PURPOSE:FTY720 is an agonist of the Sphingosine-1-phosphate (S1P) receptor 1, 3, 4, and 5 and a functional antagonist of the S1P1 receptor; it can inhibit the activation of mTOR/NF-κB and has therapeutic potential in inflammatory disease. This study was designed to determine the role of the inflammatory process in diabetic retinopathy and investigate the effect of FTY720 on high glucose (HG)-induced rat retinal Müller cells (rMC-1 cells). METHODS:In the present study, the role of FTY720 in inhibiting inflammation and its underlying mechanism were investigated. rMC-1 cells were treated without or with HG, FTY720, CQ, or RAP. Cell viability was examined by CCK-8 assay; cell activation was assessed by western blot analysis and IF staining; and cell migration was evaluated by a scratch wound healing assay. The expression of inflammation-associated proteins and autophagy-related proteins was evaluated by transmission electron microscopy, AO staining, MDC-labeled autophagic vacuoles, western blot analysis and ELISA. RESULTS:Western blot analysis and IF staining showed that the level of the rMC-1 cell marker GFAP was decreased, while GS was increased in FTY720 groups compared to that in the HG group. The healing assay results showed that compared with HG treatment, FTY720 treatment significantly reduced cell migration. Western blot analysis, ELISA and IF staining showed that compared with HG, FTY720 reduced proinflammatory proteins by inhibiting the mechanistic target of the mTOR/NF-κB signaling pathway and regulating autophagy. CONCLUSIONS:This study suggests that in an HG-induced rMC-1 cell model, FTY720 significantly inhibited the production of inflammatory cytokines by inhibiting mTOR/NF-κB signaling and regulating autophagy. These findings were associated with a decrease in rMC-1 cell injury, suggesting that FTY720 or related compounds may be valuable modulators of HG-induced retinal injury.

Purpose:Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.Methods:A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.Results:Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.Conclusions:We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Purpose Hyperopic anisometropia is a major cause of amblyopia and may be associated with macular pigment optical density (MPOD) reduction. To explore whether the MPOD changes in hyperopic anisometropic amblyopia, we measured the MPOD using fundus reflectometry in eyes with hyperopic anisometropic amblyopia and normal vision. Methods This was a cross-sectional study conducted from January 2017 to June 2017. Forty subjects (25 males and 15 females) between the ages of 6 and 10 years were recruited. The subjects' eyes were divided into two groups: amblyopic eyes (best-corrected visual acuity (BCVA) not more than 20/25 or BCVA of two eyes differing by two or more lines) and fellow eyes. All enrolled subjects underwent a comprehensive ophthalmic examination, including extraocular motility assessment, cover-uncover testing, and refractive error (noncycloplegic), BCVA, axial length (AL), macular foveal thickness (MFT) and MPOD (Visucam ® 200, Carl Zeiss Meditec AG, Germany). Results The MPOD of amblyopic and fellow eyes was 0.12 ± 0.03 log units and 0.13 ± 0.04 log units, respectively, with a significant difference ( P = 0.026). The MFT of amblyopic and fellow eyes was 241.28 ± 13.95 and 237.13 ± 16.02 μm, respectively, revealing that the MFT was significantly higher in amblyopic eyes than in fellow eyes ( P = 0.028). Conversely, there was no correlation between the MPOD and MFT in the two groups. Conclusions This study is the first to report that the MPOD is decreased in hyperopic anisometropic amblyopia. In this study, no correlation between the MPOD and MFT was found. In the future, factors that induce a decrease in the MPOD in eyes with hyperopic anisometropic amblyopia should be explored in a large-sample study with follow-up observation.

Abstract Purpose To uncover the role of the mitogen-activated protein kinase kinase (MEK)/extracellular signal-regulated kinase (ERK)/runt-related transcription factor 2 (RUNX2)/interleukin-11 (IL-11) pathway in the activation of Müller glial cells (MGCs) and the breakdown of blood-retina barrier (BRB) during diabetic retinopathy (DR). Methods Western blot (WB) detected the activation of MEK/ERK/RUNX2/IL-11 pathway, and quantitative reverse transcription polymerase chain reaction (qRT-PCR) detected IL-11 mRNA levels in high glucose (HG)-exposed MIO-M1 cells. Co-immunoprecipitation (Co-IP) identified the interaction between ERK and RUNX2. Immunofluorescence (IF) measured the co-localization of ERK and RUNX2. Luciferase reporter gene assay identified the transcription activity of IL-11 promoter under HG conditions. Enzyme-linked immunosorbent assay (ELISA) detected IL-11 levels in MIO-M1 cell culture supernatant. WB detected IL-RA protein levels, and Immunofluorescence measured the co-localization of IL-11 and IL-11RA. WB detected MGCs activation marker glial fibrillary acidic protein (GFAP) protein levels. 5-ethynyl-2'-deoxyuridine (EdU) incorporation assay detected the proliferation of MGCs. WB detected the activation of MEK/ERK/RUNX2/IL-11 pathway in streptozotocin (STZ)-induced diabetic mice. ELISA detected IL-11 and IL-11RA levels in mouse retina tissues. QRT-PCR and WB detected tight junction-associated molecules claudin-5, occluding and tight junction protein 1 (ZO-1) mRNA and protein levels in mouse retina tissues, respectively. Results MEK/ERK/RUNX2/IL-11 pathway was activated in HG-exposed MIO-M1 cells. Additionally, IL-11 bound to IL-11RA on MIO-M1 cells to promote MIO-M1 cell activation and proliferation. In the mouse STZ-induced diabetic model, MEK/ERK/RUNX2/IL-11/IL-11RA pathway was also activated. Finally, the blockade of the pathway mitigated the activation of MGCs and the breakdown of BRB. Conclusion The data suggested that activated MEK/ERK/RUNX2/IL-11/IL-11RA autocrine pathway can promote the activation of MGCs and the breakdown of BRB during DR, implying novel anti-molecular strategies for the treatment of DR.

AIM:To investigate the association between variables related to tea consumption (duration, frequency, and type) and the risk of diabetic retinopathy.METHODS:A rural community-based, cross-sectional survey was conducted in Weitang Town, Suzhou, China. People aged 60 years or above were invited to complete the survey. All eligible patients underwent detailed eye examination. Diabetic retinopathy (DR) was diagnosed and graded based on the retinal fundus imaging. Diabetes was defined as fasting glucose concentrations of ≥7.0 mmol/L or self-reported diagnosis of diabetes. Information about tea consumption such as duration, type, and frequency, together with demographics and lifestyle characteristics, were collected using a face-to-face questionnaire interview. The association between tea consumption and the risk of DR was determined by univariate and multivariate logistic regression analyses.RESULTS:Among the 5,281 participants, 614 had diabetes mellitus (prevalence of 11.63%). The prevalence rate of DR was 10.38% in the diabetic population and 1.04% in the general population. Compared with non-tea consumers, the crude OR values for DR in subjects with long-term and short-term tea consumption were 0.34 (95%CI = 0.14-0.82, p = 0.016) and 1.64 (95%CI = 0.74-3.64, p = 0.221), respectively. When adjusted for age, gender, and other confounders, consumption of tea for ≥20 years was associated with reduced odds of DR (OR = 0.29, 95%CI = 0.09-0.97, p = 0.044). Thus, long-term tea consumption was significantly associated with a lower risk of DR. There was no statistical significance between frequency or type of tea consumption with DR (p > 0.05).CONCLUSION:Elderly diabetic Chinese residents who consumed tea for more than twenty years had a lower risk of DR compared to non-tea consumers. The long-term tea consumption may be an independent protective factor for DR. However, further studies are warranted to examine the association.

We read with great interest the article by Brenner et al.1 in the February 2019 issue regarding early surface ablation on aborted laser in situ keratomileusis (LASIK) flaps. In femtosecond laser–assisted LASIK, the procedure was occasionally aborted due to various abnormal events that lead to complicated flaps. The rescue method reported in this article was photorefractive keratectomy or laser epithelial keratomileusis. These operations require a mechanical method to remove the corneal epithelium. However, in some cases with side cutting or lifting of the flap, the corneal flap did not adhere to the corneal bed firmly. Then the flap would be loose and displace during mechanical removal of the epithelium. We suggest that phototherapeutic keratectomy may be more suitable for epithelial removal in these circumstances. We have used the technique in clinical practice. In addition, the application time of glucocorticoid eye drops in the article may be short. It is generally believed that glucocorticoid eye drops should be applied for at least 2 months after surface ablation. Brenner et al. reported that patients only received glucocorticoid eye drops for 4 weeks after surface ablation, which could lead to haze or myopia recurrence. The myopia deviation or decline in uncorrected or corrected distance visual acuity of the cases reported in the article may be related to this cause.

AIM: To investigate the predictive factors of the opaque bubble layer (OBL) compared to the fellow eye of same patients in FS200 femtosecond laser assisted laser in situ keratomileusis (FS-LASIK). METHODS: This study consisted of 60 consecutive patients (120 eyes) with unilateral OBL during FS-LASIK. Eyes were divided into OBL (the OBL eyes) and OBL-free groups (the fellow eyes) based on the occurrence of OBL. The preoperative demographic data, refraction, keratometry, corneal astigmatism, pachymetry, intraocular pressure and intraoperative data including the outlet location of gas diffusing canal were collected. Conditional logistic regression analysis was performed to find the associated factors with OBL in the two groups by determining odds ratios (OR) and 95%CI. RESULTS: The preoperative demographic data, mean spherical errors, mean K value, suction time, intraocular pressure and central cornea thickness were not significantly different between the two groups. The outlet location of gas diffusing canal (P<0.01, OR 7.16, 95%CI 2.53-20.32) and the corneal astigmatism (P=0.013, OR 0.13, 95%CI 0.03-0.65) were significantly associated with the incidence of OBL by multivariate logistic regression analysis. Visual acuity, efficacy, and safety were comparable between the two groups two months after surgery except for a slightly lower predictability value for the hard OBL eyes. CONCLUSION: The reduction of the incidence of OBL is obvious when the outlet of gas diffusing canal located at the posterior border of the corneoscleral limbus. This is probably consequent to more effectiveness of gas diffusing canal. Corneal astigmatism is also an independent protective factor for OBL formation.

PURPOSE:This retrospective study aimed at comparing the efficacy and safety of toric and spherical orthokeratology lenses in the treatment of patients with moderate to high astigmatism.METHODS:Fifty adolescents with myopia and moderate to high astigmatism (≥1.50 D) who underwent consecutive orthokeratology treatment for at least 1 year were included in this study. The toric group comprised 25 subjects (25 eyes, 11 M, 14 F; age, 10.67 ± 1.46 years) who were fitted with toric orthokeratology lenses. The spherical group comprised 25 subjects (25 subjects, 11 M, 14 F; age, 11.45 ± 1.63 years) who were fitted with traditional spherical orthokeratology lenses as a control. Corneal topography, visual acuity, axial length, and slit-lamp examinations were performed to determine the differences between these two groups. The corneal tangential difference mapping was conducted between baseline and every subsequent visit to calculate the magnitude of lens decentration. The corrective effect of ortho-K lens was measured by using the corneal axial difference map.RESULTS:The mean decentration and its vertical vector were significantly less in the toric group than in the spherical group after 1 month of lens wear. In toric group, the corneal astigmatism decreased from 1.85 ± 0.31 D at baseline to 1.45 ± 0.85 D after the first month of wear. There was a significant linear correlation between the change in corneal astigmatism and lens decentration in the toric group from 1 month to 1 year (Y = 3.268 ∗ X + 0.9182, R 2 = 0.5035, p < 0.0001 (X: lens decentration; Y: astigmatic changes)). There were no significant differences in the post-OK uncorrected visual acuity, myopia control, or ocular health between the toric and spherical groups.CONCLUSION:The toric orthokeratology lens design can effectively reduce the lens decentration magnitude and CJ180 from 1-month visit to 12-month visit of patients with high or moderate corneal astigmatism. Meanwhile, there was no significant difference in visual acuity, myopia control, and ocular health throughout 12 months. However, the effect of toric lenses on corneal morphology may be susceptible to lens positioning.

Choroidal neovascularization (CNV) is a type of wet age-related macular degeneration (AMD) which is a major cause of blindness in elder patients. Tumor necrosis factor receptor-associated factor 6 (TRAF6) promotes tumor angiogenesis via upregulating the expression of hypoxia-inducible factor 1α (HIF-1α) and vascular endothelial growth factor (VEGF). Additionally, TRAF6 facilitates the inflammatory response in macrophages and microglia. Here, using mouse laser-induced CNV model and TRAF6 siRNA, the study shows that TRAF6 is a critical player in CNV. The expression of TRAF6, HIF-1α, and VEGF increased in the model. TFAF6 siRNA intravitreal (IVT) injection inhibited CNV formation, as well as expression of HIF-1α and VEGF, activation of macrophages and microglia. Together, our data suggest that TFAF6 inhibition reduces CNV formation via down-regulating expression of HIF-1α and VEGF and activation of macrophages and microglia, demonstrating the unique advantages of TRAF6 inhibition in the alleviation of AMD.

Glaucoma is a progressive optic neuropathy and is one of the leading causes of blindness in the industrialized countries. The involvement of microRNAs (miRs) has been implicated in regulating the complex biological responses to changes in intraocular pressure. However, the therapeutic role of miR-200a on glaucoma has not been well studied yet. In this study, we confirmed the role of miR-200a in glaucoma progression and identified the related mechanism. Microarray expression profiles were used to screen the glaucoma-related genes. The relationship between miR-200a and FGF7 was validated by bioinformatics analysis and dual-luciferase reporter gene assay. Glaucoma-related parameters including the expression of CD11b and iNOS, activation of Muller cells, and apoptosis of retinal ganglion cells (RGCs) in the mouse model were measured by immunohistochemistry, MTT assay and TUNEL assay, respectively. miR-200a was reduced in glaucoma, whereas FGF7 was robustly induced. Thereby, we speculated that FGF7 was negatively regulated by miR-200a. Downregulated miR-200a could activate the MAPK signaling pathway following elevations in ERK, JNK, p38 and Bax expression and reduction in Bcl-2 expression. In the mouse model, downregulated miR-200a increased the expression of CD11b and iNOS and the apoptosis of RGCs, but stimulated the inactivation of Muller cells. However, the above-mentioned alternations induced by downregulated miR-200a were reversed after FGF7 repression. miR-200a can inhibit the FGF7-mediated MAPK signaling pathway and play a protective role on improving the glaucoma-induced optical nerve injury.

Phacoemulsification is a commonly used surgical method in cataract surgery. This paper observes and compares the surgical efficacy of three incisions of different length for phacoemulsification to identify the optimal method for cataract surgery. Ninety patients were enrolled in the present study and divided into three groups. The 1.8-mm group received Bausch & Lomb MI60 foldable intraocular lens (IOL) implantation (n=30), 3.2-mm group received Bausch & Lomb Akreos AO foldable lens implantation (n=30), and 5.5-mm group received Alcon TYPE 05 rigid IOL implantation (n=30). Visual acuity, Oculyzer-based anterior segment analysis, and corneal endothelial cell count before surgery, and 3, 7, 30, and 90d after surgery were recorded and compared. Pseudophakic accommodation three days, one week, one month, and three months after surgery was determined. Intraoperative ultrasound time and ultrasonic energy were recorded. It was finally concluded that for phacoemulsification with the same phaco tip, a 1.8-mm microincision can lead to quicker recovery of visual acuity, more stable astigmatism, and higher pseudophakic accommodation than conventional incision.

Purpose: To understand the prevalence, awareness, and risk factors for diabetic retinopathy (DR) among Chinese with known type-2 diabetes mellitus (T2DM) in eastern China communities.Methods: A community-based survey including 913 patients with known T2DM was conducted in Suzhou, China. Diabetes was defined as hemoglobin A1c (hbA1c) 6.5%, use of diabetic medication or a physician diagnosis of diabetes. Retinal photographs were graded for the presence of DR using the Airlie House classification system. Binary logistic regression models were established to examine the associations of risk factors with DR and vision-threatening diabetic retinopathy (VTDR).Results: The overall prevalence of any DR was 18.0% (95% confidence interval [CI]: 15.5-20.6%) in this population. VTDR affected 4.4% (95% CI: 3.1-5.8%) of the study participants. In multivariate analysis, the presence of DR among T2DM patients was associated with decreased age (odds ratio [OR] = 0.97; p = 0.01; per year increase), longer durations of diabetes (OR = 1.02; per year increase; p = 0.03), higher blood levels of hbA1c (OR = 1.15; per unit increase; p = 0.03). Of the 158 participants with DR, only 12 (8%) had been aware of their condition or had been diagnosed previously as having DR.Conclusions: The prevalence of DR among diabetes patients in eastern China was lower than those in northern China. The awareness of DR was poor, which emphasizes the pressing need for increasing the public awareness of this vision-threatening eye disorder and routine eye screening should be performed among T2DM patients in the communities.

Zeaxanthin at nonlethal dosages (3–10 μM) significantly inhibited the cell migration of cultured uveal melanoma cells (C918 cell line) as determined by wound healing assay and Boyden chamber assay. Matrigel invasion assay showed that cell invasion of uveal melanoma cells could be significantly inhibited by zeaxanthin. Secretion of MMP-2 by melanoma cells was significantly inhibited by zeaxanthin in a dose-dependent manner as measured by ELISA kit. Zeaxanthin also significantly inhibited the NF-κB levels in nuclear extracts of the UM cells, which is the upstream of the MMP-2 secretion. These results suggest that zeaxanthin might be a potentially therapeutic approach in the prevention of metastasis in uveal melanoma.

To assess the association between smoking and pterygium among elderly adults by applying a propensity score matching (PSM) approach and to examine a potential dose-response relationship.The study was designed as a community-based cross-sectional study based on a Chinese cohort aged 60 years or older in China. Anterior segment examination was performed without pupil dilation using a slitlamp. Pterygium was defined as a raised fleshy triangular fibrovascular tissue growth of the conjunctiva encroaching onto the clear cornea. Information regarding smoking history was collected via a structured interviewer-administered questionnaire. The propensity scores for myopia were formulated using seven potential confounders. We matched the propensity scores for smokers and nonsmokers within a caliper of 0.01 of logit function of propensity scores.Slitlamp examination was successfully performed in 4567 adults. The odds ratio of pterygium for cigarette smoking before matching was 0.65 (95% confidence interval, 0.56 to 0.75; p < 0.001). There were significant covariate imbalances between comparison groups, and after PSM, covariate imbalances were significantly reduced. After PSM, the magnitude of association was slightly reduced (odds ratio, 0.70; 95% confidence interval, 0.55 to 0.89; p = 0.004). Adults with more daily cigarette consumption were less likely to be affected by pterygium in multivariate analysis (p for trend = 0.02).Smokers were less likely to be affected by pterygium. The PSM approach may be a useful method to address selection bias in observational studies when randomized trials cannot ethically be conducted.

AIM To investigate the effect of endothelial progenitor cells (EPCs) labeled by carboxy fluorescein diacetate succinimidyl ester (CFSE) on murine oxygen-induced retinopathy (OIR) by intravitreal transplantation. METHODS After isolated from human umbilical cord blood mononuclear cells, EPCs were cultivated and then labeled with CFSE in vitro. C57BL/6J mice were placed to 75% hyperoxia chamber from P7 to P12 to establish OIR model. At P12, OIR mice were intravitreally injected with 1 µL suspension contained 2×105 EPCs (EPCs group) or isometric phosphate buffered saline (PBS group). The contralateral eye of each mice received no injection (OIR group). Evans blue angiography and frozen section were examined to track the labeled cells in OIR group at P15 and P19. Using retina paraffin sections and adenosinediphos phatase staining at P12 and P19, the effect of EPCs on OIR mice was evaluated quantitatively and qualitatively. RESULTS The retinas from EPCs group with less non-perfusion area and fewer peripheral tufts were observed at P19, comparing with that from PBS or OIR group. The retinopathy in EPCs group receded earlier with less non-ganglion cells and neovascular nuclei, together with relatively regular distribution. The counts of the neovascular nuclei at P19 were reduced by 44% or 45%, compared with those of OIR group or PBS group respectively. Three days after EPCs injection, a large number of EPCs appeared in the vitreous cavity and adhered to the retinal surface. While at one week, the cells gathered between the internal plexiform layer and the inner limiting membrane, and some EPCs appeared in retinal vessels. CONCLUSION EPCs transplantation can participate in the reparative procedure of the neovascularization in OIR.

Hesperetin (Hesp), a common flavanone glycoside, was extracted from the fruit peel of Citrus aurantium L. (Rutaceae). Hesp has been shown to possess various biological properties, including antioxidant, neuroprotective, and anti-inflammatory properties. In this study, we investigated the protective effect of Hesp on inflammatory responses in lipopolysaccharide (LPS)-induced RAW 264.7 cells. Our results indicated that Hesp treatment dramatically suppressed secretion of tumor necrosis factor (TNF)-α, interleukin (IL)-6, and IL-1β; reduced inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) gene expression; inhibited NF-κB (p65) phosphorylation; and blocked IκBα phosphorylation and degradation. Further studies revealed Hesp markedly enhanced the heme oxygenase (HO)-1 and nuclear factor erythroid 2-related factor 2 (Nrf2) expression, which were involved with inducing Nrf2 nuclear translocation and decreasing Keap1 protein expression. Together, these results indicated that the anti-inflammatory effect of Hesp may be associated with NF-κB inhibition and Nrf2/HO-1 activation.

We investigated the effect of atorvastatin on vascular endothelial growth inhibitor (VEGI) expression in rats with diabetic retinopathy. Wistar rats were divided into a blank group and diabetic model group, which was further randomly divided into treatment and control groups. Rats in the treatment group received 10 mg/kg atorvastatin daily, while rats in the blank and control groups received normal saline. Rats were randomly euthanized at 3 or 6 months. Immunohistochemical staining was used to determine changes in VEGI and vascular endothelial growth factor, interleukin-4, and tumor necrosis factor α levels in rats with diabetic retinopathy. Survival rate in the treatment group was 84% (63/75) after 6 months, which was significantly higher than that in the control group (P < 0.05); rats in the control group showed the lowest survival rate. Survival in the treatment group was higher than that in the control group but not significant compared with the blank group after 3 months. VEGI, vascular endothelial growth factor, tumor necrosis factor α, and interluekin-4 expression was lower than that in the control group, but higher than the blank group after 3 months. The expression of each factor decreased to the blank group level in the treatment group and was significantly lower than that in the control group after 6 months (P < 0.05). Expression in control and blank groups was similar at 3 and 6 months. Atorvastatin can inhibit VEGI and vascular endothelial growth factor expression to protect rats from diabetic retinopathy.