The four serotypes of dengue virus (DENV1-4) are a major health concern putting 50% of the global population at risk of infection. Crucially, DENV vaccines must be tetravalent to provide protection against all four serotypes because immunity to only one serotype can enhance infections caused by heterologous serotypes. Uneven replication of live-attenuated viruses in tetravalent vaccines can lead to disease enhancement instead of protection. Subunit vaccines are a promising alternative as the vaccine components are not dependent on viral replication and antigen doses can be controlled to achieve a balanced response. Here, we show that a tetravalent subunit vaccine of dengue envelope (E) proteins computationally stabilized to form native-like dimers elicits type-specific neutralizing antibodies in mice against all four serotypes. The immune response was enhanced by displaying the E dimers on liposomes embedded with adjuvant, and no interference was detected between the four components.

ABSTRACT The four dengue virus (DENV) serotypes cause several hundred million infections annually. Several live-attenuated tetravalent dengue vaccines (LAVs) are at different stages of clinical testing and regulatory approval. A major hurdle faced by the two leading LAVs is uneven replication of vaccine serotypes stimulating a dominant response to one serotype at the expense of the other three, leading to the potential for vaccine antibody (Ab)-enhanced, more severe infections by wild-type (WT) DENV serotypes that fail to replicate in the vaccine. Protein subunit vaccines are a promising alternative since antigen dosing can be precisely controlled. However, DENV envelope (E) protein subunit vaccines have not performed well to date, possibly due to differences between the monomeric structure of soluble E and the E homodimer of the viral surface. Previously, we have combined structure-guided computational and experimental approaches to design and produce DENV2 E antigens that are stable homodimers at 37℃ and stimulate higher levels of neutralizing Abs (NAbs) than the WT E antigen in mice. The goal of this study was to evaluate if DENV2 E homodimers stimulate NAbs that target different epitopes on E protein compared to the WT E monomer. Using DENV4/2 chimeric viruses and Ab depletion methods, we mapped the WT E-elicited NAbs to simple epitopes on domain III of E. In contrast, the stable E homodimer stimulated a more complex response toward all three surface-exposed domains of the E protein. Our findings highlight the impact of DENV2 E oligomeric state on the quality and specificity of DENV NAbs and the promise of DENV E homodimers as subunit vaccines. IMPORTANCE The ideal dengue virus (DENV) vaccine should elicit a balanced and highly protective immune response against all four DENV serotypes. Current tetravalent live-attenuated DENV vaccines have faced challenges due to uneven replication of vaccine virus strains stimulating a strong immune response to one serotype and weak responses to the other three. Protein subunit vaccines provide novel opportunities to stimulate a balanced response because dosing can be precisely controlled and independent of vaccine virus replication. Here, we compare immune responses elicited by a new DENV serotype 2 protein vaccine designed to match the structure of proteins on the viral surface. We find that proteins designed to match the viral surface stimulate better immune responses targeting multiple sites on the viral surface compared to previous protein vaccines. Our results justify further testing and development of these second-generation DENV protein subunit vaccines.

Cross-reactive antibodies (Abs) to epitopes that span envelope proteins on the virion surface are hypothesized to protect against dengue. Here, we measured Abs targeting the quaternary envelope dimer epitope (EDE) as well as neutralizing and binding Abs and evaluate their association with dengue virus (DENV) infection, vaccine response, and disease outcome in dengue vaccinated and unvaccinated children (n=252) within a longitudinal cohort in Cebu, Philippines (n=2,996). Abs targeting EDE were prevalent and strongly associated with broad neutralization of DENV1-4 in those with baseline multitypic immunity. Subsequent natural infection and vaccination boosted EDE-like, neutralizing, and binding Abs. EDE-like Abs were associated with reduced dengue risk and mediated the protective effect of binding and neutralizing Abs on symptomatic and severe dengue. Thus, Abs targeting quaternary epitopes help explain broad cross protection in those with multiple prior DENV exposures, making them useful for evaluation and development of future vaccines and therapeutics.

A hallmark of dengue virus (DENV) pathogenesis is the potential for antibody-dependent enhancement, which is associated with deadly DENV secondary infection, complicates the identification of correlates of protection, and negatively impacts the safety and efficacy of DENV vaccines. Antibody-dependent enhancement is linked to antibodies targeting the fusion loop (FL) motif of the envelope protein, which is completely conserved in mosquito-borne flaviviruses and required for viral entry and fusion. In the current study, we utilized saturation mutagenesis and directed evolution to engineer a functional variant with a mutated FL (D2-FL), which is not neutralized by FL-targeting monoclonal antibodies. The FL mutations were combined with our previously evolved prM cleavage site to create a mature version of D2-FL (D2-FLM), which evades both prM- and FL-Abs but retains sensitivity to other type-specific and quaternary cross-reactive (CR) Abs. CR serum from heterotypic (DENV4)-infected non-human primates (NHP) showed lower neutralization titers against D2-FL and D2-FLM than isogenic wildtype DENV2 while similar neutralization titers were observed in serum from homotypic (DENV2)-infected NHP. We propose D2-FL and D2-FLM as valuable tools to delineate CR Ab subtypes in serum as well as an exciting platform for safer live-attenuated DENV vaccines suitable for naïve individuals and children.

Due to a patent filing, the content of this abstract is not available to be shared at this time. The abstract will be shared at the poster session. This work was supported by the Intramural Research Program of the National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health.

The dengue vaccine, Dengvaxia, has been described as eliciting antibody-dependent enhancement (ADE) in dengue-naive individuals. There is an urgent need to develop an effective dengue virus (DENV) vaccine that elicits protective, cross-reactive (CR) neutralizing antibodies (NAbs), which are capable of neutralizing DENV1–4 without triggering ADE such as EDE Abs. Here, we investigated the CRNAbs profile following DENV natural infection versus vaccination in children with prior DENV infection (n=2,996) from a longitudinal vaccine (study) cohort in Cebu, Philippines. In total, 1,214 of these children remained unvaccinated while 1,782 children received a single dose of Dengvaxia in June of 2017 during a mass vaccination campaign. Serum samples were collected one month before and one year after the vaccine campaign. To measure baseline status and change in CRNAbs level following vaccination versus natural infection, we ran Focus Reduction Neutralizing Test (FRNT) using mature DENV1–4 virions and Blockade of binding (B0B) assay against EDE Abs on a random subset of these DENV-immune children’s samples (n=231). Furthermore, we also measured IgG binding against the DENV1–4 E protein monomer and DENV2 E protein dimer. Both vaccinated and naturally infected groups elicit CRNAbs that recognize the quaternary epitopes of EDE antibodies. We also see a significant increase in antibody response in both groups, but CRNAbs had a stronger correlation to mature FRNT in naturally infected compared to vaccinated populations, indicating differences in antibody quality. These results highlight the presence of EDE-like broadly NAbs that could possibly protect against the four DENV serotypes and provide an insight for future vaccine candidates. This work was supported by the Intramural Research Program (DIR) of the National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health, the Philippine Department of Health and the University of North Carolina (PO1: P01AI106695).

The four dengue virus (DV) serotypes are mosquito-borne flaviviruses responsible for dengue fever. Live-attenuated DV vaccines that are in human trials have had mixed results with efficacy for just one or two serotypes and an increased dengue risk in some vaccinated populations. DV recombinant envelope (E) proteins as subunit vaccines have had limited success, likely due to DV wild type E protein (WT rE) is mostly monomeric at physiological temperature. Hence, it loses the quaternary structure epitopes recognized by neutralizing human antibodies (Ab) on the native dimer. We previously showed that with targeted amino acid mutations, we can form DV thermostable dimers (SD rE) displaying native quaternary epitopes targeted by strongly neutralizing Ab. Here we report on studies to test if Ab response can be directed to these quaternary epitopes by using SD rE as vaccine antigens. Since fusion loop (FL) Ab can cause antibody dependent enhancement (ADE) that increases disease severity upon heterologous DV infection, we also tested SD rE with mutated FL. Mice were immunized with DV2 WT rE or SD rE variants to compare Ab properties induced by each antigen. We found that SD-vaccinated mice had higher DV2 functional Ab titer compared to WT-vaccinated. To map vaccine responses, we run neutralization assays with chimeric epitope transplant DV and sera depleted of Ab subpopulations. We use ADE assay to determine if stabilized E dimer and mutated FL reduces ADE compared to WT rE. Preliminary results indicate that WT-vaccinated mice neutralizing Ab bind to simple epitopes on rE monomers, while SD-vaccinated mice had mostly dimer-specific neutralizing Ab. Our results demonstrate the promise of structure-guided design for developing dengue subunit vaccines. NIH/NIAID U19 AI109784 R01AI107731 DOD/US Army Medical Research ACQ W81XWH1820034

Full text Figures and data Side by side Abstract eLife assessment Introduction Results Discussion Materials and methods Data availability References Peer review Author response Article and author information Abstract A hallmark of dengue virus (DENV) pathogenesis is the potential for antibody-dependent enhancement, which is associated with deadly DENV secondary infection, complicates the identification of correlates of protection, and negatively impacts the safety and efficacy of DENV vaccines. Antibody-dependent enhancement is linked to antibodies targeting the fusion loop (FL) motif of the envelope protein, which is completely conserved in mosquito-borne flaviviruses and required for viral entry and fusion. In the current study, we utilized saturation mutagenesis and directed evolution to engineer a functional variant with a mutated FL (D2-FL), which is not neutralized by FL-targeting monoclonal antibodies. The FL mutations were combined with our previously evolved prM cleavage site to create a mature version of D2-FL (D2-FLM), which evades both prM- and FL-Abs but retains sensitivity to other type-specific and quaternary cross-reactive (CR) Abs. CR serum from heterotypic (DENV4)-infected non-human primates (NHP) showed lower neutralization titers against D2-FL and D2-FLM than isogenic wildtype DENV2 while similar neutralization titers were observed in serum from homotypic (DENV2)-infected NHP. We propose D2-FL and D2-FLM as valuable tools to delineate CR Ab subtypes in serum as well as an exciting platform for safer live-attenuated DENV vaccines suitable for naïve individuals and children. eLife assessment This valuable study describes engineered dengue virus variants that can be used to dissect epitope specificities in polyclonal sera, and to design candidate vaccine antigens that dampen antibody responses against undesirable epitopes. While the major claims are supported by solid evidence, experiments to distinguish the impact on antibody binding from neutralizing activities would have strengthened the study. This work will be of interest to virologists and structural biologists working on antibody responses to flaviviruses. https://doi.org/10.7554/eLife.87555.3.sa0 About eLife assessments Introduction Dengue virus (DENV) is a member of the Flavivirus genus and is a major global public health threat, with four major serotypes of DENV found worldwide. Dengue causes ~400 million infections each year, of which ~20% of cases present clinically, a subset of which may progress to severe dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS) (Bhatt et al., 2013; Brady et al., 2012). DENV is transmitted through Aedes mosquito vectors, and globalization and global warming are increasing the endemic range of dengue worldwide (Ebi and Nealon, 2016; Messina et al., 2019). The pathogenesis of dengue is complex as first-time infections are rarely severe and lead to serotype-specific immunity. However, reinfection with a different serotype increases the risk of developing DHF/DSS (Halstead, 1988). This is thought to be due to the phenomenon of antibody-dependent enhancement (ADE), in which poorly neutralizing cross-reactive (CR) antibodies (Abs) lead to enhanced viral uptake and infection of unique cell populations in an Fcγ-receptor-mediated manner (Katzelnick et al., 2017). ADE remains a major challenge for DENV vaccine development (Rey et al., 2018). The leading DENV vaccine platforms in clinical testing are tetravalent live-attenuated virus mixtures of all four serotypes. However, creating formulations that elicit a balanced response has proven challenging (Rabaa et al., 2017). Additionally, lab-grown strains differ from patient-derived DENVs in both maturation status and antigenicity (Raut et al., 2019). In particular, Abs targeting the fusion loop (FL) have been reported to neutralize lab and patient strains with differing strengths and have been observed to facilitate Fcγ-receptor uptake in vitro and therefore ADE (Lai et al., 2013; Beltramello et al., 2010; Costin et al., 2013). Currently, there is a single FDA-approved DENV vaccine, Dengvaxia. However, it is only approved for use in individuals aged 9–16 with previous DENV infection living in endemic areas and is contraindicated for use in naïve individuals and younger children. In naïve children, vaccination stimulated non-neutralizing CR Abs that increased the risk of severe disease after DENV infection (Wilder-Smith, 2019; Anonymous, 2019). Other DENV vaccines have been tested or are currently undergoing clinical trial, but thus far none have been approved for use in the United States (Izmirly et al., 2020). The vaccine Qdenga has been approved in the European Union, Indonesia, and Brazil, although vaccine efficacy in adults, naïve individuals, and with all serotypes has not yet been shown (Angelin et al., 2023). The DENV FL is located in Envelope (E) protein domain II (EDII) and is involved in monomer–monomer contacts with EDIII (Modis et al., 2004). During the DENV infection cycle, low pH triggers a conformational change in the E protein (Klein et al., 2013). The structure of the virion rearranges, and individual monomers form a trimer with all three FLs in the same orientation, ready to initiate membrane fusion (Modis et al., 2004; Klein et al., 2013). The core FL motif (DRGWGNGCGLFGK, AA 98–110) is highly conserved, with 100% amino acid conservation in all DENV serotypes and other mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), West Nile virus (WNV), Kunjin virus (KUNV), Murray Valley encephalitis virus (MVEV), Japanese encephalitis virus (JEV), Usutu virus (USUV), and Saint Louis encephalitis virus (SLEV; Figure 1A). Although the extreme conservation and critical role in entry have led to it being considered difficult to alter the antigenic epitope by changing more than one amino acid of the FL, we successfully tested the hypothesis that massively parallel-directed evolution could produce viable DENV FL mutants that were still capable of fusion and entry, while altering the antigenic footprint. The FL mutations, in combination with optimized prM cleavage site mutations, ablate neutralization by the prM- and FL-Abs, retain sensitivity to other protective Abs, and provide a novel vaccine strategy for DENV. Figure 1 Download asset Open asset Generation of DENV2 fusion loop mutants via directed evolution. (A) Alignment of top: dengue virus fusion loops; bottom: mosquito-borne flavivirus fusion loops, including yellow fever virus (YFV), Zika virus (ZIKV), West Nile virus (WNV), Kunjin virus (KUNV), Murray Valley encephalitis virus (MVEV), Japanese encephalitis virus (JEV), Usutu virus (USUV), and Saint Louis encephalitis virus (SLEV). Amino acids are colored by functional groups: negatively charged (red), positively charged (blue), nonpolar (yellow), polar (green), aromatic (pink), and sulfide (dark red). (B) Schematic of directed evolution procedure. Saturation mutagenesis libraries were used to produce viral libraries, which were passaged three times in either C6/36 or Vero 81 cells. At the end of the selection, viral genomes were isolated and mutations were identified by high-throughput sequencing. (C) Left: bubble plot of the sequences identified from either the unselected or selected (passage 3) C6/36 DENV libraries. Right: pie chart of the sequences from passage 3 C6/36 DENV libraries. (D) Structure of the DENV envelope with the fusion loop mutations highlighted in red. (E) Sequences of the fusion loop and furin cleavage site of DENV2, D2-FL, and D2-FLM. Results To engineer a virus with a novel antigenic footprint at the FL, we targeted the core conserved FL motif. We generated two different saturation mutagenesis libraries, each with five randomized amino acids: DRGXGXGXXXFGK (Library 1; AA 101, 103, 105–107) and DRGXXXXXGLFGK (Library 2 AA 101–105). Library 1 was designed to mutate known residues targeted by FL mAbs while Library 2 focused on a continuous linear peptide that is the epitope for FL-Abs to maximally alter antigenicity (Smith et al., 2013). Saturation mutagenesis plasmid libraries were used to produce viral libraries in either C6/36 (Aedes albopictus mosquito) or Vero 81 (African green monkey) cells and passaged three times in their respective cell types. Following directed evolution, viral genomes were extracted and subjected to deep sequencing to identify surviving and enriched variants (Figure 1B). Due to the high level of conservation, it was not surprising that most mutational combinations failed to yield viable progeny. In fact, evolutions carried out on Library 2 only yielded wildtype sequences. For Library 1, wildtype sequences dominated in Vero 81-evolved libraries. However, a novel variant emerged in C6/36 cells with two amino acid changes: DRGWGSGCLLFGK. The major variant comprised ~95% of the population, while the next most populous variant (DRGWGSGCWLFGK) comprised only 0.25% (Figure 1C). Bulk Sanger sequencing revealed an additional Env-T171A mutation outside of the FL region. Residues W101, C105, and L107 were preserved in our final sequence, supporting the importance of these residues (Modis et al., 2004). When modeled on the pre-fusion DENV2 structure, the N103S and G106L mutations are located at the interface with the neighboring monomer EDIII domain, protected from the aqueous environment. In the post-fusion form, the two residues are located between W101 and F108 and form the bowl concavity above the chlorine ion in the post-fusion trimer (Figure 1D). We used reverse genetics to re-derive the FL N103S/G106L/T171A mutant, which we term D2-FL. As enhancing Abs also target prM (Rodenhuis-Zybert et al., 2010), we also created a mature version of D2-FL termed D2-FLM, containing both the evolved FL motif and our previously published evolved prM furin cleavage site, which results in a more mature virion like those found in infected patients (Figure 1E; Raut et al., 2019; Tse et al., 2022). We performed growth curves comparing DENV2, D2-FL, and D2-FLM in both C6/36 and Vero 81 cells. In C6/36 cells, the growth of all three viruses was comparable, reaching high titers of 106–107 FFU/mL. However, in Vero 81 cells, both FL mutant viruses were highly attenuated, with a 2–2.5 log reduction in titer (Figure 2A). The species-specific phenotype in culture involved a change from insect to mammalian cells, as well as a change in growth temperature. To investigate whether the mutant viruses were more unstable at higher temperatures, we performed a thermostability assay, comparing viruses incubated at temperatures ranging from 4 to 55°C before infection. The three viruses had comparable thermostabilities, indicating that this does not explain the attenuation of the FL mutants (Figure 2B). Because the D2-FLM virus contains mutations that increase prM cleavage frequency, we also assayed the maturation status of the three viruses by western blot. D2-FL had a comparable prM:E ratio to the isogenic wildtype DENV2 (DV2-WT), while, as expected, D2-FLM had a reduced prM:E ratio, indicating a higher degree of maturation (Figure 2C). Figure 2 Download asset Open asset Biological and physical properties of mature DENV2 fusion loop mutants. (A) Multistep growth curves [Multiplicity of infection (MOI) = 0.05–0.1] of DV2-WT, D2-FL, and D2-FLM on C6/36 cells (left) or Vero 81 cells (right). (B) Thermostability assay on DV2-WT, D2-FL, and D2-FLM. (C) Western blot of virions, blotted against Envelope and prM proteins. Equal volumes of supernatants from viral infected C6/36 cells at 5 days post-infection (dpi) (A) were loaded into each lane. The prM:E ratio was determined and normalized to the DV2-WT ratio. High exposure of D2-FLM (right) illustrates the relative abundance of prM protein to E protein. Averages of three biological replicates are shown. The data are graphed as means ± standard deviations (Error bars). Two-way ANOVA was used for statistical comparison of growth curves and thermostability: ns, not significant; *<0.05; **<0.005; ***<0.0005. Figure 2—source data 1 Raw gel images of the western blot shown in Figure 2C. https://cdn.elifesciences.org/articles/87555/elife-87555-fig2-data1-v1.zip Download elife-87555-fig2-data1-v1.zip Next, we characterized the ability of Abs targeting the FL to recognize DV2-WT, D2-FL, and D2-FLM with a panel of monoclonal antibodies (mAbs). Importantly, D2-FL and D2-FLM were resistant to mAbs targeting the FL. Neutralization by 1M7 is reduced by ~2 logs in both variants, 1N5 neutralization is reduced by ~1 log for D2-FL and reduced to background levels for D2-FLM, and no neutralization was observed for 1L6 or 4G2 for either variant (Figure 3A; Smith et al., 2013). Focusing on the D2-FLM virus containing both evolved motifs, we then characterized the antigenicity of the whole virion with a panel of mAbs. As expected, D2-FLM was unable to be neutralized by the prM Abs 1E16 and 5M22; the Ab 2H2 does not neutralize either DV2-WT or D2-FLM (Figure 3B). For Abs targeting epitopes in non-mutated regions, including the ED1 and EDE epitopes that target EDII and EDIII, FRNT50 values were generally comparable, although EDE1-C10 shows a moderate but statistically significant reduction between DV2-WT and D2-FLM, indicating that the overall virion structural integrity was intact (Figure 3B). Figure 3 Download asset Open asset Fusion loop (FL) mutant is insensitive to FL monoclonal antibodies (mAbs), the major target for cross-reactive Abs in non-human primates (NHPs). (A) Left: FRNT50 values for neutralization of DV2-WT, D2-FL, and D2-FLM with mAbs against the FL (1M7, 1N5, 1L6, 4G2). All Abs were tested in at least n = 3 independent experiments, except 1N5 due to limited Ab. Right: average neutralization curves for neutralization of DV2-WT, D2-FL, and D2-FLM with mAbs against the DENV2 FL. (B) FRNT50 values for neutralization of DV2-WT and D2-FLM with mAbs against DENV2 prM (2H2, 1E16, 5M22), EDI (3F9), EDE (C10, B7), and EDIII (2D22). All Abs were tested in at least n = 3 independent experiments. The data are graphed as means ± standard deviations (Error bars). (C) Neutralization of DV2-WT, D2-FL, and D2-FLM with sera from NHPs infected with either DENV4 or DENV2. FRNT50s were compared using Student's t-test. Significant symbols are as follows: *p<0.05; **p<0.005; ***p<0.0005; ****p<0.00005. The data are graphed as means ± standard deviations. Next, we analyzed neutralization of the D2-FLM virus using serum derived from convalescent humans and experimentally infected rhesus macaque non-human primates (NHPs). Overall, we tested serum from three different cohorts with a total of 6 humans and 9 NHPs at different time points with a total of 27 samples. In the first cohort (NHP infected with 1 × 106 FFU Vero-grown virus via subcutaneous [SC] injection) (Young et al., 2023), serum from homotypic DENV2-infected NHPs (n = 3) did not display a difference in neutralization between DV2-WT, D2-FL, and D2-FLM, confirming that prM and FL epitopes are not significant contributors to the homotypic type-specific (TS) neutralizing Ab response in primates (Figure 3C). In two NHPs infected with DENV4, strong neutralization potency (FRNT50 between 1:100 and 1:1000) was demonstrated against DV2-WT (Figure 3C). Heterologous cross-neutralization was significantly reduced to background levels (FRNT50 < 1:40) against the D2-FLM virus at 90 days post-infection (dpi). Neutralization observed against D2-FL, in general, fell between DV2-WT and D2-FLM. NHP 0Y0 displayed little difference in neutralization between D2-FL and D2-FLM, suggesting that FL Abs were more prominent in this animal. Interestingly, in animal 3Z6, at 20 dpi, neutralization against DENV-FL was comparable to DV2-WT, while D2-FLM was greatly reduced, indicating that Abs in the sera targeting the immature virion formed a large portion of the CR response. These data suggest that after a single infection many of the CR Ab responses target prM and the FL and the reliance on these Abs for heterotypic neutralization increases over time (Figure 3C). In the second cohort (NHPs infected with 5 × 105 FFU C6/36-grown virus via SC injection) and the third cohort (human serum tested positive by ELISA for homotypic DENV infection) (Lopez et al., 2021), most of the serum (18/24) did not cross-neutralize DV2-WT (FRNT50 < 1:40), leading to inconclusive result in determining the CR-Ab population in these sera (Table 1). The difference between the three cohorts also highlights the heterogeneity of Ab composition in humans and NHPs after DENV exposure. Nevertheless, the collection of FL, mature, and FL-mature variants provides new opportunity to delineate antibody composition in complex polyclonal serum from DENV natural infection and vaccination. Table 1 Summary of FRNT50 values of human convalescent serum and non-human primates (NHP) infection serum against DV2, D2-FL (not determined in human serum) and D2-FLM. FRNT50 values were derived from an eight-point dilution curve of serum started from 1:40 with subsequent threefold dilutions. FRNT50 values were calculated/extrapolated from the neutralization curves. For human serum, the average FRNT50 values were shown from two independent experiments with technical replicates. For NHP serum, FRTN50 values were average of three independent experiments. ND, not determined. * denotes the Hill slopes of all the neutralization curve of them sample are <0.5 (low confidence of neutralization). Human #Infected serotypeCollection tmeDV2D2-FLD2-FLMDS1500DENV1Convalescent serum1:75ND1:53DS24991:80ND1:52DS1136DENV31:133ND1:45DS11601:86ND1:208DS0275DENV41:94ND1:94DS22391:156ND1:42NHP #Infected serotypeCollection time (dpi)DV2D2-FLD2-FLMR628DENV430<1:40<1:40<1:4060<1:40<1:40<1:40901:42*<1:40<1:40R73730<1:40<1:40<1:4060<1:40<1:40<1:4090<1:40<1:40<1:40R113230<1:40<1:40<1:4060<1:40<1:40<1:4090<1:40<1:40<1:40R1160301:58*<1:40<1:40601:57*1 : 50*<1:4090<1:401 : 57*1:91* Discussion Mechanistic understanding of vaccine protection and identification of correlates of protection are immensely important for DENV vaccine development. The dual protective and enhancing properties of DENV Abs create major challenges for dissecting the role of various Ab populations in disease protection. Cross-reactive weakly neutralizing prM- and FL-Abs are often immunodominant after primary DENV infection (Lai et al., 2013; Smith et al., 2012; Oliphant et al., 2006; Lai et al., 2008; Dejnirattisai et al., 2010), and can lead to overestimation of the levels of heterotypic protection in traditional neutralization assays. Since these same antibodies are also associated with ADE (Rodenhuis-Zybert et al., 2010), inaccurate conclusions could have dire consequences if protection in vitro translates to the enhancement of disease in human vaccinees. Unfortunately, Ab profiling in polyclonal serum is mainly performed by ELISA, and a neutralization assay that can discriminate Abs does not exist. The D2-FLM variant is not neutralized by FL- and prM-mAbs and appears insensitive to neutralization by these Abs in polyclonal serum. Of note, EDE1-C10 neutralization potency was also reduced in our FL-M variant, further indicating our mutations are affecting the tip of the EDII region that partially overlaps with the EDE1 epitope (Sharma et al., 2021). In combination with other chimeric DENVs (Andrade et al., 2019; Young et al., 2020; Gallichotte et al., 2015), D2-FLM provides a reagent to distinguish between TS, protective CR (e.g. E dimer epitope [EDE]) (Barba-Spaeth et al., 2016; Dejnirattisai et al., 2015) and ADE-prone CR (e.g. FL and prM) (Dejnirattisai et al., 2010) Ab subclasses in neutralization assays after infection and vaccination. Due to the ADE properties of DENV Abs, studies to understand and eliminate ADE phenotype are under active investigation. For example, mAbs can be engineered to eliminate binding to the Fcγ receptor, abolishing ADE (Kotaki et al., 2021). While this methodology holds potential for Ab therapeutic development and passive immunization strategies, it is not relevant for vaccination. As FL and prM targeting Abs are the major species demonstrated to cause ADE in vitro, we and others hypothesized that these Abs are responsible for ADE-driven negative outcomes after primary infection and vaccination (Lai et al., 2013; Beltramello et al., 2010; Costin et al., 2013; de Alwis et al., 2014). We propose that genetic ablation of the FL and prM epitopes in vaccine strains will minimize the production of these subclasses of Abs responsible for undesirable vaccine responses. Indeed, covalently locked E-dimers and E-dimers with FL mutations have been engineered as potential subunit vaccines that reduce the availability of the FL, thereby reducing the production of FL Abs (Rouvinski et al., 2017; Rockstroh et al., 2015; Slon-Campos et al., 2019; Metz et al., 2017). DENV subunit vaccines are an area of active study (Kudlacek et al., 2021); however, monomer/dimer subunits can also expose additional, interior-facing epitopes not normally exposed to the cell. Furthermore, dimer subunits are not a complete representation of the DENV virion, which presents other structurally important interfaces such as the threefold and fivefold symmetries. Concerns about balanced immunity to all four serotypes also apply to subunit vaccine platforms. Given the complexity of the immune response to DENV, live virus vaccine platforms have thus far been more successful. However, the FL is strongly mutationally intolerant. Previous reported mutations in the FL are mainly derived from experimental evolution using FL-Abs to select for escape mutant or by deep mutational scanning (DMS) of the Env protein for Ab epitope mapping. Mutations in the FL epitope were observed in a DENV2-NGC-V2 (G106V) (Goncalvez et al., 2004), attenuated JEV vaccine strain SA14-14-2 (L107F) (Gromowski et al., 2015), and attenuated WNV-NY99 (L107F) (Zhang et al., 2006). While most of the mutations, including the double mutations reported here lead to attenuation of the virus, a recent DMS study showed that Zika-G106A has no observable impact on viral fitness (Chambers et al., 2018). Interestingly, we also recovered a mutation G106L, suggesting that positions 103, 106, and 107 are tolerable FL positions for mutation in mosquito-borne flavivirus. On the other hand, tick-borne flaviviruses, no known vector flaviviruses, and invertebrate-specific flaviviruses show a more diverse FL composition. The inflexibility of mosquito-borne flaviviruses might be due to the evolutionary constraint of the virus to switch between mosquito and vertebrate hosts. Using directed evolution, we successfully generated our D2-FLM variant that combines viability with the desired Ab responses. Therefore, the D2-FLM variant is a novel candidate for a vaccine strain, which presents all the native structures and complex symmetries of DENV necessary for T-cell-mediated responses and which can elicit more optimal protective Ab responses (Tian et al., 2019; Elong Ngono and Shresta, 2019; Waickman et al., 2019). Other considerations of high importance when designing a live DENV vaccine include strain selection and serotype balance (Gallichotte et al., 2018). In the current study, we used DENV2 S16803, a prototype for DENV2 (Halstead and Marchette, 2003). However, S16803 was isolated several decades ago, and it may be beneficial to utilize more contemporaneous strains (Rabaa et al., 2017; Juraska et al., 2018). Work is currently ongoing to demonstrate the portability of the evolved FL motif on additional DENV2 strains and other serotypes, which is essential for tetravalent vaccine production. D2-FLM was highly attenuated in Vero cells, creating a challenge for vaccine production. Therefore, further adaptation of this strain to grow efficiently in mammalian cells while retaining its antigenic properties is needed. We have tested a panel of FL-Abs; however, we cannot exclude the possibility that other FL-Abs may not be affected by N103S and G106L. Our study confirmed that saturation mutagenesis could generate mutants with multiple amino acid changes, and we are currently using D2-FLM as backbone to iteratively evolve additional mutations in FL to further vary the FL antigenic epitope. Taken together, the FLM variant holds new possibilities for a new generation of DENV vaccines, as well as a platform to readily measure TS and CR ADE-type responses and thereby assess the true protective potential of DENV vaccine trials and safeguard approval of DENV vaccines for human use. Materials and methods Cells and viruses Request a detailed protocol A. albopictus C6/36 (ATCC CRL-1660) cells were grown in MEM (Gibco) with 5% FBS (HyClone), 1% penicillin/streptomycin (Gibco), 0.1 mM nonessential amino acids (Gibco), 1% HEPES (Gibco), and 2 mM GlutaMAX (Gibco), cultured at 32°C with 5% CO2. African green monkey Vero 81 cells (ATCC CCL-81) were grown in DMEM/F12 (Gibco) with 10% FBS, 1% penicillin/streptomycin (Gibco), 0.1 mM nonessential amino acids (Gibco), and 1% HEPES (Gibco), cultured at 37°C with 5% CO2. Cells were tested negative for mycoplasma. DENV viruses were grown in C6/36 or Vero 81 cells maintained in infection media. C6/36 infection media consists of Opti-MEM (Gibco) with 2% FBS (HyClone), 1% penicillin/streptomycin (Gibco), 0.1 mM nonessential amino acids (Gibco), 1% HEPES (Gibco), and 2 mM GlutaMAX (Gibco). Vero 81 infection media consists of DMEM/F12 (Gibco) with 2% FBS, 1% penicillin/streptomycin (Gibco), 0.1 mM nonessential amino acids (Gibco), and 1% HEPES (Gibco). DENV2 strain S16803 was used in this study (Halstead and Marchette, 2003). Sequences used for the alignments include DENV1 WestPac-74 (U88535.1), DENV2 S-16803 (GU289914.1), DENV3 3001 (JQ411814.1), DENV4 Sri Lanka-92 (KJ160504.1), YFV 17D (NC_002031.1), SLEV Kern217 (NC_007580.2), JEV (NC_001437.1), USUV Vienna-2001 (NC_006551.1), MVEV (NC_000943.1), and WNV-1 NY99 (NC_009942.1), and ZIKV MR-766 (NC_012532.1). DENV reverse genetics Request a detailed protocol DENV2 S16803 was used in this study. Recombinant viruses were created using a four-plasmid system as previously described (Messer et al., 2012), consisting of the DENV genome split into four segments, each cloned into a separate plasmid. The DENV plasmids were digested and ligated to form a single template for in vitro transcription. The resulting RNA was electroporated into either C6/36 or Vero cells. Virus-containing supernatant was harvested at 4–5 d post electroporation and passaged. DENV variants were created through site-directed mutagenesis of the DENV plasmids. Library generation and directed evolution Request a detailed protocol DENV FL libraries were generated through saturation mutagenesis of the indicated resides, based on a previously published protocol (Tse et al., 2022; Tse et al., 2017). Degenerate NNK oligonucleotides were used to amplify the region, generating a library of mutated DNA fragments. Q5 DNA Polymerase was used with less than 18 cycles to maintain accuracy. The resulting library was cloned into the DENV reverse genetics system. The ligated plasmids were electroporated into DH10B ElectroMax cells (Invitrogen) and directly plated on 5,245 mm2 dishes (Corning) to avoid bias from suspension culture. Colonies were pooled and purified using a Maxiprep kit (QIAGEN), and the plasmid library used for DENV reverse genetics (above). Viral libraries were passaged three times in the corresponding cell type. High-throughput sequencing and analysis Request a detailed protocol Viral RNA was isolated with a QIAamp viral RNA kit (QIAGEN), and cDNA produced using the Superscript IV Reverse Transcriptase (Invitrogen). Amplicons were prepared for sequencing using the Illumina TruSeq system with two rounds of PCR using Q5 Hot Start DNA polymerase (NEB). For the first round of PCR, primers were specific to the DENV2 E sequence surrounding the FL motif with overhangs for the Illumina adapters (RT: CGCAGCTAGAATCGATCTAGCNNNNNNNNNNNNNNNTGTGCACCAGCCAAGC; F:CCCTACACGACGCTCTTCCGATCTNNNNNCAAACCAACATTGGATTTTGAACTG; R:GACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNCGCAGCTAGAATCGATCTAGC). After purification, this product was used as the template for the second round of PCR using Illumina P5 and P7 primers containing 8-nucleotide indexes (P5: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGAC; P7: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG). Purified PCR products were analyzed on a Bioanalyzer (Agilent Technologies) and quantified on a Qubit 4 fluorometer (Invitrogen). Amplicon libraries were run on a MiSeq system with 2 × 150 bp reads. Plasmid and P0 libraries were sequenced at a depth of ~4.5 million reads; later passages were sequenced at a depth of ~750,000 reads. Custom Perl and R scripts were used to analyze and plot the data as previously published (Tse et al., 2022) and can be found the Tse Lab GitHub site (Meganck, 2022). DENV growth kinetics Request a detailed protocol One day before infection, 5 × 105 cells were seeded in every well of a 6-well plate. Cells with infected with an MOI of 0.05–0.1, estimating 1 × 106 cells on the day of infection. Infection was carried out for 1 hr in the incubator, followed by 3× washes with PBS and replenishment with fresh infection medium. Then, 300 uL of viral supernatant was collected at 0, 24, 48, 72, 96, and 120 hr and stored at –80°C. All experiments were performed independently at least three times (biological replicate). DENV focus-forming assay Request a detailed protocol Titers of viral supernatant were determined using a standard DENV focus-forming assay. In brief, cells were seeded at 2 × 104 cells per well of a 96-well plate 1 d before infection. The next day, 50 uL of tenfold serial

A stabilized dimer of the surface protein from dengue virus has been engineered to elicit antibodies that neutralize the virus.

The long-term function of transplanted therapeutic cells typically requires systemic immune suppression. Here, we show that a retrievable implant comprising a silicone reservoir and a porous polymeric membrane protects human cells encapsulated in it after implant transplantation in the intraperitoneal space of immunocompetent mice. Membranes with pores 1 µm in diameter allowed host macrophages to migrate into the device without the loss of transplanted cells, whereas membranes with pore sizes <0.8 µm prevented their infiltration by immune cells. A synthetic polymer coating prevented fibrosis and was necessary for the long-term function of the device. For >130 days, the device supported human cells engineered to secrete erythropoietin in immunocompetent mice, as well as transgenic human cells carrying an inducible gene circuit for the on-demand secretion of erythropoietin. Pancreatic islets from rats encapsulated in the device and implanted in diabetic mice restored normoglycaemia in the mice for over 75 days. The biocompatible device provides a retrievable solution for the transplantation of engineered cells in the absence of immunosuppression.

Dengue virus (DENV) is responsible for the most prevalent and significant arthropod-borne viral infection of humans. The leading DENV vaccines are based on tetravalent live-attenuated virus platforms. In practice, it has been challenging to induce balanced and effective responses to each of the four DENV serotypes because of differences in the replication efficiency and immunogenicity of individual vaccine components. Unlike live vaccines, tetravalent DENV envelope (E) protein subunit vaccines are likely to stimulate balanced immune responses, because immunogenicity is replication independent. However, E protein subunit vaccines have historically performed poorly, in part because the antigens utilized were mainly monomers that did not display quaternary-structure epitopes found on E dimers and higher-order structures that form the viral envelope. In this study, we compared the immunogenicity of DENV2 E homodimers and DENV2 E monomers. The stabilized DENV2 homodimers, but not monomers, were efficiently recognized by virus-specific and flavivirus cross-reactive potently neutralizing antibodies that have been mapped to quaternary-structure epitopes displayed on the viral surface. In mice, the dimers stimulated 3-fold-higher levels of virus-specific neutralizing IgG that recognized epitopes different from those recognized by lower-level neutralizing antibodies induced by monomers. The dimer induced a stronger E domain I (EDI)and EDII-targeted response, while the monomer antigens stimulated an EDIII epitope response and induced fusion loop epitope antibodies that are known to facilitate antibody-dependent enhancement (ADE). This study shows that DENV E subunit antigens that have been designed to mimic the structural organization of the viral surface are better vaccine antigens than E protein monomers. IMPORTANCE Dengue virus vaccine development is particularly challenging because vaccines have to provide protection against four different dengue virus stereotypes. The leading dengue virus vaccine candidates in clinical testing are all based on live-virus vaccine platforms and struggle to induce balanced immunity. Envelope subunit antigens have the potential to overcome these limitations but have historically performed poorly as vaccine antigens, because the versions tested previously were presented as monomers and not in their natural dimer configuration. This study shows that the authentic presentation of DENV2 E-based subunits has a strong impact on antibody responses, underscoring the importance of mimicking the complex protein structures that are found on DENV particle surfaces when designing subunit vaccines.

Dengue viruses (DENV serotypes 1-4) and Zika virus (ZIKV) are related flaviviruses that continue to be a public health concern, infecting hundreds of millions of people annually. The traditional live-attenuated virus vaccine approach has been challenging for the four DENV serotypes because of the need to achieve balanced replication of four independent vaccine components. Subunit vaccines represent an alternative approach that may circumvent problems inherent with live-attenuated DENV vaccines. In mature virus particles, the envelope (E) protein forms a homodimer that covers the surface of the virus and is the major target of neutralizing antibodies. Many neutralizing antibodies bind to quaternary epitopes that span across both E proteins in the homodimer. For soluble E (sE) protein to be a viable subunit vaccine, the antigens should be easy to produce and retain quaternary epitopes recognized by neutralizing antibodies. However, WT sE proteins are primarily monomeric at conditions relevant for vaccination and exhibit low expression yields. Previously, we identified amino acid mutations that stabilize the sE homodimer from DENV2 and dramatically raise expression yields. Here, we tested whether these same mutations raise the stability of sE from other DENV serotypes and ZIKV. We show that the mutations raise thermostability for sE from all the viruses, increase production yields from 4-fold to 250-fold, stabilize the homodimer, and promote binding to dimer-specific neutralizing antibodies. Our findings suggest that these sE variants could be valuable resources in the efforts to develop effective subunit vaccines for DENV serotypes 1 to 4 and ZIKV.