New approach to the interpretation of the multiplet structure in the Shpol'skii spectra based on the symmetry consideration of the impurity molecule and crystal matrix is proposed. The reasons and peculiarities of doublet structure formation in the spectra of molecules without inversion center and highly symmetric molecules are considered. It is shown that the structure of electron density distribution in the naphthalene molecule causes a doubly degenerate of the electronic level of its ground state. The calculated data are compared with the experimental results. The main research stages and directions in the field of narrow-line spectroscopy of organic molecules are marked.

Professor Galyna Oleksandrivna Puchkovska (22.06.1934–29.09.2010), an outstanding Ukrainian scientist, laureate of the State Prize of Ukraine, and the Honored Worker of Ukraine in Science and Engineering was one of the world-famous specialists in the domains of IR molecular spectroscopy, solid state physics, and phase transformations in crystals with hydrogen bonds.

The 4-pentyl-4′-cyanobiphenyl (5CB) molecule conformation and structure alignment have been investigated by means of temperature variable Fourier transform infrared (FTIR) and photoluminescence (PL) spectroscopy in a wide temperature range (from −90 to 50 °C) covering the 5CB glass-like, metastable and stable crystalline, nematic and isotropic phases defined by differential scanning calorimetry measurements. The corresponding FTIR absorption and PL emission bands reflect a strong dipolar association and a formation of at least two types of 5CB dimeric structures with antiparallel or parallel orientation in the planar configuration. No formation of hydrogen bonds between the cyano groups and hydrogen atoms of the adjacent benzene ring has been found. Besides, a small amount of the 5CB monomer structure has been shown to be present in all phases. The observed temperature-induced changes in the IR and PL spectra can be used as an independent source of experimental information on conformational equilibria and structure alignment of 5CB in different states under the phase transitions.

Results of a comparative analysis of spectral-luminescent properties of crystalline and glassy benzophenone are presented. The main spectral characteristics (frequencies of purely electronic transitions in phosphorescence spectra, band half-widths, relative quantum yields) of glassy benzophenone have been found to possess a number of significant features as compared to the crystalline phase in the temperature range 4.2–220 K. Temperature-dependent structural changes in benzophenone have been studied by differential scanning calorimetry. The ability of phase transitions to appear in benzophenone and their sequences were shown to differ during cooling and heating of the samples. The relationship between the spectral characteristics of various benzophenone phases and their transition temperatures has been demonstrated. Model concepts describing the transport of charge carriers and the transfer of electronic excitation energy in disordered amorphous and glassy molecular systems and information on the glass structural features have been used to explain the experimental results.

We report the results of an experimental study of polymer bulk material Polyamide-6 luminescence properties. A new effect of persistent time-delayed luminescence was revealed at room temperature. Detailed inspection of the effect has shown strong dependence on the microscopic crystalline structure of the polymer. Two morphological forms were recognized with the aid of X-ray Bragg reflection treating. The afterglow with the decay time exceeding 10 seconds was found to appear at about 150 K for the γ-form and is observed at room temperature for the α- form. The temporal dependence of time-delayed luminescence was found to satisfy hyperbolic Becquerel law, thus indicating the recombination origin of the effect. Also, emission realized with the excitation by third optical harmonics of a femtosecond Ti:Sapphire laser (267 nm) at room temperature was examined. The registered luminescence spectra were found quite different for these forms. While γ-form samples exhibit spectrum at the visible region, the α-form emits a pronounced luminescence output in the near UV (340 nm).

The results of experimental investigations on the low-temperature fluorescence and absorption spectra of the 1- and 2-fluoronaphthalene impurities in the crystalline naphthalene are presented and analyzed. When the 1- and 2-fluoronaphthalene concentrations are less than 1%, the absorption and fluorescence spectra are shown to be composed of two identical band series, induced by the formation of two different centers, consisting of the single impurity molecules. The impurity concentration increase of over 1% results in the appearance of the additional structure in the polarized absorption spectra near the 0-0 bands of the single centers in a form of narrow bands with similar intensity and different polarization. This structure is associated with a formation of impurity paired centers, consisting of the two resonantly interacting molecules of either 1-fluoronaphthalene, or 2-fluoronaphthalene. Besides, in the case of the 2-fluoronaphthalene, the absorption spectra contain intense peaks, located ∼ 45 cm−1 higher in frequency, relative to the 0−0 transition bands for each single-center, and consisted of complexes of narrow lines. These spectral peaks are also explained by a formation of impurity paired centers, but here interactions between the molecules are not resonant. For the pure naphthalene crystal factors, causing the observation of additional oppositely polarized weak bands in the absorption spectra at ∼ 10 cm−1 near the Davydov doublet components, are described.

The work contains the analysis of possible distributions of aerosol impurities through the glacier depth in those regions of Antarctica, where synoptic maps have shown stabilization of cyclones; and based on this analysis a methodology has been proposed for the determination of climatic parameter changes (average temperature and atmospheric precipitation amount) over a long time period. The main sources of the impurities in the glaciers of Antarctica are marine and continental aerosols, carried by meridional circulation of air masses. The annual concentration of chemical impurities, carried from both ocean and continent, and fallen on the glacier with rain or snow, is approximately the same over a long time period, if the glacier is located in a region of stable cyclonic activity. In this case, for the analysis, ice cores are taken continuously through the glacier depth. Linear sizes of all samples are similar. The quantity of annual layers in the sample is determined based on the age of the lower and upper levels in the glacier, from where the sample is taken. The thickness of the annual ice layer in the glacier is determined by the amount of fallen atmospheric precipitation and ablation processes. Consequently, all samples correspond to the periods of both equal and different durability. The quantity of annual layers in the sample (n) characterizes the amount of atmospheric precipitation of the corresponding period. Changes in the impurity concentrations from sample to sample are connected with the relative change in temperature of the corresponding periods. Then the two parameters, the number of annual layers, n, and the layer impurity content, C, have been determined experimentally in each sample. Based on these two parameters, a new technique has been proposed that allows determination of approximate temperature and precipitation changes over the time period, equal to the age of the studied glacier.

This work relates to the study of vibrational structures in the electron spectra of naphthalene crystals with impurities of b- and a-naphthalene fluorine with concentrations of 10^−4 to 10 wt.% at a temperature at 4.2 K. It is determined that, at low impurity concentrations, the spectra have a doublet structure and consist of narrow quasilines with initial values of v01 = 31322 cm^−1 and v02 = 31226 cm^−1, which are resonance-coincident in the absorption and fluorescence spectra. It is demonstrated that if the impurity concentration increases, the series of narrow quasilines appear in the areas of the 0-0 transitions of the impurity centers of both types together with the doublet structure. A part of these quasilines is polarized predominantly along the b-axis of a naphthalene crystal. The model is proposed for impurity centers, which induce the generation of new spectral bands. This model is based on the interaction of translation-nonequivalent impurity molecules in the elementary lattice cell of a naphthalene crystal. At high impurity concentrations, the resonance-symmetric wide spectral bands appear in the absorption and fluorescence spectra. The analysis of the results obtained is performed with consideration for the Franck–Condon interaction and the Herzberg–Teller interaction.

The spectral-luminescence properties of the 4-cyano-4'-pentylbiphenyl CH 3 (CH 2 ) 4 (C 6 H 4 ) 2 CN (5CB) liquid crystal has been studied in the temperature range 4.2-297 K. It is shown that at increasing temperature the fluorescence spectra are shifted to the red side. The spectral long-wavelength shifts are also analyzed. A comparison of the temperature behaviour position of the emission of the band maxima l max and their half-widths Δl/2 in the fluorescence spectra and the results of the DSC-investigation show that phase transitions occur in 5CB liquid crystals at T ~ 230 and 260 K.

The effects of the 5CB liquid crystal (LC) cooling regimes on its luminescence spectra at the low temperature (T=4.2 K) have been found out and investigated. Experiments have been carried out at two cooling rates: 2 and 150deg/min. Differential scanning calorimetry (DSC) data allow us to establish that the 5CB glass-like state (GLS) is formed during the rapid cooling of the sample. Peculiarities of the LC dimer formation under the different cooling conditions are discussed.

The spectroluminescence properties of 4cyano4'pentylbiphenyl CH 3 (CH 2 ) 4 (C 6 H 4 ) 2 CN (5CB) were studied in the temperature range 4.2–297 K. A red shift of the fluorescence spectrum was noted with increasing temperature. The long-wavelength shifts in these spectra were also analyzed. Comparison of the temperature dependence curves for the emission at the band maxima λ max and their halfwidths Δλ/2 in the fluorescence spectra and the results of a differential scanning calorimetry (DSC) study showed that phase transitions occur in the 5CB liquid crystals at ~230 and ~260 K.

We investigated the photoluminescent properties of nanocomposites based on the liquid crystal (LC) 5CB filled with dispersed inorganic particles, such as carbon nanotubes (CNT), montmorillonite mineral platelets (MMT) and titanium dioxide nanotubes TiO 2 (TNT), in the temperature range 4.2-300 K. The IR absorption spectra of these composites were studied in the spectral range 390-4000 cm - 1 at room temperature. The composite luminescent properties depending on the physical properties of the nanoparticles were considered. The long-wavelength shifts of the composites luminescence spectra according to the 5CB spectrum were defined by the magnitude of the nanoparticles specific surface. The spectral long-wavelength shifts at room and low temperatures were analyzed.

We have studied the influence of inorganic particles on the photoluminescent properties of the nematic liquid crystal 5CB in composites based on carbon nanotubes (CNTs) and hybrid nanoparticles consisting of carbon nanotubes and platelets of the organically modified mineral montmorillonite (MMT). We show that the photoluminescence (PL) of 5CB + CNT composites is characterized by excimer emission of the 5CB molecules. Adding carbon nanotubes to the liquid crystal medium leads to a considerable decrease in the photoluminescence intensity, but has practically no effect on the bulk structural alignment in the organic matrix. Hybrid CNT–MMT particles form a uniform coagulation network in the composite with 5CB and significantly disrupt the nematic structure of the liquid crystal. Bent conformations of the 5CB molecules appear which are typical of the liquid crystal monomers. The presence of the indicated 5CB conformers in the system and also the weaker interaction between the liquid crystal and the inorganic filler explain the increase in the photoluminescence intensity for the composite 5CB + CNT–MMT compared with the emission characteristics for the original liquid crystal.

The luminescence spectral characteristics of nanocomposites based on the 5CB liquid crystal with dispersions of inorganic particles of carbon nanotubes (CNTs), the mineral montmorillonite (MMT), and nanotubes of titanium dioxide TiO2 (TNT) were investigated in the temperature range of 4.3–300 K. The IR absorption spectra of the composites at room temperature in the region of 390–4000 cm−1 were studied. The dependence of the luminescent properties of the composites on the physical properties and parameters of the nanoparticles was studied. It was established that the longwave shift of the luminescence spectra of the composites in relation to the spectra of the pure liquid crystal is related to the specific surface area of the nanoparticles. The longwave shifts of the spectra at room and low temperatures are analyzed.

Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomeres is associated mainly with G-bases and other long-wave centers, possibly G-quadruplex structures, whereas their phosphorescence is associated with AT-sequences as it takes place for the native DNA. A significant increase of phosphorescence-to-fluorescence intensity ratio was observed for Tel22 as compared to DNA. Results obtained are promising for the detection of DNA macromolecules containing the extended telomeric sequences.

Specific temperature dependences (10-300 K) of the emission band maximum, its intensity and half-width in the luminescence spectra of 5CB liquid crystals and 5CB+ carbon nanotube nanocomposites are observed. The analysis of the luminescence spectra and thermal properties of the studied systems has shown that the observed features are due to polymorphic transformation of 5CB and conformational changes of its molecules.

The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240-300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 degrees C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands).

Spectral and photophysical properties of several phenalenone dyes were investigated in dependence on the type of polyurethane polymer matrix. The increase in polarity of the solid-state medium was shown to shift absorption and luminescence to the low energy side. Structural effects of the substituents in the phenalenone chromophore on the Stokes shift value were studied. Photophysical properties of phenalenones were found out to be significantly dependent on polymerization method of the polymer matrices. Considerable growth in photostability of the organic dyes was obtained under their covalent bonding with the polymer chain.