirus”. The virus isolates reacted positively with the antiserum to the nucleocapsid (N) protein of Capsicum chlorosis virus (CaCV) and the monoclonal antibody to the N protein of ”Watermelon silver mottle virus” (WSMoV), indicating that they are members of the WSMoV serogroup. The nucleotide sequences of the N gene of these virus isolates from calla lily were phylogenetically related to CaCV. Furthermore, the pathogenicity of CaCV was also verified by inoculation tests on plants of calla lily.

Bell pepper (Capsicum annuum L.) plants exhibiting systemic mild mosaic, vein yellowing, and leaf malformation were collected from Puli City in 2006. Double-antibody sandwich (DAS)-ELISA was used to test these samples for Chilli veinal mottle virus (ChiVMV) infection using polyclonal antibodies. In addition, Chenopodium quinoa, C. amaranticolor, and Nicotiana benthamiana plants were mechanically inoculated with sap extracted from collected samples. Ten days postinoculation, chlorotic local lesions were observed on inoculated leaves of C. quinoa and C. amaranticolor plants, whereas, systemic mosaic and foliar distortion symptoms were developed on upper leaves of N. benthamiana plants. The DAS-ELISA test showed that field-collected pepper samples and inoculated leaves of C. quinoa and C. amaranticolor were infected with ChiVMV, while N. benthamiana with mosaic symptoms did not react with ChiVMV antibodies. To confirm ChiVMV, field-collected samples as well as mechanically inoculated plants were tested by reverse transcription (RT)-PCR using the potyvirus degenerate primers Hrp5/Pot1 (2). Amplified RT-PCR products were cloned and sequenced. Sequence analysis of amplified fragments (1.4 kb) revealed that field-collected pepper samples were infected with ChiVMV and Pepper mottle virus (PepMoV). The DNA fragment amplified from C. quinoa and C. amaranticolor showed high (99.2%) sequence identities with the CP gene of ChiVMV (3) (GenBank Accession No. AM909717). However, amplicons obtained from N. benthamiana plants (GenBank Accession No. HQ329082) that showed mosaic symptoms showed 83.6% to 98.7% nucleotide identities with PepMoV (GenBank Accession Nos. AB126033, AF227728, AF440801, AF501591, EU586133, and M96425). Next, a pure isolate of PepMoV was established on N. benthamiana by mechanical inoculation of diluted plant sap obtained from a PepMoV-infected N. benthamiana plant. Bell pepper plants inoculated with the Taiwan isolate of PepMoV developed mosaic and leaf distortion symptoms. Antiserum against the PepMoV Taiwan isolate was subsequently prepared by immunizing rabbits with purified virus particles. Using the prepared antiserum and specific primers (1) to detect PepMoV, ChiVMV, and Pepper veinal mottle virus (PVMV), three viruses could be readily detected and differentiated from diseased bell peppers in the field. In a survey done in 2007, 18 of 33 pepper samples from southern Taiwan were found with mixed infections of PepMoV and ChiVMV, seven samples were infected with PepMoV and PVMV, five samples were infected with PVMV, and another three samples were infected with ChiVMV. To our knowledge, this is the first report of the occurrence of PepMoV in bell peppers in Taiwan. References: (1) Y. H. Cheng et al. Plant Dis. 93:107, 2009. (2) S. S. Pappu et al. Plant Dis. 82:1121, 1998. (3) W. S. Tsai et al. Plant Pathol. 58:408, 2008.

A novel sanitation approach by using liquid culture filtrate (CF) of a Streptomyces isolate (CA5) that can readily disinfect coat proteins (CP) of Odohtoglossum ringspot virus (ORSV) and Cymbidium mosaic virus (CymMV) and eliminate their infectivities is demonstrated. By treating for only 30 s with a preparation of CA5 CF on the materials or tools commonly used in orchid nurseries including razor blades, plastic clips, labels and gloves coated previously with ORSV and CymMV infected plant sap, it is shown that no ELISA signals and infectivity could be recovered on the treated materials. Similarly, virus contaminated human nails and surfaces of Phalaenopsis orchid leaf tissue can also be treated without detecting any leftover ELISA signal and virus infectivity. We also showed that CA5 CF has the potential to eliminate virus contamination on the surface of orchid seeds leading to the production of clean orchid seedlings. The virus degradation activity of CA5 culture filtrate is heat labile to temperature treatments higher than 60°C, indicating that the activity is possibly due to a proteinaceous substance. Further experiments of dialyzing CA5 culture filtrate using different molecular cut-off membranes showed that the molecular mass of the substance should be larger than 100 kDa.

In May of 2006, samples from tomato plants (Solanum lycopersicum cv. Known-you 301) exhibiting necrotic symptoms on stems, petioles, and leaves were collected from Chiayi County, Taiwan. Double-antibody sandwich-ELISAs were performed using Cucumber mosaic virus, Tomato mosaic virus, Potato virus Y, Watermelon silver mottle virus, and Chilli veinal mottle virus (ChiVMV) polyclonal antibodies. Three of eight samples reacted with antibodies against ChiVMV but not with the others. Using the potyvirus degenerate primers (Hrp 5/Pot 1) (2), an expected 1.5-kb DNA fragment including the 3'-end of the NIb gene, the complete coat protein (CP) gene, and the 3'-nontranslatable region of the virus was amplified from total RNA isolated from these three samples by reverse transcription (RT)-PCR. A homology search in GenBank indicated that the new tomato-infecting virus in Taiwan belongs to Pepper veinal mottle virus (PVMV) since they shared >90% amino acid identity in the CP gene. A virus culture (Tom1) isolated from one of the diseased tomatoes was then established in Chenopodium quinoa and Nicotiana benthamiana and the CP gene was amplified and sequenced (GenBank Accession No. EU719647). Comparisons of the 807-nt CP gene with those of five PVMV isolates available in GenBank showed 81.5 to 93.1% nucleotide and 90.0 to 97.8% amino acid identity. Tom1 induced irregular necrotic lesions on stems, petioles, and leaves of tomato while inducing only mild mottle symptoms on pepper. Serological cross reaction between ChiVMV and PVMV has been observed previously (1,3) and also found in this study. To differentiate these two potyviruses by RT-PCR, primer pair CPVMVup/dw (5'-TATTC(T/C)TCAGTGTGG(A/T/C)T(T/C)CCACCAT and 5'-(T/C)C(A/T)C(A/T)(A/T/G)(A/T)AA(A/G)CCATAA(A/C)(A/C)ATA(A/G)T(T/C)T) was designed on the basis of the comparison of the CP gene and the 3'-nontranslatable region of the PVMV and ChiVMV. DNA fragments of 171 and 259 bp are expected to be amplified from ChiVMV and PVMV, respectively, by RT-PCR with primers CPVMVup/dw. In a field survey done in 2006, samples from diseased peppers (Capsicum annuum) that reacted with the polyclonal antibodies against ChiVMV were further identified by RT-PCR with primers CPVMVup/dw, indicating that both ChiVMV and PVMV infected pepper crops (Capsicum spp.) in Taiwan. A pepper isolate (Pep1) of PVMV was obtained from Nantou County through three times of single lesion passages on C. quinoa and then propagated on N. benthamiana. The CP gene of Pep1 was amplified and sequenced (GenBank Accession No. EU719646) and found to share 99.1% nucleotide and 100% amino acid identity with that of Tom1. Pep1 caused mild mottle symptoms on leaves of both tomato and pepper. To our knowledge, this is the first report of the presence of PVMV in Taiwan as well as in East Asia. References: (1) B. Moury et al. Phytopathology 95:227, 2005. (2) S. S. Pappu et al. Plant Dis. 82:1121, 1998. (3) W. S. Tsai et al. Plant Pathol. 58:408, 2008.

Plant PathologyVolume 57, Issue 4 p. 765-765 Free Access Melon yellow spot virus in watermelon: a first record from Taiwan T.-C. Chen, T.-C. Chen Department of Biotechnology, Asia University, Wufeng, Taichung County 413;Search for more papers by this authorY.-Y. Lu, Y.-Y. Lu Department of Plant Pathology, National Chung Hsing University, Taichung 402; andSearch for more papers by this authorY.-H. Cheng, Y.-H. Cheng Division of Plant Pathology, Taiwan Agricultural Research Institute, Wufeng, Taichung County 413, TaiwanSearch for more papers by this authorC.-A. Chang, C.-A. Chang Division of Plant Pathology, Taiwan Agricultural Research Institute, Wufeng, Taichung County 413, TaiwanSearch for more papers by this authorS.-D. Yeh, Corresponding Author S.-D. Yeh Department of Plant Pathology, National Chung Hsing University, Taichung 402; and *E-mail: sdyeh@nchu.edu.twSearch for more papers by this author T.-C. Chen, T.-C. Chen Department of Biotechnology, Asia University, Wufeng, Taichung County 413;Search for more papers by this authorY.-Y. Lu, Y.-Y. Lu Department of Plant Pathology, National Chung Hsing University, Taichung 402; andSearch for more papers by this authorY.-H. Cheng, Y.-H. Cheng Division of Plant Pathology, Taiwan Agricultural Research Institute, Wufeng, Taichung County 413, TaiwanSearch for more papers by this authorC.-A. Chang, C.-A. Chang Division of Plant Pathology, Taiwan Agricultural Research Institute, Wufeng, Taichung County 413, TaiwanSearch for more papers by this authorS.-D. Yeh, Corresponding Author S.-D. Yeh Department of Plant Pathology, National Chung Hsing University, Taichung 402; and *E-mail: sdyeh@nchu.edu.twSearch for more papers by this author First published: 18 July 2008 https://doi.org/10.1111/j.1365-3059.2007.01791.xCitations: 20AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Several viruses, including the thrips-borne tospovirus Watermelon silver mottle virus (WSMoV), cause severe damage to cucurbits in Taiwan. In June 2006, a survey for WSMoV on watermelon (Citrullus lanatus) was conducted in Miaoli County central Taiwan by indirect ELISA using the antiserum against the nucleocapsid (N) protein of Capsicum chlorosis virus, which is serologically related to WSMoV. Extracts from diseased samples with a positive reaction were used as inocula for bioassay on watermelon and Chenopodium quinoa. One of these gave symptoms on watermelon and C. quinoa different from those caused by WSMoV. After three passages of single lesion isolation, this new isolate reacted with the monoclonal antibody (MAb) against the nonstructural WSMoV NSs protein (Chen et al., 2006), but not with the MAb to WSMoV N protein. This suggested that this tospovirus was only distantly related toWSMoV. RT-PCR with the degenerate primers, WScon1p (5′-GTCAACTTTCTCAATTTGTTCATGCATA-3′) and WScon5 m (5′-CTCTTTATCATACAT(T/C)TTGAACACAAT(C/G)AC-3′), designed from the NSs genes of members of WSMoV serogroup, amplified a DNA fragment from the host tissues infected by the newly isolated tospovirus. The sequence of this fragment was found to share 97% identity with that of the NSs gene of Melon yellow spot virus (MYSV), a virus previously reported from Japan (Kato et al., 2000) and distinct from WSMoV. When the complete sequences of N and NSs genes of the newly isolated tospovirus were determined from the DNA fragments amplified by the specific primers designed from the S RNA of MYSV, the results showed 98·9 and 97·9% amino acid identities, respectively, to those of MYSV. Over all, the data indicate that the new virus is an isolate of MYSV, denoted as MYSV-TW and is a new record for Taiwan. References Chen TC, Huang CW, Kuo YW et al ., 2006. Identification of common epitopes on a conserved region of NSs proteins among tospoviruses of Watermelon silver mottle virus serogroup. Phytopathology 96, 1296– 304. CrossrefCASPubMedWeb of Science®Google Scholar Kato K, Hanada K, Kameya-Iwaki M, 2000. Melon yellow spot virus: a distinct species of the genus Tospovirus isolated from melon. Phytopathology 90, 422– 6. CrossrefCASPubMedWeb of Science®Google Scholar Citing Literature Volume57, Issue4August 2008Pages 765-765 ReferencesRelatedInformation

Calla lily (Zantedeschia spp.), an aroid plant species indigenous to Africa, is a popular ornamental crop in Taiwan and many other countries. Dasheen mosaic virus (DsMV) is the first potyvirus species reported to infect calla lilies. Besides DsMV, several potyviruses with distinct serological and molecular properties were isolated from calla lilies in Taiwan. In 2001, a potyvirus with serological and molecular properties distinct to those of DsMV was recognized and widely distributed in calla lily fields in Taiwan. The virus inducing mosaic symptoms similar to those caused by DsMV was provisionally designated as Zantedeschia mosaic virus (ZaMV). The "ZaMV" was later identified as a strain of Konjak mosaic virus (KoMV), a potyvirus infecting aroid plants reported from Japan. This was based on the analysis that they shared more than 90% of identity between their coat protein (CP) gene sequences. In 2002, Turnip mosaic virus infecting calla lilies causing yellow spot and stripe foliar symptoms was recognized. TuMV was found frequently occurring in calla lily fields adjacent to cruciferous crops. In addition, TuMV was also detected in calla lily bulbs imported from other countries including USA and Vietnam. The same year, another potyvirus discovered from calla lilies showing mild mosaic symptoms. It was evidently different from those already reported calla lily-infecting potyviruses, and named Zantedeschia mild mosaic virus (ZaMMV) based on its distinct symptoms. ZaMMV was identified coincidentally by two working groups novel molecular properties that a sequence of 38-39 repeated glutamine residues located on the N-terminal of the CP gene. The biological and molecular significance of the unusual glutamine repeats is not known. Finally, Calla lily latent virus (CLLV) was discovered and detected from a calla lily plant dually co-infected with DsMV and KoMV. It is so named for its inability to induce any visible symptoms on calla lilies. This characteristic was confirmed by the consistent observation in field surveys that none of the calla lily plants singly infected by CLLV developed symptoms. Serological and molecular studies reveal that CLLV is a new species of Potyvirus.

The poinsettia exhibited curves and winkles on leaves were investigated. A viral sequence about 1.3 kb was amplified by PCR from total DNA extracted from diseased plants using the degenerate primers. Complete circular nucleotide sequence was determined by three overlapping clones. The circular genomic DNA contains 2736 nucleotides encoding six open reading frames (ORFs), including ORF V1 and V2 on viral strand and C1, C2, C3 and C4 on the complementary strand. Degenerate primers specific for B component of bipartite geminiviruses failed to produce amplicons from viral DNA template indicating that the poinsettia virus is a monopartite geminivirus. Sequence comparisons show that the virus shares less than 79% and 87% of identities in the genome sequence and the sequence of coat protein (CP) gene with the known geminiviruses. Based on the sequence data, a primer pair was designed to differentiate poinsettia geminivirus from other geminiviruses found in Taiwan. Results of current studies indicate that the virus inducing leaf curl in poinsettia is a new species of whitefly-transmitted monopartitie Begomovirus. We herein propose the name as Poinsettia leaf curl geminivirus.

A new potyvirus designated as Calla lily latent virus (CLLV) was isolated from apparently healthy calla lilies (Zantedeschia spp.) collected from nurseries in Taichung County, Taiwan. Different from most calla lily-infecting potyviruses, CLLV infects Chenopodium quinoa and develops local lesions on inoculated leaves (3). Typical potyvirus particles approximately 780 nm long were detected from CLLV-induced C. quinoa local lesions. CLLV was transmitted readily to and established in C. quinoa. Attempts to establish CLLV infection in calla lilies from extracts of C. quinoa lesions were not successful. The virus was transmitted from infected to healthy calla lilies with difficulty. A 1.3-kb cDNA product was amplified by reverse transcription-polymerase chain reaction (RT-PCR) from CLLV-infected calla lilies and C. quinoa using potyvirus degenerate primers (2). The PCR product was cloned and sequenced. It was found to consist of 1,339 nucleotides (nt) (GenBank Accession No. AF469171) corresponding to the genome organization of the 3'terminal region of potyviruses. The deduced amino acid sequence contains 362 residues encoding the 3'terminal region of the nuclear inclusion b gene (80 residues) and the complete coat protein (CP) gene (282 residues). A 253-nt noncoding region (NCR) was found at the 3'terminal region of the cDNA. By comparing with known sequences of potyviruses, CLLV was identified as a new species of Potyvirus based on the uniqueness in the CP gene and 3' NCR. Soybean mosaic virus and Watermelon mosaic virus 2 are the potyviruses most similar to CLLV, but they share only approximately 80% nucleotide identity with CLLV in the CP and NCR regions. Attempts to purify sufficient CLLV from C. quinoa for antiserum preparation were not successful. Alternatively, polyclonal antibodies were produced using E. coli-expressed CLLV CP (1). The antibodies were useful for detection of CLLV and its CP in calla lilies using enzyme-linked immunosorbent assay, sodium dodecyl sulfate-immunodiffusion, immuno-specific electron microscopy, and western blot. Field surveys showed that calla lily plants found positive for CLLV by serological methods always remained symptomless throughout the six-month growing season. Occasionally, CLLV was detected in symptomatic calla lilies, but these plants were consistently confirmed dually infected by other viruses (Dasheen mosaic virus and Konjak mosaic virus found most commonly). Infection of CLLV alone in calla lilies may not have a direct impact on the production and marketing of the crop. Synergism is not currently known when calla lilies are coinfected with other viruses. CLLV is spread by vegetative propagation through infected rhizomes or tubers. References: (1) C. C. Chen et al. Plant Dis. 87:901-905, 2003. (2) S. S. Pappu et al. Plant Dis. 82:1121-1125, 1998. (3) F. W. Zettler and R. D. Hartman. Pages 464-470 in: Virus and Virus-like Diseases of Bulb and Flower Crops. G. Loebenstein et al., eds. John Wiley and Sons Inc., UK, 1995.

Two virus cultures, RC4 and YC5, were isolated in Taiwan from calla lily (Zantedeschia spp.) cv. Black magic displaying yellow spot and stripe on leaves. Both isolates were mechanically transmitted to various hybrids of Zantedeschia and induced systemic symptoms similar to those observed on diseased Black magic. In addition to Zantedeschia spp., the two virus isolates also infected several cruciferous species and induced mosaic symptoms. Electron microscopy revealed the presence of flexuous virus particles about 750 nm in length. The two isolates were propagated in and purified from mustard plants and were used as immunogens for production of antisera in rabbits. In enzyme-linked immunosorbent assay and sodium dodecyl sulfate-immunodiffusion tests, both antisera reacted strongly with their homologous antigens and with antigens of two Turnip mosaic virus (TuMV) isolates from radish (TuMV-R) and lisianthus (TuMV-L), but not with 21 other different potyviruses tested. In reciprocal tests, antisera against TuMV-R and TuMV-L also reacted strongly with RC4 and YC5 antigens, indicating that these two calla lily isolates are serologically indistinguishable from other known TuMV strains. Cloning and sequence analyses confirmed that both isolates shared 95 to 99% of deduced amino acid sequence identities in the coat protein genes with those of various known TuMV strains. This investigation represents the first record of the natural infection of TuMV in calla lily.