The genomic sequences of 20 Leishmania infantum isolates collected in northeastern Brazil were compared with each other and with the available genomic sequences of 29 L. infantum/donovani isolates from Nepal and Turkey. The Brazilian isolates were obtained in the early 1990s or since 2009 from patients with visceral or non-ulcerating cutaneous leishmaniasis, asymptomatic humans, or dogs with visceral leishmaniasis. Two isolates were from the blood and bone marrow of the same visceral leishmaniasis patient. All 20 genomic sequences display 99.95% identity with each other and slightly less identity with a reference L. infantum genome from a Spanish isolate. Despite the high identity, analysis of individual differences among the 32 million base pair genomes showed sufficient variation to allow the isolates to be clustered based on the primary sequence. A major source of variation detected was in chromosome somy, with only four of the 36 chromosomes being predominantly disomic in all 49 isolates examined. In contrast, chromosome 31 was predominantly tetrasomic/pentasomic, consistent with its regions of synteny on two different disomic chromosomes of Trypanosoma brucei. In the Brazilian isolates, evidence for recombination was detected in 27 of the 36 chromosomes. Clustering analyses suggested two populations, in which two of the five older isolates from the 1990s clustered with a majority of recent isolates. Overall the analyses do not suggest individual sequence variants account for differences in clinical outcome or adaptation to different hosts. For the first known time, DNA of isolates from asymptomatic subjects were sequenced. Of interest, these displayed lower diversity than isolates from symptomatic subjects, an observation that deserves further investigation with additional isolates from asymptomatic subjects.

ABSTRACTThe infectious metacyclic promastigotes ofLeishmaniaprotozoa establish infection in a mammalian host after they are deposited into the dermis by a sand fly vector. SeveralLeishmaniavirulence factors promote infection, including the glycosylphosphatidylinositol membrane-anchored major surface protease (MSP). MetacyclicLeishmania infantum chagasipromastigotes were treated with methyl-beta-cyclodextrin (MβCD), a sterol-chelating reagent, causing a 3-fold reduction in total cellular sterols as well as enhancing MSP release without affecting parasite viabilityin vitro. MβCD-treated promastigotes were more susceptible to complement-mediated lysis than untreated controls and reduced the parasite load 3-fold when inoculated into BALB/c mice. Paradoxically, MβCD-treated promastigotes caused a higher initialin vitroinfection rate in human or murine macrophages than untreated controls, although their intracellular multiplication was hindered upon infection establishment. There was a corresponding larger amount of covalently bound C3b than iC3b on the parasite surfaces of MβCD-treated promastigotes exposed to healthy human serumin vitro, as well as loss of MSP, a protease that enhances C3b cleavage to iC3b. Mass spectrometry showed that MβCD promotes the release of proteins into the extracellular medium, including both MSP and MSP-like protein (MLP), from virulent metacyclic promastigotes. These data support the hypothesis that plasma membrane sterols are important for the virulence ofLeishmaniaprotozoa at least in part through retention of membrane virulence proteins.

Background: Acquired antibodies are important in human immunity to malaria, but key targets remain largely unknown. Plasmodium falciparum reticulocyte-binding-homologue-4 (PfRh4) is important for invasion of human erythrocytes and may therefore be a target of protective immunity.Methods: IgG and IgG subclass-specific responses against different regions of PfRh4 were determined in a longitudinal cohort of 206 children in Papua New Guinea (PNG). Human PfRh4 antibodies were tested for functional invasion-inhibitory activity, and expression of PfRh4 by P. falciparum isolates and sequence polymorphisms were determined.Results: Antibodies to PfRh4 were acquired by children exposed to P. falciparum malaria, were predominantly comprised of IgG1 and IgG3 subclasses, and were associated with increasing age and active parasitemia. High levels of antibodies, particularly IgG3, were strongly predictive of protection against clinical malaria and high-density parasitemia. Human affinity-purified antibodies to the binding region of PfRh4 effectively inhibited erythrocyte invasion by P. falciparum merozoites and antibody levels in protected children were at functionally-active concentrations. Although expression of PfRh4 can vary, PfRh4 protein was expressed by most isolates derived from the cohort and showed limited sequence polymorphism.Conclusions: Evidence suggests that PfRh4 is a target of antibodies that contribute to protective immunity to malaria by inhibiting erythrocyte invasion and preventing high density parasitemia. These findings advance our understanding of the targets and mechanisms of human immunity and evaluating the potential of PfRh4 as a component of candidate malaria vaccines.

The protozoan parasite Trypanosoma brucei switches its variant surface glycoprotein (VSG) to subvert its mammalian hosts' immune responses. The T. brucei genome contains as many as 1600 VSG genes (VSGs), but most are silent noncoding pseudogenes. Only one functional VSG, located in a telomere-linked expression site, is transcribed at a time. Silent VSGs are copied into a VSG expression site through gene conversion. Truncated gene conversion events can generate new mosaic VSGs with segments of sequence identity to other VSGs. To examine the VSG family sub-structure within which these events occur, we combined the available VSG sequences and annotations with scripted BLAST searches to map the relationships among VSGs in the T. brucei genome. Clusters of related VSGs were visualized in 2- and 3-dimensions for different N- and C-terminal regions. Five types of N-termini (N1-N5) were observed, within which gene recombinational events are likely to occur, often with fully-coding 'functional' or 'atypical'VSGs centrally located between more dissimilar VSGs. Members of types N1, N3 and N4 are most closely related in the middle of the N-terminal region, whereas type N2 members are more similar near the N-terminus. Some preference occurs in pairing between specific N- and C-terminal types. Statistical analyses indicated no overall tendency for more related VSGs to be located closer in the genome than less related VSGs, although exceptions were noted. Many potential mosaic gene formation events within each N-terminal type were identified, contrasted by only one possible mosaic gene formation between N-terminal types (N1 and N2). These data suggest that mosaic gene formation is a major contributor to the overall VSG diversity, even though gene recombinational events between members of different N-terminal types occur only rarely.

Trypanosoma congolense is an important pathogen of livestock in Africa. To study protein expression throughout the T. congolense life cycle, we used culture-derived parasites of each of the three main insect stages and bloodstream stage parasites isolated from infected mice, to perform differential protein expression analysis. Three complete biological replicates of all four life cycle stages were produced from T. congolense IL3000, a cloned parasite that is amenable to culture of major life cycle stages in vitro. Cellular proteins from each life cycle stage were trypsin digested and the resulting peptides were labeled with isobaric tags for relative and absolute quantification (iTRAQ). The peptides were then analyzed by tandem mass spectrometry (MS/MS). This method was used to identify and relatively quantify proteins from the different life cycle stages in the same experiment. A search of the Wellcome Trust's Sanger Institute's semi-annotated T. congolense database was performed using the MS/MS fragmentation data to identify the corresponding source proteins. A total of 2088 unique protein sequences were identified, representing 23% of the ∼9000 proteins predicted for the T. congolense proteome. The 1291 most confidently identified proteins were prioritized for further study. Of these, 784 yielded annotated hits while 501 were described as “hypothetical proteins”. Six proteins showed no significant sequence similarity to any known proteins (from any species) and thus represent new, previously uncharacterized T. congolense proteins. Of particular interest among the remainder are several membrane molecules that showed drastic differential expression, including, not surprisingly, the well-studied variant surface glycoproteins (VSGs), invariant surface glycoproteins (ISGs) 65 and 75, congolense epimastigote specific protein (CESP), the surface protease GP63, an amino acid transporter, a pteridine transporter and a haptoglobin–hemoglobin receptor. Several of these surface disposed proteins are of functional interest as they are necessary for survival of the parasites.

The Leishmania species cause a variety of human disease syndromes. Methods for diagnosis and species differentiation are insensitive and many require invasive sampling. Although quantitative PCR (qPCR) methods are reported for leishmania detection, no systematic method to quantify parasites and determine the species in clinical specimens is established. We developed a serial qPCR strategy to identify and rapidly differentiate Leishmania species and quantify parasites in clinical or environmental specimens. SYBR green qPCR is mainly employed, with corresponding TaqMan assays for validation. The screening primers recognize kinetoplast minicircle DNA of all Leishmania species. Species identification employs further qPCR set(s) individualized for geographic regions, combining species-discriminating probes with melt curve analysis. The assay was sufficient to detect Leishmania parasites, make species determinations, and quantify Leishmania spp. in sera, cutaneous biopsy specimens, or cultured isolates from subjects from Bangladesh or Brazil with different forms of leishmaniasis. The multicopy kinetoplast DNA (kDNA) probes were the most sensitive and useful for quantification based on promastigote standard curves. To test their validity for quantification, kDNA copy numbers were compared between Leishmania species, isolates, and life stages using qPCR. Maxicircle and minicircle copy numbers differed up to 6-fold between Leishmania species, but the differences were smaller between strains of the same species. Amastigote and promastigote leishmania life stages retained similar numbers of kDNA maxi- or minicircles. Thus, serial qPCR is useful for leishmania detection and species determination and for absolute quantification when compared to a standard curve from the same Leishmania species.

Leishmania spp. protozoa are obligate intracellular parasites that replicate in macrophages during mammalian infection. Efficient phagocytosis and survival in macrophages are important determinants of parasite virulence. Macrophage lines differ dramatically in their ability to sustain intracellular Leishmania infantum chagasi (Lic). We report that the U937 monocytic cell line supported the intracellular replication and cell-to-cell spread of Lic during 72 h after parasite addition, whereas primary human monocyte-derived macrophages (MDMs) did not. Electron microscopy and live cell imaging illustrated that Lic promastigotes anchored to MDMs via their anterior ends and were engulfed through symmetrical pseudopods. In contrast, U937 cells bound Lic in diverse orientations, and extended membrane lamellae to reorient and internalize parasites through coiling phagocytosis. Lic associated tightly with the parasitophorous vacuole (PV) membrane in both cell types. PVs fused with LAMP-1-expressing compartments 24 h after phagocytosis by MDMs, whereas U937 cell PVs remained LAMP-1 negative. The expression of one phagocytic receptor (CR3) was higher in MDMs than U937 cells, leading us to speculate that parasite uptake proceeds through dissimilar pathways between these cells. We hypothesize that the mechanism of phagocytosis differs between primary versus immortalized human macrophage cells, with corresponding differences in the subsequent intracellular fate of the parasite.

The parasitic protozoan, Leishmania, survives in harsh environments within its mammalian and sand fly hosts. Secreted proteins likely play critical roles in the parasite's interactions with its environment. As a preliminary identification of the spectrum of potential excreted/secreted (ES) proteins of Leishmania infantum chagasi (Lic), a causative agent of visceral leishmaniasis, we used standard algorithms to screen the annotated L. infantum genome for genes whose predicted protein products have an N-terminal signal peptide and lack transmembrane domains and membrane anchors. A suite of 181 candidate ES proteins were identified. These included several that were documented in the literature to be released by other Leishmania spp. Six candidate ES proteins were selected for further validation of their expression and release by different parasite stages. We found both amastigote-specific and promastigote-specific released proteins. The ES proteins of Lic are candidates for future studies of parasite virulence determinants and host protective immunity.

PURPOSE:About two million new cases of leishmaniasis with 50 000 associated deaths occur worldwide each year. Promastigotes of the causative Leishmania spp. develop from the procyclic stage to the highly virulent metacyclic stage within the sand fly vector. We hypothesized that proteins important for promastigote virulence might be uniquely represented in the plasma membrane of metacyclic, but not procyclic, promastigotes. EXPERIMENTAL DESIGN:Procyclic (logarithmic) promastigotes and purified metacyclic promastigotes from stationary phase cultures of Leishmania chagasi were used to prepare membrane preparations either by surface biotinylation-streptavidin affinity separation or by octyl glucoside detergent extraction. RESULTS:These membrane fractions were enriched over 130- and 250-fold, respectively, as estimated by Western blotting for the plasma membrane's major surface protease. Hundreds or dozens of proteins were identified by LC-MS/MS in the surface biotinylation or detergent extraction, respectively. Confocal microscopy suggested the difference between the lists was due to the fact that proteins localized both on the surface membrane and within the flagellar pocket were accessible to surface biotinylation, whereas only proteins on the membrane were obtained by detergent extraction. Using detergent extraction, we found different proteins were present in membranes of the procyclic stage compared to metacyclic stage promastigotes. Several dozen were stage specific. CONCLUSIONS AND CLINICAL RELEVANCE:These data provide a foundation for identifying virulence factors in the plasma membranes of Leishmania spp. promastigotes during metacyclogenesis.

During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3'-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3'-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3'-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3'-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation.

Trypanosoma congolense is one of the most economically important pathogens of livestock in Africa. Culture-derived parasites of each of the three main insect stages of the T. congolense life cycle, i.e., the procyclic, epimastigote and metacyclic stages, and bloodstream stage parasites isolated from infected mice, were used to construct stage-specific cDNA libraries and expressed sequence tags (ESTs or cDNA clones) in each library were sequenced. Thirteen EST clusters encoding different variant surface glycoproteins (VSGs) were detected in the metacyclic library and 26 VSG EST clusters were found in the bloodstream library, 6 of which are shared by the metacyclic library. Rare VSG ESTs are present in the epimastigote library, and none were detected in the procyclic library. ESTs encoding enzymes that catalyze oxidative phosphorylation and amino acid metabolism are about twice as abundant in the procyclic and epimastigote stages as in the metacyclic and bloodstream stages. In contrast, ESTs encoding enzymes involved in glycolysis, the citric acid cycle and nucleotide metabolism are about the same in all four developmental stages. Cysteine proteases, kinases and phosphatases are the most abundant enzyme groups represented by the ESTs. All four libraries contain T. congolense-specific expressed sequences not present in the Trypanosoma brucei and Trypanosoma cruzi genomes. Normalized cDNA libraries were constructed from the metacyclic and bloodstream stages, and found to be further enriched for T. congolense-specific ESTs. Given that cultured T. congolense offers an experimental advantage over other African trypanosome species, these ESTs provide a basis for further investigation of the molecular properties of these four developmental stages, especially the epimastigote and metacyclic stages for which it is difficult to obtain large quantities of organisms. The T. congolense EST databases are available at: http://www.sanger.ac.uk/Projects/T_congolense/EST_index.shtml. The sequence data have been submitted to EMBL under the following accession numbers: FN263376-FN292969.

Homogenous metacyclic promastigotes of Leishmania chagasi were isolated by buoyant density from in vitro heterogeneous cultures and used for biochemical characterization of isoforms of the major surface protease (MSP). Compared to stationary phase promastigotes, metacyclic cells had three times more MSP, produced 3-fold higher parasite loads in a mouse model in vivo, and were more resistant to complement-mediated lysis in vitro. These metacyclic L. chagasi expressed both the virulence-associated 59-kDa, and the constitutively expressed 63-kDa, isoforms of MSP.

Most trypanosomatid genes are transcribed into polycistronic precursor RNAs that are processed into monocistronic mRNAs possessing a 39-nucleotide spliced leader (SL) at their 5′-ends and polyadenylation at their 3′-ends. We show here that precursor RNA derived from a luciferase gene integrated in reverse orientation at the rDNA locus of Trypanosoma brucei is processed into three major SL-containing RNAs in bloodstream cells and a single SL-containing RNA in procyclic RNAs. This difference in trans RNA splicing between bloodstream and procyclic cells is independent of the 5′- and 3′-UTRs flanking the luciferase coding region. Thus, bloodstream cells can recognize some sequences in precursor RNA as a SL addition site that procyclic cells do not. These alternative SL addition sites may be aberrant or they might be utilized to expand the number of gene products from individual genes. Future experiments on endogenous genes will be necessary to examine the latter possibility.

The Leishmania spp. protozoa have an abundant surface metalloprotease called MSP (major surface protease), which in Leishmania chagasi is encoded by three distinct gene classes (MSPS, MSPL, MSPC). Although MSP has been characterized primarily in extracellular promastigotes, it also facilitates survival of intracellular amastigotes. Promastigotes express MSPS, MSPL, and two forms of MSPC RNAs, whereas amastigotes express only MSPL RNA and one MSPC transcript. We confirmed the presence of MSPC protein in both promastigotes and amastigotes by liquid chromatography–tandem mass spectrometry (LC–MS/MS). More than 10 MSP isoforms were visualized in both amastigotes and promastigotes using two-dimensional immunoblots, but amastigote MSPs migrated at a more acidic pI. Promastigote MSPs were N-glycosylated, whereas most amastigote MSPs were not. Immuno-electron microscopy showed that two-thirds of the promastigote MSP is distributed along the cell surface. In contrast, most amastigote MSP localized at the flagellar pocket, the major site of leishmania endocytosis/exocytosis. Biochemical analyses indicated that most amastigote MSP is soluble in the cytosol, vesicles or organelles, whereas most promastigote MSP is membrane-associated and GPI anchored. Activity gels and immunoblots confirmed the presence of a novel proteolytically active amastigote MSP of higher Mr than the promastigote MSPs. Furthermore, promastigote MSP is shed extracellularly whereas MSP is not shed from axenic amastigotes. We conclude that amastigotes and promastigotes both express multiple MSP isoforms, but these MSPs differ biochemically and localize differently in the two parasite stages. We hypothesize that MSP plays different roles in the extracellular versus intracellular forms of Leishmania spp.

In the realm of tropical diseases, African trypanosomiasis has always offered researchers glamor, drama, and mystery. Numerous physicians have written accounts of their adventures amid the jungles, savannas, and coasts of equatorial Africa in their quest for a cure for sleeping sickness. Symptoms — caused by the African trypanosome, a single-celled parasite, and its transmission vector, the tsetse fly — arise mysteriously, and epidemics can start without warning. More than a century of research on trypanosomiasis has shown that the parasite is one of the most sophisticated pathogens ever to have evolved. In The fatal sleep: Africa’s killer disease that went undiscovered for centuries, Peter Kennedy presents a memoir about his fascination with this illness. His goal, he says in the preface, is “to tell the nonscientist about the history and profound importance of human African trypanosomiasis.” To achieve this goal, he relates his career experiences, first as a medical student in London, later as a clinical neurologist, and most importantly, as a researcher who, at the time of writing, had made 18 trips to Africa to study this disease. Many of his anecdotes, while not always specific to his disease-related research, offer portraits of his training as a physician-scientist and his experiences in Africa — the best of which relate his adventures in Zambia, Uganda, and Kenya. The reader will appreciate the author’s difficulty in rendering scientific ideas, particularly experimental results, into nonscientific language, which sometimes results in an uneven voice. As Kennedy tells it, a thousand years ago a physician in Sudan reported a human disease characterized by fatal lethargy that seemed to be linked to the deaths of camels and horses. In 1771, naval surgeon John Atkins described a similar illness among natives of Guinea, where patients lingered unto death with “sleepy distemper.” In 1803, physician Thomas Winterbottom noted in Sierra Leone that slaves with swollen posterior cervical lymph nodes — now known as Winterbottom’s sign — could not be traded. The inveterate physician-explorer David Livingston, who tested in horses a cure for animal trypanosomiasis, published a letter in the British Medical Journal in May 1858 titled “Arsenic as a remedy for the tsetse fly bite.” The disease first received international attention when an epidemic broke out at the end of the nineteenth century near Lake Victoria in present-day Uganda. Physician-scientists rushed to find preventions and cures that would protect both European colonists and their African workers. Kirk Arden Hoppe, in his book Lords of the fly (1), describes a “circus” of professional interest in sleeping sickness at the beginning of the twentieth century that eventually led to mass relocation of Africans out of tsetse fly–infested areas. Large areas of vegetation were burned in hopes of eliminating the tsetse fly, vast numbers of game were killed to extinguish the reservoir, and humans were forbidden to occupy emptied territories. Today, epidemic trypanosomiasis occurs primarily where populations are disrupted by war, famine, and unrest. Two subspecies of African trypanosomes present slightly different courses of disease. Trypanosoma brucei gambiense in west and central Africa leads to a more indolent, but equally fatal, disease lasting months to years, whereas T. b. rhodesiense in east Africa is fatal within 3–4 months. The disease begins with itching, fever, skin chancre and/or rash, and malaise. Diagnosis is made by identifying parasites in the blood or spinal fluid or by the card agglutination trypanosomiasis test (CATT). Progressive disease leads to disturbances in personality, visual problems, and a variety of CNS symptoms (including sleep abnormalities and profound lethargy), followed by death. DNA analysis suggests that African trypanosomes have evolved over 100 million years, including 3 million years in tandem with humans. The parasite evades the host immune system by changing its protein coat in a process known as antigenic variation. Such a change occurs as often as every 2 weeks and seems to preclude development of a vaccine. The disease is said to kill at least 50,000 people every year. More than 60 million people in sub-Saharan Africa are currently at risk for trypanosomiasis, with severe pockets of illness in the Central African Republic, Uganda, Angola, Congo-Kinshasa, and Sudan. As Kennedy points out, treatment options are few. A toxic arsenical administered intravenously is still used to treat late-stage disease; however, the treatment itself proves fatal in 1 of 20 patients. A concise review article by Peter Kennedy on human sleeping sickness appeared in the JCI in 2004 (2). His book, as a memoir of a life in trypanosomiasis research, calls much-needed attention to a widespread disease of poor and isolated Africans, for whom pharmaceutical companies should spend more time developing therapeutic drugs. Notably, 50% of the author’s royalties from sales of this book will be donated to charities devoted to sleeping sickness research and human health in Africa.

Trypanosomatid protozoa lack consensus promoters for RNA polymerase (RNAP) II. However, the artificial insertion of the T7 promoter (P(T7)) and the tetracycline repressor into Trypanosoma brucei cell lines expressing T7RNAP allows P(T7)-driven gene expression to be tetracycline-inducible. These cell lines provide a molecular tool to address protein function by several recombinant approaches. We describe here the development of an analogous Leishmania chagasi cell line bearing the genes for exogenous T7RNAP and the tetracycline repressor inserted in the multi-gene alpha-tubulin locus. A plasmid construct with P(T7) and the tetracycline operator upstream of a reporter gene, when introduced into this cell line as episomal plasmids or chromosomal insertion into the non-coding strand of an 18SrRNA gene, resulted in tetracycline-inducible expression of the reporter as much as 16- and 150-fold, respectively. The reporter was under a much tighter control when chromosomally inserted than extra-chromosomally born. Furthermore, P(T7) augmented the reporter's expression 2-fold more in comparison to P(T7)-less constructs. This cell line is the first Leishmania spp. that allows the exogenous T7RNAP-driven gene expression to be tetracycline-inducible; and may provide a useful tool for addressing protein function by manipulating expression levels of Leishmania endogenous genes.

ABSTRACTMajor surface protease (MSP), also called GP63, is a virulence factor ofLeishmaniaspp. protozoa. There are three pools of MSP, located either internally within the parasite, anchored to the surface membrane, or released into the extracellular environment. The regulation and biological functions of these MSP pools are unknown. We investigated here the trafficking and extrusion of surface versus internal MSPs. VirulentLeishmania chagasiundergo a growth-associated lengthening in thet1/2of surface-localized MSP, but this did not occur in the attenuated L5 strain. The release of surface-localized MSP was enhanced in a dose-dependent manner by MβCD, which chelates membrane cholesterol-ergosterol. Furthermore, incubation of promastigotes at 37°C with Matrigel matrix, a soluble basement membrane extract of Engelbreth-Holm-Swarm tumor cells, stimulated the release of internal MSP but not of surface-located MSP. Taken together, these data indicate that MSP subpopulations in distinct cellular locations are released from the parasite under different environmental conditions. We hypothesize that the internal MSP with its lengthyt1/2does not serve as a pool for promastigote surface MSP in the sand fly vector but that it instead functions as an MSP pool ready for quick release upon inoculation of metacyclic promastigotes into mammals. We present a model in which these different MSP pools are released under distinct life cycle-specific conditions.

MSP is a virulence factor of Leishmania spp. protozoa, which cause the human disease, leishmaniasis. MSP is a surface metalloprotease encoded by three distinct gene classes in Leishmania chagasi (MSPL, MSPS and MSPC). Although MSP was discovered and characterized in the extracellular promastigote stage, there is evidence that it facilitates intracellular survival of the amastigote stage. We compared MSP protein isoforms of axenic L. chagasi amastigotes with those of promastigotes. Immuno‐electron microscopy showed 2/3 of total promastigote MSP is localized on the surface and 1/3 is intracellular. In contrast, most amastigote MSP is intracellular and localized at the flagellar pocket, the major site of endocytosis/exocytosis in leishmania. Alkaline carbonate treatment and high‐salt washing indicated that the majority of amastigote MSP is cytosolic with a minor luminal component, whereas most promastigote MSP is anchored in the surface membrane. Protease gels showed that both forms of the parasites synthesize metalloproteases, active at pH7.9 and 5.5. We conclude that intracellular L. chagasi amastigotes express multiple MSP isoforms similar to promastigotes, but amastigote MSPs differ from promastigote MSPs biochemically, and localize differently in the parasite cell. These observations suggest the abundant MSP protease plays different roles in the extracellular versus intracellular environment.