Background Thalassemia, a prevalent monogenic inherited disorder, represents a significant public health concern in southern China. This comprehensive study retrospectively analysed prenatal diagnostic data for thalassemia over an 11-year period in Guangdong Province, a high-prevalence region in southern China.Methods Prenatal diagnosis (PND) of thalassemia was performed on 22,127 foetuses from at-risk pregnancies, following standardized protocols for invasive sampling, foetal sample collection and laboratory processing. Thalassemia mutations were identified using PCR-based molecular techniques.Results The analysis revealed that 16,812 cases (75.98%) were diagnosed with thalassemia, including 12,636 cases (57.11%) identified as α-thalassemia, 3961 cases (17.90%) as β-thalassemia and 215 cases (0.97%) as co-inheritance of α- and β-thalassemia. Among these, 5769 cases (26.08%) were diagnosed with intermedia or severe thalassemia genotypes, of which 2593 underwent pregnancy termination. Additionally, our study detected 275 cases of rare thalassemia variants. The retrospective analysis encompassed critical aspects including the timing of PND, genotype spectrum and rare variant identification, complemented by a synthesis of clinical practice insights.Conclusions This large-scale study provides substantial epidemiological data and clinical insights that significantly contribute to the enhancement of thalassemia prevention and control strategies in Guangdong Province.

Abnormal hemoglobin anti-Lepore Hong Kong is a rare βδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of β 0 -thalassemia and α-thalassemia (– SEA / or α CS α/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with β 0 -thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2–40.8%) and behaved with β-thalassemia trait. Furthermore, determination of the α/β-mRNA ratio revealed a slight downregulation of β-globin, similar to that of β-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, β 0 -thalassemia and α-thalassemia, provide valuable information for prenatal counseling.

BackgroundGenetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent-offspring trios and proband only analysis.MethodsWe conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation.ResultsOur CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications.ConclusionCES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.

Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β CD59 ) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed β CD128-134 ) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β 0 -thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

ABSTRACT Background Hb Chapel Hill [Alpha2 74(EF3) Asp > Gly] results from an GAC > GGC substitution at codon 74 of the HBA1 or HBA2 genes. Hb Chapel Hill has not been reported since 1986. Methods A heterozygous mutation, HBA2: c.224A > G, was identified in the proband, her father and sister. We compared the haematological and clinical data of this family with the data reported in the limited number of individuals. Results Having excluded iron deficiency, the Hb Chapel Hill was asymptomatic in heterozygous state. The cases presented here characterize cases in new techniques including capillary electrophoresis (CE). Two aberrant peaks were identified by CE, a major peak migrating in the zone 7 that correspond to Hb Chapel Hill (αChapel Hill 2β2) and a minor peak migrating in the zone 1 that correspond to Hb Chapel Hill2 (αChapel Hill 2δ2). Focusing on the variant expression, the Hb Chapel Hill plus Hb A2 variant were around 18.9–20.6% of total Hb in three members. Conclusion This data will be useful for providing up-to-date and high quality information on the Hb Chapel Hill.

ABSTRACTObjective In the present study, two unrelated cases of Hb Q-Thailand heterozygosity unlinked with the (–α4.2/) α+-thalassemia deletion allele were identified by long-read single molecule real-time (SMRT) sequencing in southern China. The aim of this study was to report the hematological and molecular features as well as diagnostic aspects of the rare manifestation.Methods Hematological parameters and hemoglobin analysis results were recorded. A suspension array system for routine thalassemia genetic analysis and long-read SMRT sequencing were applied in parallel for thalassemia genotyping. Traditional methods, including Sanger sequencing, multiplex gap-polymerase chain reaction (gap-PCR) and multiplex ligation-dependent probe amplification (MLPA), were used together to confirm the thalassemia variants.Results Long-read SMRT sequencing was used to diagnose two Hb Q-Thailand heterozygous patients for whom the hemoglobin variant was unlinked to the (–α4.2/) allele for the first time. The hitherto undescribed genotypes were verified by traditional methods. Hematological parameters were compared with those of Hb Q-Thailand heterozygosity linked with the (–α4.2/) deletion allele in our study. For the positive control samples, long-read SMRT sequencing revealed a linkage relationship between the Hb Q-Thailand allele and the (–α4.2/) deletion allele.Conclusions Identification of the two patients confirms that the linkage relationship between the Hb Q-Thailand allele and the (−α4.2/) deletion allele is a common possibility but not a certainty. Remarkably, as it is superior to traditional methods, SMRT technology may eventually serve as a more comprehensive and precise method that holds promising prospects in clinical practice, especially for rare variants.

Background At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. Methods We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. Results Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). Conclusion We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.

Objective:To evaluate the diagnostic capabilities of PCR-flow Fluorescence Hybridization technology in prenatal genetic diagnosis of thalassemia.Methods:8 005 cases of prenatal genetic diagnosis of thalassemia in Guangdong Women and Children Hospital from September 2017 to December 2020 were retrospectively analyzed. All samples were diagnosed by traditional genetic methods include multiple Gap-PCR, PCR-RDB, MLPA and Sanger sequencing. Meanwhile, PCR-flow Fluorescence Hybridization technology was used as a verification platform for detecting common mutation sites of thalassemia. The results were analyzed to evaluate the diagnostic capabilities of PCR-flow Fluorescence Hybridization technology compared with traditional methods in prenatal genetic diagnosis of thalassemia.Results:By traditional methods, 1 939 cases (24.22%, 1 939/8 005) were normal and 6 066 cases (75.78%, 6 066/8 005) were diagnosed as thalassemia, including 4 513 cases of α-thalassemia, 1 475 cases of β-thalassemia, and 78 cases of αβ-thalassemia. By PCR-flow Fluorescence Hybridization technology, 7 845 samples were successfully diagnosed after initial interpretation by software. Compared with traditional methods, all the sensitivity, specificity and accuracy were 100%. The other 160 samples which failed in the initial interpretation can be successfully interpreted after review or manual interpretation.Conclusion:There were no differences between the two methods on the detecting of common mutation sites of thalassemia.

Hemoglobin Santa Ana [β88(F4)Leu→Pro (CTG > CCG) HBB: c.266T > C] is an unstable hemoglobin variant characterized by a substitution of the amino acid leucine by proline at the 88th position of the β-globin chain. We for the first time identified this hemoglobin variant in a Chinese patient by capillary electrophoresis (CE). The proband was an 8-year-old boy with chronic anemia, brown urine and splenomegaly. He had been affected by moderate anemia, twice approaching a severe degree, that was attributed to infection. The CE result revealed an abnormal hemoglobin peak at electrophoretic zone 4 that correspond to the hemoglobin Santa Ana peak, and a CTG > CCG mutation at codon 88 of the β-globin gene was confirmed by DNA sequencing. To avoid misdiagnosis and genetic risks, a literature review of other unstable hemoglobins that migrate similarly to the hemoglobin Santa Ana was performed. Our findings indicate that hemoglobin Santa Ana can be clearly separated by CE, with accurate diagnosis depending on molecular analysis. This information will be useful for providing appropriate genetic counselling and for prenatal diagnosis.

Background: The alpha-thalassemia is a highly prevalent disease in tropical and subtropical regions, including southern China, and is mainly caused by deletion in alpha-globin genes (HBA1 and HBA2). The clinical manifestation of alpha-thalassemia is highly correlated with the copy number of alpha-globin genes. The decrease in copy number results in a-thalassemia, while duplication or triplication compounded with beta-thalassemia may aggravate the clinical manifestation. However, the common methods used to measure the copy number variants can only detect the three common types: -(SEA), -alpha(3.7), and -alpha(4.2), and may easily miss the rare deletional type and duplication or triplication cases. Therefore, a new method that allows the detection of different copy number variants in alpha-globin genes simultaneously and accurately needs to be established. Methods: A total of 428 peripheral-blood and fetal chorionic villus or amniotic fluid samples were used in this study. We employed a pair of primers and two probes, one for HBA1 and another for HBA2, to perform droplet digital polymerase chain reaction (ddPCR). Each reaction needed the ddPCR of RPP30 as a reference gene to calculate the copy number. Results: We accurately detected the copy number variants in alpha-globin genes, including the common form alpha-thalassemia, triplications such as alpha alpha alpha(anti4.2), and trisomy 16, by performing only two reactions. The accuracy rate for detecting the copy number of alpha-globin genes was up to 100%. Conclusion: In conclusion, ddPCR served as an accurate and rapid method for detecting copy number variations in the clinical screening for alpha-thalassemia.

Objectives Here we report two rare alpha-globin chain variants in two unrelated families: Hb Val de Marne [alpha 133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C] and Hb Dongguan [alpha 52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G]. Notably, HBA2: c.400A > C is an unreported new variant in the third exon of the alpha(2) gene, and simple heterozygous unstable Hb Dongguan haematological characteristics are proposed for the first time. Methods Hb analysis was performed by using capillary electrophoresis (CE). Twenty-three common mutations were detected using a suspension array system. Mutations were identified by DNA sequencing. Results The CE results showed an abnormal peak with incomplete separation from Hb A at zone 8 in two members of Family 1. DNA sequencing confirmed the presence of Hb Val de Marne [alpha 133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C]. Five members of Family 2 exhibited an abnormal peak at zone 11, and DNA sequencing confirmed the presence of Hb Dongguan [alpha 52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G]. Conclusions The discovery of HBA2: C.400A > C expands the existing spectrum of alpha-globin variants. The carriers of simple heterozygous Hb Dongguan generally do not have obvious clinical symptoms. The information in this study will help clinicians understand the screening, molecular diagnosis and clinical significance of Hb variants.

Abstract β-Thalassemia (β-thal), a highly prevalent disease in tropical and subtropical regions of Southern China, is caused mainly by point mutations in the β-globin gene cluster. However, large deletions have also been found to contribute to some types of β-thal. We identified a novel 5 kb deletion in the β-globin cluster in a Chinese patient using multiplex ligation-dependent probe amplification (MLPA), and characterized it with single molecule real-time (SMRT) sequencing, gap-polymerase chain reaction (gap-PCR) and Sanger sequencing. The deletion was located between positions 5226189 and 5231091 on chromosome 11 (GRCh38), extending from 4 kb upstream of the 5' untranslated region (5'UTR) to the second intron of the β-globin gene. The patient with this deletion presented with microcytosis and hypochromic red cells, as well as relatively high Hb F and Hb A2 levels. Our research indicated that SMRT sequencing is a useful tool for accurate detection of large deletions. Our study broadens the spectrum of deletional β-thalassemias and provides a perspective for further study of the function of the β-globin cluster.

Objective: The 3.7 kb deletion (-alpha(3.7)) in the alpha-globin cluster, which characterizes alpha(+)-thalassemia, has been reported to have a carrier rate of 4.78% in southern China. Three -alpha(3.7) subtypes have been identified worldwide. However, the -alpha(3.7 III) subtype has not previously been identified in China. Herein, we reported identification of the -alpha(3.7 III) subtype in a Chinese patient. Methods: We used gap-PCR and a liquid chip system to detect alpha-thalassemia mutations. Multiple ligation-dependent probe amplification was performed to detect the large deletion. We finally used Sanger sequencing and single molecule real-time sequencing to characterize and confirm the genotype. Results: The proband, characterized as -alpha(3.7 III) heterozygous, showed microcytosis and hypochromic red cells, with a mean corpuscular volume of 78 fL and mean corpuscular hemoglobin of 25.4 pg. The proband's mutation was inherited from her father, who had normal blood parameters. Conclusion: We first identified the -alpha(3.7 III) subtype in China. Consequently, all -alpha(3.7) subtypes have now been identified in the Chinese population. Therefore, attention should be paid to -alpha(3.7 III) in clinical prenatal diagnosis, given that commonly used methods such as gap-PCR may lead to misdiagnosis or missed diagnosis.

We report on a fetus with cardiomegaly and increased middle cerebral artery-peak systolic velocity at 25 weeks of gestation. Severe fetal anemia (hemoglobin (Hb) level 37 g/L) was confirmed by cordocentesis. Hb analysis showed that Hb Bart’s was 9% in cord blood. Molecular analysis of the proband’s family found that the mother was a carrier of Hb Quong Sze (Hb QS, HBA2 :c.377T>C), the father was a carrier of Hb Zurich-Albisrieden (Hb ZA, HBA2 :c.178G>C), and the fetus was a compound heterozygote for Hb ZA and Hb QA. Despite intrauterine blood transfusions, the fetus experienced problems including oligohydramnios, growth retardation, placental thickening, and heart enlargement in the third trimester. The couple chose to terminate the pregnancy, and fetal autopsy confirmed the above diagnosis. This is the first report of a case of Hb ZA compounded with Hb QS, and provides a reference for genetic counselling and prenatal diagnosis in the Chinese population. Keywords Hemoglobin Zurich-Albisrieden , hemoglobin Quong Sze , fetal anemia , hydrops fetalis , cardiomegaly , prenatal diagnosis

Objective To investigate whether β-globin gene 3'UTR+101G>C (HBB:c.*233G>C) variant has genetic effect and provide basis for gene diagnosis and genetic counseling. Method Whole blood cell analysis and capillary zone electrophoresis (CZE) were used to analyze the hematological indexes. The most frequent 23 mutations in southern Chinese individuals were routinely measured by PCR-flow fluorenscence immunmicrobeads assay. Sanger sequencing was used to detect the other variants of β-globin gene (HBB). Results In 463 cases, a total of 7 cases with HBB:c.*233G>C variant were detected, among them 4 cases carried other pathogenic variants of HBB gene (2 cases were in trans, 2 cases were in cis), who had typical hematological characteristics of mild β-thalassemia, and 3 cases also carried abnormal hemoglobin variation, but did not have hematological characteristics of β-thalassemia. Conclusion The study shows that HBB:c.*233G > C variant has no obvious genetic effect and should be a benign polymorphism.

OBJECTIVE To analyze the hematological characteristics of Chinese Gγ+(Aγδβ)0-thalassemia，SEA-HPFH and Taiwan type β-thalassemia. METHODS Hemoglobin electrophoresis and blood routine test were used to analyze the hematological indexes of all peripheral blood samples，PCR-Flow fluorescent hybridization and Gap-PCR were used to detect the globin gene mutations and the data were analyzed statistically. RESULTS The 3 types of deletion β- Thalassemia patients were showed as hypochromic small cell anemia. The MCH and MCV values of Taiwan type β-thalassemia patients were the lowest. The results of hemoglobin electrophoresis showed that the increasing of HbF was found in all of the 3 types. Except for the decreasing of Hb A2 in Chinese Gγ+(Aγδβ)0-thalassemia，the levels of Hb A2 in the other two deletion β-thalassemia patients were significantly increased. Except for Hb, there were significant differences in MCV, MCH, Hb A2 and HbF between Chinese Gγ+(Aγδβ)0-thalassemia and SEA-HPFH(P<0.001). CONCLUSION Through analyze the hematological characteristics, it can be provide that the guidance for the differential diagnosis and genetic consultation of the three commonest deletion β-thalassemia in Chinese.

Background: α-thalassemia, with carrier rates of 11.31% and 17.55% respectively in Guangdong and Guangxi province, is a highly prevalent disease in Southern China and tropical and subtropical regions and is mainly caused by deletion in α-globin gene (HBA1 and HBA2). The clinical manifestation of α-thalassemia is highly correlated with the copy number of α-globin gene. The decrease of copy number results in α-thalassemia, while duplication or triplication compounded with β-thalassemia may aggravate the clinical manifestation. However, the usual methods we used to measure the copy number variants can only detect the three common types: --SEA, -α3.7 and − α4.2, which may easily miss the rare deletional type and duplication or triplication cases. Therefore, it is essential to establish a new method which allows detection of different copy number variants in α-globin genes, including deletion, duplication and triplication simultaneously and accurately.Methods: 428 peripheral blood and fetal chorionic villus or amniotic fluid samples were recruited in this study. We used a pair of primers and two probes to perform droplet digital PCR.Results: By performing only two reactions, we accurately detected the copy number variants in α-globin genes, including the common form α-thalassemia, triplications such as αααanti4.2 and trisomy 16. The accuracy rate for detecting the copy number of α-globin genes can up to 100%.Conclusions: In conclusion, droplet digital PCR served as an accurate and rapid method for copy number variation detection in clinical screening for α-thalassemia.

We report on a fetus with cardiomegaly and increased middle cerebral artery-peak systolic velocity at 25 weeks of gestation. Severe fetal anemia (hemoglobin (Hb) level 37 g/L) was confirmed by cordocentesis. Hb analysis showed that Hb Bart’s was 9% in cord blood. Molecular analysis of the proband’s family found that the mother was a carrier of Hb Quong Sze (Hb QS, HBA2 :c.377T>C), the father was a carrier of Hb Zurich-Albisrieden (Hb ZA, HBA2 :c.178G>C), and the fetus was a compound heterozygote for Hb ZA and Hb QA. Despite intrauterine blood transfusions, the fetus experienced problems including oligohydramnios, growth retardation, placental thickening, and heart enlargement in the third trimester. The couple chose to terminate the pregnancy, and fetal autopsy confirmed the above diagnosis. This is the first report of a case of Hb ZA compounded with Hb QS, and provides a reference for genetic counselling and prenatal diagnosis in the Chinese population.

We report on a fetus with cardiomegaly and increased middle cerebral artery-peak systolic velocity at 25 weeks of gestation. Severe fetal anemia (hemoglobin (Hb) level 37 g/L) was confirmed by cordocentesis. Hb analysis showed that Hb Bart’s was 9% in cord blood. Molecular analysis of the proband’s family found that the mother was a carrier of Hb Quong Sze (Hb QS, HBA2:c.377T>C), the father was a carrier of Hb Zurich-Albisrieden (Hb ZA, HBA2:c.178G>C), and the fetus was a compound heterozygote for Hb ZA and Hb QA. Despite intrauterine blood transfusions, the fetus experienced problems including oligohydramnios, growth retardation, placental thickening, and heart enlargement in the third trimester. The couple chose to terminate the pregnancy, and fetal autopsy confirmed the above diagnosis. This is the first report of a case of Hb ZA compounded with Hb QS, and provides a reference for genetic counselling and prenatal diagnosis in the Chinese population.