Dominant negative inhibition is most commonly seen when a mutant subunit of a multi-subunit protein is co-expressed with the wild-type protein so that assembly of a functional oligomer is impaired. Studies have shown that TRAF6 plays a key role in the regulation of NF-κB through the IL-1R/TLR-TRAF6-TAK1-TAB1-TAB2-IkB-NF-κB pathway. We previously demonstrated that TRAF6 is an important factor for the activation of nuclear factor (NF)-κB signaling in multiple myeloma cell proliferation through the c-Jun N-terminal kinase (JNK) pathway and the pathway can be silenced by TRAF6 siRNA. (H. Chen et al. Oncogene, 2006). We targeted the TRAF6 function domain by designing primers targeting positive 1115 to 1818 (Forward: ggctagcatgtcagaggtccggaatttggag (Nhe1) Reverse: cgaagtactgatgcaggggtatagctcgagc (Xho1)) for hTRAF6dn according to GeneBank (NCBI) nucleotide sequence of human TRAF6 (#U78798). We cloned TRAF6 negative domain cDNA into PCRII-TOPO vector and subsequently re-cloned into the pLenti6.2 expression vector (pLenti6.2-hTRAF6dn). All constructs were confirmed by sequencing. Viral titers for all transfections were determined to be 107 plaque-forming units/ml. Expression levels as determined by flow cytometric analysis were >95% for all lentivirally encoded GFP gene products. The pLenti6.2-hTRAF6dn vector continually expressed the peptide for TRAF6dn during tumor cell proliferation. We found that TRAF6dn began to inhibit MM cell proliferation in the U266 myeloma cell line after 72 hours of culture and most prominently on day 6. However, the inhibition of RPMI8226 cell proliferation by TRAFdn started after 24 hours of culture whereas effects on inducing MM cell apoptosis were most prominent at 72 hours. The decrease in cell proliferation and increase in cell apoptosis occurred in a dose-dependent fashion. We also examined the effects of TRAF6dn on the NF-κB and JNK pathway since this signaling pathway is associated with cell cycle effects in myeloma. Phosphorylated NF-κB protein levels were reduced using the TRAF6dn expression vector. We also determined the phosphorylation of JUN kinase kinase (JNKK), which activates the MAP kinase homologues SAPK and JNK in response to IL-1 receptor stimulation. The results showed that the phosphorylation of JNKK is clearly reduced following blocking the TRAF6 function domain with the TRAF6dn. Furthermore, we examined c-Jun, a component of the transcription factor complex AP-1, which binds and activates transcription at TRE/AP-1 elements. The transcriptional activity of c-Jun is regulated by SAPK/JNK binding to c-Jun and phosphorylation of c-Jun at Ser63/73. We found that total endogenous c-Jun is reduced after blocking the TRAF6 function domain with TRAF6dn in the RPMI8226 and U266 MM cell lines. Comparing TRAF6dn with TRAF6 siRNA, only the TRAF6dn inhibited the TRAF6 function domain. These studies suggest that the TRAF6dn peptide may impede myeloma cell signaling pathways resulting in inhibition of tumor cell growth and may represent a new approach to treating patients with MM.

Myeloma survival and proliferation in the bone marrow (BM) depends on the expression of a variety of autocrine and paracrine growth factors, including IL-6, insulin-like growth factor I (IGF-I), vascular endothelial growth factor (VEGF), and hepatocyte growth factor (HGF). We recently discovered an additional new autocrine myeloma growth factor, pleiotrophin (PTN). PTN is an 18kD heparin-binding protein normally expressed during early development and downregulated in adults, but aberrant PTN re-expression has been associated with a variety of aggressive solid tumors including neuroblastoma, glioma, melanoma and lung, breast and prostate cancers. We found that interference with PTN using a polyclonal anti-PTN antibody inhibited the proliferation of myeloma cells in vitro and in vivo by inducing cell cycle arrest but not apoptosis. To determine the mechanism by which PTN stimulates myeloma proliferation we analyzed the expression of the known PTN receptors, syndecans 1 (CD138) and 3, the anaplastic lymphoma kinase (ALK) and the receptor tyrosine phosphatase beta/zeta (RPTPβ/ζ) on myeloma cells. The expression of ALK and RPTPβ/ζ has not previously been investigated in any hematologic malignancy. In addition to syndecan 1 we found that a subset of myeloma cell lines and BM mononuclear cells (BMMCs) from myeloma patients are RPTPβ/ζ+ by RT-PCR, Western blot and flow cytometry. Myeloma cells, however, do not express ALK. RPTPβ/ζ inhibition by PTN binding leads to the accumulation of β-catenin, and downstream activation of Wnt, NF-κB, MAPK and Akt-mediated cell signals in cells from solid tumors, signaling pathways known to contribute to myeloma cell survival and proliferation. The myeloma cell line MM-1S and the SCID-hu myeloma model LAGλ-1 are both CD138+ but RPTPβ/ζ−. Nonetheless, the growth of these cells is inhibited by anti-PTN antibody. CD138 lacks cytoplasmic signaling motifs suggesting that additional novel receptors are required for PTN-stimulated cell growth in these cells. To continue to define PTN-mediated signaling in myeloma cells we compared the induction of PTN-regulated signaling pathways in RPTPβ/ζ+ RPMI 8226 cells compared to RPTPβ/ζ − MM-1s cells by phospho-protein Western blot. We found differences in PTN-stimulated tyrosine phosphorylation between RPTPβ/ζ+ and RPTPβ/ζ −cells. Specifically, we also discovered that RPTPβ/ζ+ RPMI 8226 cells activate the MAPK Erk1/2. In contrast, we found Akt, but not Erk1/2, to be activated by PTN in RPTPβ/ζ − MM-1S cells. We are now continuing our analysis of PTN signaling in these cells. We are using also identifying new PTN receptors on the surface of myeloma cells by affinity chromatography using biotinylated-PTN. These studies will provide potential new targets that should lead to the development of novel targeted anti-myeloma therapies.

Bone resorption leading to osteolytic bone disease is characteristic of multiple myeloma (MM). Recent studies show the presence of bone-resorbing osteoclasts and bone-forming osteoclasts in the circulation, and these cells may correlate with bone disease and change with anti-bone resorptive therapies. We have investigated whether there is an imbalance in the expression of osteoblast and osteoclast genes in the peripheral blood mononuclear cells (PBMCs) from MM patients relative to normal age-matched controls and the effect of bisphosphonate treatment on the expression of these genes. We analyzed the expression of a panel of osteoblast-related (bone alkaline phosphatase [bone AP], bone morphogenic protein 2 [BMP2], collagen I and osteocalcin) and osteoclast-related (b3 integrin, calcitonin, receptor for activation of nuclear factor kappa B [RANK] and tartrate-resistant alkaline phosphatase [TRAP]) genes by semi-quantitative RT-PCR on total RNA isolated from PBMCs obtained following density gradient separation. We demonstrated that the expression of the osteoblast-related gene BMP2 was reduced in eight of nine MM patients when compared with normal donors. In marked contrast, three osteoclast-related genes, b3 integrin, RANK and TRAP, were more highly expressed in all nine MM patients compared to the normal donors; only calcitonin expression was similar to the control subjects. Interestingly, patients receiving bisphosphonate treatment appeared to show increased osteoblast gene expression with higher amounts of bone AP, BMP2 and osteocalcin RNA compared to the patients not receiving anti-bone resorptive therapy. However, there was no alteration in the level of the RNA in any of the four osteoclast genes compared to patients not receiving anti-bone resorptive therapy. We are extending our analysis to a larger panel of MM patients in order to determine the relationship between these circulating cells and bone disease, overall clinical status and change in their levels with anti-bone resorptive therapy. In addition, we are also investigating whether there exist larger and smaller numbers of circulating osteoclasts and osteoblasts, respectively, in MM patients, or whether these circulating cells show alteration of their expression of these genes. Our semi-quantitative RT-PCR results are being correlated with immunohistochemical staining results from osteoblast and osteoclast markers obtained on PBMCs from MM and normal subjects. These studies provide evidence that the number of circulating osteoblasts and osteoclasts is altered in patients with MM, and also may suggest that bisphosphonate therapy may also be associated with changes in these cell populations.