Safe and effective vaccines against co-circulating mosquito-borne orthoflaviviruses such as Zika virus (ZikV) and the four serotypes of Dengue virus (DenV1-4) must elicit broadly neutralizing antibodies (bnAbs) to prevent the risk of enhancement of infection by non-neutralizing antibodies. We recently discovered new orthoflavivirus-directed bnAbs, including F25.S02, which neutralizes DenV1-4 and ZikV with comparable or superior potency to the previously characterized E dimer epitope (EDE) bnAbs. Mutagenesis studies of viral envelope proteins showed that the epitope specificity of F25.S02 is distinct from EDE1 bnAbs. Here, we used cryoEM and X-ray crystallography to understand the basis of cross-neutralization of F25.S02 at the molecular level. We obtained a ~4.2 Å cryoEM structure of F25.S02 Fab bound to a stabilized DenV3 soluble E protein dimer and a 2.3 Å crystal structure of F25.S02 Fab bound to ZikV soluble E protein dimer. Like previously described EDE1 bnAbs, the structural epitope of F25.S02 is at the E dimer interface, encompassing predominantly conserved regions in domain II, including the fusion loop. However, unlike EDE1 bnAbs, F25.S02 binding is almost entirely dependent on the heavy chain and is shifted slightly away from the dimer symmetry axis. Our findings emphasize the importance of this cross-neutralizing site of vulnerability for DenV and ZikV that can facilitate rational design of vaccines and therapeutics.

Dengue virus (DENV) is a global disease threat with tropical regions bearing the bulk of disease burden. Presence of four DENV serotypes with varying antigenicity has complicated development of effective, pan-serotype strategies for prevention and treatment of dengue disease. Here, we report single-particle cryo-electron microscopy (cryo-EM) structures of DENV in complex with three human-derived broadly neutralizing antibodies (bnAbs), revealing an antibody class which preferentially uses its heavy chain for potency and antigen recognition. These heavy chain-driven E-dimer recognizing (HEDR) bnAbs potently neutralize all DENV serotypes by binding to a quaternary epitope encompassing the critical fusion loop and conserved glycans on DENV surface E-glycoprotein dimer. We also demonstrate the presence of capsule-shaped DENV, with HEDR antibodies binding such tubular morphologies in addition to spherical virions. Cryo-EM helical reconstructions of Fab-bound tubular virions from different DENV strains establishes that the pattern of E-glycoproteins helical arrangement is dependent solely on the virus strain. The structural data also demonstrate that binding of highly potent HEDR bnAb D14.F25.S02 causes distortion of DENV particles. Collectively, these results elucidate key features of HEDR bnAbs while illustrating the importance of eliciting immune responses that can neutralize diverse DENV morphologies. ### Competing Interest Statement The authors have declared no competing interest. Wellcome Trust/DBT India Alliance, https://ror.org/04reqzt68, IA/I/22/1/506233 Science and Engineering Research Board, https://ror.org/03ffdsr55, SPG/2021/002433

Antibodies targeting an envelope dimer epitope (EDE) cross-neutralize Zika virus (ZIKV) and dengue virus (DENV) and have thus inspired an epitope-focused vaccine design. There are two EDE antibody subclasses (EDE1, EDE2) distinguished by their dependence on viral envelope protein N-linked glycosylation at position N153 (DENV) or N154 (ZIKV) for binding. Here, we determined how envelope glycosylation site mutations affect neutralization by EDE and other broadly neutralizing antibodies. Consistent with structural studies, mutations abolishing the N153/N154 glycosylation site increased DENV and ZIKV sensitivity to neutralization by EDE1 antibodies. Surprisingly, despite their location at predicted contact sites, these mutations also increased sensitivity to EDE2 antibodies. Moreover, despite preserving the glycosylation site motif (N-X-S/T), substituting the threonine at ZIKV envelope residue 156 with a serine resulted in loss of glycan occupancy accompanied with increased neutralization sensitivity to EDE antibodies. For DENV, the presence of a serine instead of a threonine at envelope residue 155 retained glycan occupancy, but nonetheless increased sensitivity to EDE antibodies, in some cases to a similar extent as mutation at N153, which abolishes glycosylation. Envelope glycosylation site mutations also increased ZIKV and DENV sensitivity to other non-EDE broadly neutralizing antibodies, but had limited effects on ZIKV- or DENV-specific antibodies. Thus, envelope protein glycosylation is context-dependent and modulates the potency of broadly neutralizing antibodies in a manner not predicted by existing structures. Manipulating envelope protein glycosylation could be a novel strategy for engineering vaccine antigens to elicit antibodies that broadly neutralize ZIKV and DENV.IMPORTANCEAntibodies that potently cross-neutralize Zika (ZIKV) and dengue (DENV) viruses are attractive to induce via vaccination to protect against these co-circulating flaviviruses. Structural studies have shown that viral envelope protein glycosylation is important for binding by one class of these so-called broadly neutralizing antibodies, but less is known about its effect on neutralization. Here, we investigated how envelope protein glycosylation site mutations impact the potency of broadly neutralizing antibodies against ZIKV and DENV. We found that glycan occupancy was not always predicted by an intact N-X-S/T sequence motif. Moreover, envelope protein glycosylation site mutations alter the potency of broadly neutralizing antibodies in a manner unexpected from their predicted binding mechanism as determined by existing structures. We therefore highlight the complex role and determinants of envelope protein glycosylation that should be considered in the design of vaccine antigens to elicit broadly neutralizing antibodies.

Under some conditions, dengue virus (DENV) can hijack IgG antibodies to facilitate its uptake into target cells expressing Fc gamma receptors (FcgR)-a process known as antibody-dependent enhancement (ADE) of infection. Beyond a requirement for FcgR, host dependency factors for this unusual IgG-mediated infection route remain unknown. To identify cellular factors exclusively required for ADE, here, we performed CRISPR knockout (KO) screens in an in vitro system poorly permissive to infection in the absence of IgG antibodies. Validating our approach, a top hit was FcgRIIa, which facilitates the binding and internalization of IgG-bound DENV but is not required for canonical infection. Additionally, we identified host factors with no previously described role in DENV infection, including TBC1D24 and SV2B, which have known functions in regulated secretion. Using genetic knockout and trans-complemented cells, we validated a functional requirement for these host factors in ADE assays performed with monoclonal antibodies and polyclonal sera in multiple cell lines and using all four DENV serotypes. We show that knockout of TBC1D24 or SV2B impaired the binding of IgG-DENV complexes to cells without affecting FcgRIIa expression levels. Thus, we identify cellular factors beyond FcgR that promote efficient ADE of DENV infection. Our findings represent a first step toward advancing fundamental knowledge behind the biology of a non-canonical infection route implicated in disease.IMPORTANCEAntibodies can paradoxically enhance rather than inhibit dengue virus (DENV) infection in some cases. To advance knowledge of the functional requirements of antibody-dependent enhancement (ADE) of infection beyond existing descriptive studies, we performed a genome-scale CRISPR knockout (KO) screen in an optimized in vitro system permissive to efficient DENV infection only in the presence of IgG. In addition to FcgRIIa, a known receptor that facilitates IgG-mediated uptake of IgG-bound, but not naked DENV particles, our screens identified TBC1D24 and SV2B, cellular factors with no known role in DENV infection. We validated a functional role for TBC1D24 and SV2B in mediating ADE of all four DENV serotypes in different cell lines and using various antibodies. Thus, we identify cellular factors beyond Fc gamma receptors that promote ADE mechanisms. This study represents a first step toward advancing fundamental knowledge beyond a poorly understood non-canonical viral entry mechanism.

Zika virus and dengue virus are co-circulating flaviviruses with a widespread endemic range. Eliciting broad and potent neutralizing antibodies is an attractive goal for developing a vaccine to simultaneously protect against these viruses. However, the capacity of viral mutations to confer escape from broadly neutralizing antibodies remains undescribed, due in part to limited throughput and scope of traditional approaches. Here, we use deep mutational scanning to map how all possible single amino acid mutations in Zika virus envelope protein affect neutralization by antibodies of varying breadth and potency. While all antibodies selected viral escape mutations, the mutations selected by broadly neutralizing antibodies conferred less escape relative to those selected by narrow, virus-specific antibodies. Surprisingly, even for broadly neutralizing antibodies with similar binding footprints, different single mutations led to escape, indicating distinct functional requirements for neutralization not captured by existing structures. Additionally, the antigenic effects of mutations selected by broadly neutralizing antibodies were conserved across divergent, albeit related, flaviviruses. Our approach identifies residues critical for antibody neutralization, thus comprehensively defining the as-yet-unknown functional epitopes of antibodies with clinical potential. Importance The wide endemic range of mosquito-vectored flaviviruses – such as Zika virus and dengue virus serotypes 1-4 – places hundreds of millions of people at risk of infection every year. Despite this, there are no widely available vaccines, and treatment of severe cases is limited to supportive care. An avenue towards development of more widely applicable vaccines and targeted therapies is the characterization of monoclonal antibodies that broadly neutralize all these viruses. Here, we measure how single amino acid mutations in viral envelope protein affect neutralizing antibodies with both broad and narrow specificities. We find that broadly neutralizing antibodies with potential as vaccine prototypes or biological therapeutics are quantifiably more difficult to escape than narrow, virus-specific neutralizing antibodies.

Full text Figures and data Side by side Abstract eLife assessment Introduction Results Discussion Materials and methods Data availability References Peer review Author response Article and author information Abstract A hallmark of dengue virus (DENV) pathogenesis is the potential for antibody-dependent enhancement, which is associated with deadly DENV secondary infection, complicates the identification of correlates of protection, and negatively impacts the safety and efficacy of DENV vaccines. Antibody-dependent enhancement is linked to antibodies targeting the fusion loop (FL) motif of the envelope protein, which is completely conserved in mosquito-borne flaviviruses and required for viral entry and fusion. In the current study, we utilized saturation mutagenesis and directed evolution to engineer a functional variant with a mutated FL (D2-FL), which is not neutralized by FL-targeting monoclonal antibodies. The FL mutations were combined with our previously evolved prM cleavage site to create a mature version of D2-FL (D2-FLM), which evades both prM- and FL-Abs but retains sensitivity to other type-specific and quaternary cross-reactive (CR) Abs. CR serum from heterotypic (DENV4)-infected non-human primates (NHP) showed lower neutralization titers against D2-FL and D2-FLM than isogenic wildtype DENV2 while similar neutralization titers were observed in serum from homotypic (DENV2)-infected NHP. We propose D2-FL and D2-FLM as valuable tools to delineate CR Ab subtypes in serum as well as an exciting platform for safer live-attenuated DENV vaccines suitable for naïve individuals and children. eLife assessment This valuable study describes engineered dengue virus variants that can be used to dissect epitope specificities in polyclonal sera, and to design candidate vaccine antigens that dampen antibody responses against undesirable epitopes. While the major claims are supported by solid evidence, experiments to distinguish the impact on antibody binding from neutralizing activities would have strengthened the study. This work will be of interest to virologists and structural biologists working on antibody responses to flaviviruses. https://doi.org/10.7554/eLife.87555.3.sa0 About eLife assessments Introduction Dengue virus (DENV) is a member of the Flavivirus genus and is a major global public health threat, with four major serotypes of DENV found worldwide. Dengue causes ~400 million infections each year, of which ~20% of cases present clinically, a subset of which may progress to severe dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS) (Bhatt et al., 2013; Brady et al., 2012). DENV is transmitted through Aedes mosquito vectors, and globalization and global warming are increasing the endemic range of dengue worldwide (Ebi and Nealon, 2016; Messina et al., 2019). The pathogenesis of dengue is complex as first-time infections are rarely severe and lead to serotype-specific immunity. However, reinfection with a different serotype increases the risk of developing DHF/DSS (Halstead, 1988). This is thought to be due to the phenomenon of antibody-dependent enhancement (ADE), in which poorly neutralizing cross-reactive (CR) antibodies (Abs) lead to enhanced viral uptake and infection of unique cell populations in an Fcγ-receptor-mediated manner (Katzelnick et al., 2017). ADE remains a major challenge for DENV vaccine development (Rey et al., 2018). The leading DENV vaccine platforms in clinical testing are tetravalent live-attenuated virus mixtures of all four serotypes. However, creating formulations that elicit a balanced response has proven challenging (Rabaa et al., 2017). Additionally, lab-grown strains differ from patient-derived DENVs in both maturation status and antigenicity (Raut et al., 2019). In particular, Abs targeting the fusion loop (FL) have been reported to neutralize lab and patient strains with differing strengths and have been observed to facilitate Fcγ-receptor uptake in vitro and therefore ADE (Lai et al., 2013; Beltramello et al., 2010; Costin et al., 2013). Currently, there is a single FDA-approved DENV vaccine, Dengvaxia. However, it is only approved for use in individuals aged 9–16 with previous DENV infection living in endemic areas and is contraindicated for use in naïve individuals and younger children. In naïve children, vaccination stimulated non-neutralizing CR Abs that increased the risk of severe disease after DENV infection (Wilder-Smith, 2019; Anonymous, 2019). Other DENV vaccines have been tested or are currently undergoing clinical trial, but thus far none have been approved for use in the United States (Izmirly et al., 2020). The vaccine Qdenga has been approved in the European Union, Indonesia, and Brazil, although vaccine efficacy in adults, naïve individuals, and with all serotypes has not yet been shown (Angelin et al., 2023). The DENV FL is located in Envelope (E) protein domain II (EDII) and is involved in monomer–monomer contacts with EDIII (Modis et al., 2004). During the DENV infection cycle, low pH triggers a conformational change in the E protein (Klein et al., 2013). The structure of the virion rearranges, and individual monomers form a trimer with all three FLs in the same orientation, ready to initiate membrane fusion (Modis et al., 2004; Klein et al., 2013). The core FL motif (DRGWGNGCGLFGK, AA 98–110) is highly conserved, with 100% amino acid conservation in all DENV serotypes and other mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), West Nile virus (WNV), Kunjin virus (KUNV), Murray Valley encephalitis virus (MVEV), Japanese encephalitis virus (JEV), Usutu virus (USUV), and Saint Louis encephalitis virus (SLEV; Figure 1A). Although the extreme conservation and critical role in entry have led to it being considered difficult to alter the antigenic epitope by changing more than one amino acid of the FL, we successfully tested the hypothesis that massively parallel-directed evolution could produce viable DENV FL mutants that were still capable of fusion and entry, while altering the antigenic footprint. The FL mutations, in combination with optimized prM cleavage site mutations, ablate neutralization by the prM- and FL-Abs, retain sensitivity to other protective Abs, and provide a novel vaccine strategy for DENV. Figure 1 Download asset Open asset Generation of DENV2 fusion loop mutants via directed evolution. (A) Alignment of top: dengue virus fusion loops; bottom: mosquito-borne flavivirus fusion loops, including yellow fever virus (YFV), Zika virus (ZIKV), West Nile virus (WNV), Kunjin virus (KUNV), Murray Valley encephalitis virus (MVEV), Japanese encephalitis virus (JEV), Usutu virus (USUV), and Saint Louis encephalitis virus (SLEV). Amino acids are colored by functional groups: negatively charged (red), positively charged (blue), nonpolar (yellow), polar (green), aromatic (pink), and sulfide (dark red). (B) Schematic of directed evolution procedure. Saturation mutagenesis libraries were used to produce viral libraries, which were passaged three times in either C6/36 or Vero 81 cells. At the end of the selection, viral genomes were isolated and mutations were identified by high-throughput sequencing. (C) Left: bubble plot of the sequences identified from either the unselected or selected (passage 3) C6/36 DENV libraries. Right: pie chart of the sequences from passage 3 C6/36 DENV libraries. (D) Structure of the DENV envelope with the fusion loop mutations highlighted in red. (E) Sequences of the fusion loop and furin cleavage site of DENV2, D2-FL, and D2-FLM. Results To engineer a virus with a novel antigenic footprint at the FL, we targeted the core conserved FL motif. We generated two different saturation mutagenesis libraries, each with five randomized amino acids: DRGXGXGXXXFGK (Library 1; AA 101, 103, 105–107) and DRGXXXXXGLFGK (Library 2 AA 101–105). Library 1 was designed to mutate known residues targeted by FL mAbs while Library 2 focused on a continuous linear peptide that is the epitope for FL-Abs to maximally alter antigenicity (Smith et al., 2013). Saturation mutagenesis plasmid libraries were used to produce viral libraries in either C6/36 (Aedes albopictus mosquito) or Vero 81 (African green monkey) cells and passaged three times in their respective cell types. Following directed evolution, viral genomes were extracted and subjected to deep sequencing to identify surviving and enriched variants (Figure 1B). Due to the high level of conservation, it was not surprising that most mutational combinations failed to yield viable progeny. In fact, evolutions carried out on Library 2 only yielded wildtype sequences. For Library 1, wildtype sequences dominated in Vero 81-evolved libraries. However, a novel variant emerged in C6/36 cells with two amino acid changes: DRGWGSGCLLFGK. The major variant comprised ~95% of the population, while the next most populous variant (DRGWGSGCWLFGK) comprised only 0.25% (Figure 1C). Bulk Sanger sequencing revealed an additional Env-T171A mutation outside of the FL region. Residues W101, C105, and L107 were preserved in our final sequence, supporting the importance of these residues (Modis et al., 2004). When modeled on the pre-fusion DENV2 structure, the N103S and G106L mutations are located at the interface with the neighboring monomer EDIII domain, protected from the aqueous environment. In the post-fusion form, the two residues are located between W101 and F108 and form the bowl concavity above the chlorine ion in the post-fusion trimer (Figure 1D). We used reverse genetics to re-derive the FL N103S/G106L/T171A mutant, which we term D2-FL. As enhancing Abs also target prM (Rodenhuis-Zybert et al., 2010), we also created a mature version of D2-FL termed D2-FLM, containing both the evolved FL motif and our previously published evolved prM furin cleavage site, which results in a more mature virion like those found in infected patients (Figure 1E; Raut et al., 2019; Tse et al., 2022). We performed growth curves comparing DENV2, D2-FL, and D2-FLM in both C6/36 and Vero 81 cells. In C6/36 cells, the growth of all three viruses was comparable, reaching high titers of 106–107 FFU/mL. However, in Vero 81 cells, both FL mutant viruses were highly attenuated, with a 2–2.5 log reduction in titer (Figure 2A). The species-specific phenotype in culture involved a change from insect to mammalian cells, as well as a change in growth temperature. To investigate whether the mutant viruses were more unstable at higher temperatures, we performed a thermostability assay, comparing viruses incubated at temperatures ranging from 4 to 55°C before infection. The three viruses had comparable thermostabilities, indicating that this does not explain the attenuation of the FL mutants (Figure 2B). Because the D2-FLM virus contains mutations that increase prM cleavage frequency, we also assayed the maturation status of the three viruses by western blot. D2-FL had a comparable prM:E ratio to the isogenic wildtype DENV2 (DV2-WT), while, as expected, D2-FLM had a reduced prM:E ratio, indicating a higher degree of maturation (Figure 2C). Figure 2 Download asset Open asset Biological and physical properties of mature DENV2 fusion loop mutants. (A) Multistep growth curves [Multiplicity of infection (MOI) = 0.05–0.1] of DV2-WT, D2-FL, and D2-FLM on C6/36 cells (left) or Vero 81 cells (right). (B) Thermostability assay on DV2-WT, D2-FL, and D2-FLM. (C) Western blot of virions, blotted against Envelope and prM proteins. Equal volumes of supernatants from viral infected C6/36 cells at 5 days post-infection (dpi) (A) were loaded into each lane. The prM:E ratio was determined and normalized to the DV2-WT ratio. High exposure of D2-FLM (right) illustrates the relative abundance of prM protein to E protein. Averages of three biological replicates are shown. The data are graphed as means ± standard deviations (Error bars). Two-way ANOVA was used for statistical comparison of growth curves and thermostability: ns, not significant; *<0.05; **<0.005; ***<0.0005. Figure 2—source data 1 Raw gel images of the western blot shown in Figure 2C. https://cdn.elifesciences.org/articles/87555/elife-87555-fig2-data1-v1.zip Download elife-87555-fig2-data1-v1.zip Next, we characterized the ability of Abs targeting the FL to recognize DV2-WT, D2-FL, and D2-FLM with a panel of monoclonal antibodies (mAbs). Importantly, D2-FL and D2-FLM were resistant to mAbs targeting the FL. Neutralization by 1M7 is reduced by ~2 logs in both variants, 1N5 neutralization is reduced by ~1 log for D2-FL and reduced to background levels for D2-FLM, and no neutralization was observed for 1L6 or 4G2 for either variant (Figure 3A; Smith et al., 2013). Focusing on the D2-FLM virus containing both evolved motifs, we then characterized the antigenicity of the whole virion with a panel of mAbs. As expected, D2-FLM was unable to be neutralized by the prM Abs 1E16 and 5M22; the Ab 2H2 does not neutralize either DV2-WT or D2-FLM (Figure 3B). For Abs targeting epitopes in non-mutated regions, including the ED1 and EDE epitopes that target EDII and EDIII, FRNT50 values were generally comparable, although EDE1-C10 shows a moderate but statistically significant reduction between DV2-WT and D2-FLM, indicating that the overall virion structural integrity was intact (Figure 3B). Figure 3 Download asset Open asset Fusion loop (FL) mutant is insensitive to FL monoclonal antibodies (mAbs), the major target for cross-reactive Abs in non-human primates (NHPs). (A) Left: FRNT50 values for neutralization of DV2-WT, D2-FL, and D2-FLM with mAbs against the FL (1M7, 1N5, 1L6, 4G2). All Abs were tested in at least n = 3 independent experiments, except 1N5 due to limited Ab. Right: average neutralization curves for neutralization of DV2-WT, D2-FL, and D2-FLM with mAbs against the DENV2 FL. (B) FRNT50 values for neutralization of DV2-WT and D2-FLM with mAbs against DENV2 prM (2H2, 1E16, 5M22), EDI (3F9), EDE (C10, B7), and EDIII (2D22). All Abs were tested in at least n = 3 independent experiments. The data are graphed as means ± standard deviations (Error bars). (C) Neutralization of DV2-WT, D2-FL, and D2-FLM with sera from NHPs infected with either DENV4 or DENV2. FRNT50s were compared using Student’s t-test. Significant symbols are as follows: *p<0.05; **p<0.005; ***p<0.0005; ****p<0.00005. The data are graphed as means ± standard deviations. Next, we analyzed neutralization of the D2-FLM virus using serum derived from convalescent humans and experimentally infected rhesus macaque non-human primates (NHPs). Overall, we tested serum from three different cohorts with a total of 6 humans and 9 NHPs at different time points with a total of 27 samples. In the first cohort (NHP infected with 1 × 106 FFU Vero-grown virus via subcutaneous [SC] injection) (Young et al., 2023), serum from homotypic DENV2-infected NHPs (n = 3) did not display a difference in neutralization between DV2-WT, D2-FL, and D2-FLM, confirming that prM and FL epitopes are not significant contributors to the homotypic type-specific (TS) neutralizing Ab response in primates (Figure 3C). In two NHPs infected with DENV4, strong neutralization potency (FRNT50 between 1:100 and 1:1000) was demonstrated against DV2-WT (Figure 3C). Heterologous cross-neutralization was significantly reduced to background levels (FRNT50 < 1:40) against the D2-FLM virus at 90 days post-infection (dpi). Neutralization observed against D2-FL, in general, fell between DV2-WT and D2-FLM. NHP 0Y0 displayed little difference in neutralization between D2-FL and D2-FLM, suggesting that FL Abs were more prominent in this animal. Interestingly, in animal 3Z6, at 20 dpi, neutralization against DENV-FL was comparable to DV2-WT, while D2-FLM was greatly reduced, indicating that Abs in the sera targeting the immature virion formed a large portion of the CR response. These data suggest that after a single infection many of the CR Ab responses target prM and the FL and the reliance on these Abs for heterotypic neutralization increases over time (Figure 3C). In the second cohort (NHPs infected with 5 × 105 FFU C6/36-grown virus via SC injection) and the third cohort (human serum tested positive by ELISA for homotypic DENV infection) (Lopez et al., 2021), most of the serum (18/24) did not cross-neutralize DV2-WT (FRNT50 < 1:40), leading to inconclusive result in determining the CR-Ab population in these sera (Table 1). The difference between the three cohorts also highlights the heterogeneity of Ab composition in humans and NHPs after DENV exposure. Nevertheless, the collection of FL, mature, and FL-mature variants provides new opportunity to delineate antibody composition in complex polyclonal serum from DENV natural infection and vaccination. Table 1 Summary of FRNT50 values of human convalescent serum and non-human primates (NHP) infection serum against DV2, D2-FL (not determined in human serum) and D2-FLM. FRNT50 values were derived from an eight-point dilution curve of serum started from 1:40 with subsequent threefold dilutions. FRNT50 values were calculated/extrapolated from the neutralization curves. For human serum, the average FRNT50 values were shown from two independent experiments with technical replicates. For NHP serum, FRTN50 values were average of three independent experiments. ND, not determined. * denotes the Hill slopes of all the neutralization curve of them sample are <0.5 (low confidence of neutralization). Human #Infected serotypeCollection tmeDV2D2-FLD2-FLMDS1500DENV1Convalescent serum1:75ND1:53DS24991:80ND1:52DS1136DENV31:133ND1:45DS11601:86ND1:208DS0275DENV41:94ND1:94DS22391:156ND1:42NHP #Infected serotypeCollection time (dpi)DV2D2-FLD2-FLMR628DENV430<1:40<1:40<1:4060<1:40<1:40<1:40901:42*<1:40<1:40R73730<1:40<1:40<1:4060<1:40<1:40<1:4090<1:40<1:40<1:40R113230<1:40<1:40<1:4060<1:40<1:40<1:4090<1:40<1:40<1:40R1160301:58*<1:40<1:40601:57*1 : 50*<1:4090<1:401 : 57*1:91* Discussion Mechanistic understanding of vaccine protection and identification of correlates of protection are immensely important for DENV vaccine development. The dual protective and enhancing properties of DENV Abs create major challenges for dissecting the role of various Ab populations in disease protection. Cross-reactive weakly neutralizing prM- and FL-Abs are often immunodominant after primary DENV infection (Lai et al., 2013; Smith et al., 2012; Oliphant et al., 2006; Lai et al., 2008; Dejnirattisai et al., 2010), and can lead to overestimation of the levels of heterotypic protection in traditional neutralization assays. Since these same antibodies are also associated with ADE (Rodenhuis-Zybert et al., 2010), inaccurate conclusions could have dire consequences if protection in vitro translates to the enhancement of disease in human vaccinees. Unfortunately, Ab profiling in polyclonal serum is mainly performed by ELISA, and a neutralization assay that can discriminate Abs does not exist. The D2-FLM variant is not neutralized by FL- and prM-mAbs and appears insensitive to neutralization by these Abs in polyclonal serum. Of note, EDE1-C10 neutralization potency was also reduced in our FL-M variant, further indicating our mutations are affecting the tip of the EDII region that partially overlaps with the EDE1 epitope (Sharma et al., 2021). In combination with other chimeric DENVs (Andrade et al., 2019; Young et al., 2020; Gallichotte et al., 2015), D2-FLM provides a reagent to distinguish between TS, protective CR (e.g. E dimer epitope [EDE]) (Barba-Spaeth et al., 2016; Dejnirattisai et al., 2015) and ADE-prone CR (e.g. FL and prM) (Dejnirattisai et al., 2010) Ab subclasses in neutralization assays after infection and vaccination. Due to the ADE properties of DENV Abs, studies to understand and eliminate ADE phenotype are under active investigation. For example, mAbs can be engineered to eliminate binding to the Fcγ receptor, abolishing ADE (Kotaki et al., 2021). While this methodology holds potential for Ab therapeutic development and passive immunization strategies, it is not relevant for vaccination. As FL and prM targeting Abs are the major species demonstrated to cause ADE in vitro, we and others hypothesized that these Abs are responsible for ADE-driven negative outcomes after primary infection and vaccination (Lai et al., 2013; Beltramello et al., 2010; Costin et al., 2013; de Alwis et al., 2014). We propose that genetic ablation of the FL and prM epitopes in vaccine strains will minimize the production of these subclasses of Abs responsible for undesirable vaccine responses. Indeed, covalently locked E-dimers and E-dimers with FL mutations have been engineered as potential subunit vaccines that reduce the availability of the FL, thereby reducing the production of FL Abs (Rouvinski et al., 2017; Rockstroh et al., 2015; Slon-Campos et al., 2019; Metz et al., 2017). DENV subunit vaccines are an area of active study (Kudlacek et al., 2021); however, monomer/dimer subunits can also expose additional, interior-facing epitopes not normally exposed to the cell. Furthermore, dimer subunits are not a complete representation of the DENV virion, which presents other structurally important interfaces such as the threefold and fivefold symmetries. Concerns about balanced immunity to all four serotypes also apply to subunit vaccine platforms. Given the complexity of the immune response to DENV, live virus vaccine platforms have thus far been more successful. However, the FL is strongly mutationally intolerant. Previous reported mutations in the FL are mainly derived from experimental evolution using FL-Abs to select for escape mutant or by deep mutational scanning (DMS) of the Env protein for Ab epitope mapping. Mutations in the FL epitope were observed in a DENV2-NGC-V2 (G106V) (Goncalvez et al., 2004), attenuated JEV vaccine strain SA14-14-2 (L107F) (Gromowski et al., 2015), and attenuated WNV-NY99 (L107F) (Zhang et al., 2006). While most of the mutations, including the double mutations reported here lead to attenuation of the virus, a recent DMS study showed that Zika-G106A has no observable impact on viral fitness (Chambers et al., 2018). Interestingly, we also recovered a mutation G106L, suggesting that positions 103, 106, and 107 are tolerable FL positions for mutation in mosquito-borne flavivirus. On the other hand, tick-borne flaviviruses, no known vector flaviviruses, and invertebrate-specific flaviviruses show a more diverse FL composition. The inflexibility of mosquito-borne flaviviruses might be due to the evolutionary constraint of the virus to switch between mosquito and vertebrate hosts. Using directed evolution, we successfully generated our D2-FLM variant that combines viability with the desired Ab responses. Therefore, the D2-FLM variant is a novel candidate for a vaccine strain, which presents all the native structures and complex symmetries of DENV necessary for T-cell-mediated responses and which can elicit more optimal protective Ab responses (Tian et al., 2019; Elong Ngono and Shresta, 2019; Waickman et al., 2019). Other considerations of high importance when designing a live DENV vaccine include strain selection and serotype balance (Gallichotte et al., 2018). In the current study, we used DENV2 S16803, a prototype for DENV2 (Halstead and Marchette, 2003). However, S16803 was isolated several decades ago, and it may be beneficial to utilize more contemporaneous strains (Rabaa et al., 2017; Juraska et al., 2018). Work is currently ongoing to demonstrate the portability of the evolved FL motif on additional DENV2 strains and other serotypes, which is essential for tetravalent vaccine production. D2-FLM was highly attenuated in Vero cells, creating a challenge for vaccine production. Therefore, further adaptation of this strain to grow efficiently in mammalian cells while retaining its antigenic properties is needed. We have tested a panel of FL-Abs; however, we cannot exclude the possibility that other FL-Abs may not be affected by N103S and G106L. Our study confirmed that saturation mutagenesis could generate mutants with multiple amino acid changes, and we are currently using D2-FLM as backbone to iteratively evolve additional mutations in FL to further vary the FL antigenic epitope. Taken together, the FLM variant holds new possibilities for a new generation of DENV vaccines, as well as a platform to readily measure TS and CR ADE-type responses and thereby assess the true protective potential of DENV vaccine trials and safeguard approval of DENV vaccines for human use. Materials and methods Cells and viruses Request a detailed protocol A. albopictus C6/36 (ATCC CRL-1660) cells were grown in MEM (Gibco) with 5% FBS (HyClone), 1% penicillin/streptomycin (Gibco), 0.1 mM nonessential amino acids (Gibco), 1% HEPES (Gibco), and 2 mM GlutaMAX (Gibco), cultured at 32°C with 5% CO2. African green monkey Vero 81 cells (ATCC CCL-81) were grown in DMEM/F12 (Gibco) with 10% FBS, 1% penicillin/streptomycin (Gibco), 0.1 mM nonessential amino acids (Gibco), and 1% HEPES (Gibco), cultured at 37°C with 5% CO2. Cells were tested negative for mycoplasma. DENV viruses were grown in C6/36 or Vero 81 cells maintained in infection media. C6/36 infection media consists of Opti-MEM (Gibco) with 2% FBS (HyClone), 1% penicillin/streptomycin (Gibco), 0.1 mM nonessential amino acids (Gibco), 1% HEPES (Gibco), and 2 mM GlutaMAX (Gibco). Vero 81 infection media consists of DMEM/F12 (Gibco) with 2% FBS, 1% penicillin/streptomycin (Gibco), 0.1 mM nonessential amino acids (Gibco), and 1% HEPES (Gibco). DENV2 strain S16803 was used in this study (Halstead and Marchette, 2003). Sequences used for the alignments include DENV1 WestPac-74 (U88535.1), DENV2 S-16803 (GU289914.1), DENV3 3001 (JQ411814.1), DENV4 Sri Lanka-92 (KJ160504.1), YFV 17D (NC_002031.1), SLEV Kern217 (NC_007580.2), JEV (NC_001437.1), USUV Vienna-2001 (NC_006551.1), MVEV (NC_000943.1), and WNV-1 NY99 (NC_009942.1), and ZIKV MR-766 (NC_012532.1). DENV reverse genetics Request a detailed protocol DENV2 S16803 was used in this study. Recombinant viruses were created using a four-plasmid system as previously described (Messer et al., 2012), consisting of the DENV genome split into four segments, each cloned into a separate plasmid. The DENV plasmids were digested and ligated to form a single template for in vitro transcription. The resulting RNA was electroporated into either C6/36 or Vero cells. Virus-containing supernatant was harvested at 4–5 d post electroporation and passaged. DENV variants were created through site-directed mutagenesis of the DENV plasmids. Library generation and directed evolution Request a detailed protocol DENV FL libraries were generated through saturation mutagenesis of the indicated resides, based on a previously published protocol (Tse et al., 2022; Tse et al., 2017). Degenerate NNK oligonucleotides were used to amplify the region, generating a library of mutated DNA fragments. Q5 DNA Polymerase was used with less than 18 cycles to maintain accuracy. The resulting library was cloned into the DENV reverse genetics system. The ligated plasmids were electroporated into DH10B ElectroMax cells (Invitrogen) and directly plated on 5,245 mm2 dishes (Corning) to avoid bias from suspension culture. Colonies were pooled and purified using a Maxiprep kit (QIAGEN), and the plasmid library used for DENV reverse genetics (above). Viral libraries were passaged three times in the corresponding cell type. High-throughput sequencing and analysis Request a detailed protocol Viral RNA was isolated with a QIAamp viral RNA kit (QIAGEN), and cDNA produced using the Superscript IV Reverse Transcriptase (Invitrogen). Amplicons were prepared for sequencing using the Illumina TruSeq system with two rounds of PCR using Q5 Hot Start DNA polymerase (NEB). For the first round of PCR, primers were specific to the DENV2 E sequence surrounding the FL motif with overhangs for the Illumina adapters (RT: CGCAGCTAGAATCGATCTAGCNNNNNNNNNNNNNNNTGTGCACCAGCCAAGC; F:CCCTACACGACGCTCTTCCGATCTNNNNNCAAACCAACATTGGATTTTGAACTG; R:GACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNCGCAGCTAGAATCGATCTAGC). After purification, this product was used as the template for the second round of PCR using Illumina P5 and P7 primers containing 8-nucleotide indexes (P5: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGAC; P7: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG). Purified PCR products were analyzed on a Bioanalyzer (Agilent Technologies) and quantified on a Qubit 4 fluorometer (Invitrogen). Amplicon libraries were run on a MiSeq system with 2 × 150 bp reads. Plasmid and P0 libraries were sequenced at a depth of ~4.5 million reads; later passages were sequenced at a depth of ~750,000 reads. Custom Perl and R scripts were used to analyze and plot the data as previously published (Tse et al., 2022) and can be found the Tse Lab GitHub site (Meganck, 2022). DENV growth kinetics Request a detailed protocol One day before infection, 5 × 105 cells were seeded in every well of a 6-well plate. Cells with infected with an MOI of 0.05–0.1, estimating 1 × 106 cells on the day of infection. Infection was carried out for 1 hr in the incubator, followed by 3× washes with PBS and replenishment with fresh infection medium. Then, 300 uL of viral supernatant was collected at 0, 24, 48, 72, 96, and 120 hr and stored at –80°C. All experiments were performed independently at least three times (biological replicate). DENV focus-forming assay Request a detailed protocol Titers of viral supernatant were determined using a standard DENV focus-forming assay. In brief, cells were seeded at 2 × 104 cells per well of a 96-well plate 1 d before infection. The next day, 50 uL of tenfold serial

Severe dengue infections are characterized by endothelial dysfunction shown to be associated with the secreted nonstructural protein 1 (sNS1), making it an attractive vaccine antigen and biotherapeutic target. To uncover the biologically relevant structure of sNS1, we obtained infection-derived sNS1 (isNS1) from DENV-infected Vero cells through immunoffinity purification instead of recombinant sNS1 (rsNS1) overexpressed in insect or mammalian cell lines. We found that isNS1 appeared as an approximately 250 kDa complex of NS1 and ApoA1 and further determined the cryoEM structures of isNS1 and its complex with a monoclonal antibody/Fab. Indeed, we found that the major species of isNS1 is a complex of the NS1 dimer partially embedded in a High-Density Lipoprotein (HDL) particle. Cross-linking mass spectrometry (XL-MS) studies confirmed that the isNS1 interacts with the major HDL component ApoA1 through interactions that map to the NS1 wing and hydrophobic domains. Furthermore, our studies demonstrated that the sNS1 in sera from DENV-infected mice and a human patient form a similar complex as isNS1. Our results report the molecular architecture of a biological form of sNS1 which may have implications for the molecular pathogenesis of dengue.CryoEM structures of secreted dengue virus NS1 protein reveal dimers in complex with high-density lipoprotein.

Sequential dengue virus (DENV) infections often generate neutralizing antibodies against all four DENV serotypes and sometimes, Zika virus. Characterizing cross-flavivirus broadly neutralizing antibody (bnAb) responses can inform countermeasures that avoid enhancement of infection associated with non-neutralizing antibodies. Here, we used single cell transcriptomics to mine the bnAb repertoire following repeated DENV infections. We identified several new bnAbs with comparable or superior breadth and potency to known bnAbs, and with distinct recognition determinants. Unlike all known flavivirus bnAbs, which are IgG1, one newly identified cross-flavivirus bnAb (F25.S02) was derived from IgA1. Both IgG1 and IgA1 versions of F25.S02 and known bnAbs displayed neutralizing activity, but only IgG1 enhanced infection in monocytes expressing IgG and IgA Fc receptors. Moreover, IgG-mediated enhancement of infection was inhibited by IgA1 versions of bnAbs. We demonstrate a role for IgA in flavivirus infection and immunity with implications for vaccine and therapeutic strategies.

To address the ongoing SARS-CoV-2 pandemic and prepare for future coronavirus outbreaks, understanding the protective potential of epitopes conserved across SARS-CoV-2 variants and coronavirus lineages is essential. We describe a highly conserved, conformational S2 domain epitope present only in the prefusion core of β-coronaviruses: SARS-CoV-2 S2 apex residues 980–1006 in the flexible hinge. Antibody RAY53 binds the native hinge in MERS-CoV and SARS-CoV-2 spikes on the surface of mammalian cells and mediates antibody-dependent cellular phagocytosis and cytotoxicity against SARS-CoV-2 spike in vitro. Hinge epitope mutations that ablate antibody binding compromise pseudovirus infectivity, but changes elsewhere that affect spike opening dynamics, including those found in Omicron BA.1, occlude the epitope and may evade pre-existing serum antibodies targeting the S2 core. This work defines a third class of S2 antibody while providing insights into the potency and limitations of S2 core epitope targeting.

Article Figures and data Abstract Introduction Results Discussion Materials and methods Data availability References Decision letter Author response Article and author information Metrics Abstract The complement system is a critical host defense against infection, playing a protective role that can also enhance disease if dysregulated. Although many consequences of complement activation during viral infection are well established, mechanisms that determine the extent to which viruses activate complement remain elusive. Here, we investigate complement activation by human respiratory syncytial virus (RSV), a filamentous respiratory pathogen that causes significant morbidity and mortality. By engineering a strain of RSV harboring tags on the surface glycoproteins F and G, we are able to monitor opsonization of single RSV particles using fluorescence microscopy. These experiments reveal an antigenic hierarchy, where antibodies that bind toward the apex of F in either the pre- or postfusion conformation activate the classical pathway whereas other antibodies do not. Additionally, we identify an important role for virus morphology in complement activation: as viral filaments age, they undergo a morphological transformation which lowers the threshold for complement deposition through changes in surface curvature. Collectively, these results identify antigenic and biophysical characteristics of virus particles that contribute to the formation of viral immune complexes, and suggest models for how these factors may shape disease severity and adaptive immune responses to RSV. Introduction The complement system is a network of proteins that play a vital role in the innate and adaptive immune responses to pathogens including viruses (O’Brien et al., 2011; Kopf et al., 2002; Bottermann et al., 2019), bacteria (Bladen et al., 1966; Mishra et al., 2012), and parasites (Roestenberg et al., 2007; Engstler et al., 2007; Kurtovic et al., 2018). Activation of the complement system proceeds through three principal routes: the classical, lectin, and alternative pathways (reviewed in Dunkelberger and Song, 2010). These pathways differ in their mechanisms of activation: by opsonizing antibodies (classical pathway), by pathogen-specific carbohydrates (lectin pathway), or through continual low levels of attachment to surfaces (alternative pathway). Following activation, each pathway converges on C3, the central component of the complement cascade. C3 that has been cleaved by proteases or that has spontaneously hydrolyzed can covalently attach to activating surfaces via a reactive thioester. C3 attachment to surfaces is self-amplifying, producing new C3 convertases that further drive opsonization. C3 attachment also contributes to the terminal arm of the complement cascade, eventually leading to the assembly of a membrane attack complex that can neutralize membrane-bound targets through the formation of lytic pores. In addition to its role in the neutralization of pathogens and infected cells, C3 also plays a central role in immune signaling. Upon attachment to pathogen surfaces, multiple C3 cleavage products interact with a variety of immune receptors. These interactions contribute to antigen transport to and within lymphoid organs (Ochsenbein et al., 1999; Phan et al., 2007); antigen presentation by follicular dendritic cells (Reynes et al., 1985); activation of B cells (Hebell et al., 1991; Dempsey et al., 1996); T cell priming (Kopf et al., 2002); and the clearance of immune complexes by phagocytic cells (Lukácsi et al., 2017); or erythrocytes (Cornacoff et al., 1983). Additionally, the cleavage product C3a, also produced during complement activation, is a potent anaphylatoxin, increasing inflammation and recruiting immune cells to sites of infection (Bera et al., 2011; Peng et al., 2009). The diversity of interactions between immune cells and C3 highlights its central protective role bridging innate and adaptive immunity, as well as the potential dangers associated with dysregulation of complement (Gralinski et al., 2018; Ricklin et al., 2016). Although the disparate contributions complement makes to health and disease are well established, the mechanisms by which different human viruses activate or evade complement are less well understood. Understanding the factors that contribute to this process could help aid in the development of more effective vaccines and improve understanding of disease pathogenesis. Here, we set out to investigate complement activation by the human pathogen respiratory syncytial virus (RSV). Activation of complement during RSV infection has been linked to both protection (Corbeil et al., 1996; Bukreyev et al., 2012) and pathogenesis (Bera et al., 2011; Polack et al., 2002), but the mechanisms that drive complement activation by RSV remain unclear. RSV is an enveloped, negative-sense single-stranded RNA virus of the family Pneumoviridae that causes severe infection among infants, the immunocompromised, and the elderly. The RSV genome encodes three membrane proteins – the fusion protein (F), the attachment glycoprotein (G), and the short hydrophobic protein (SH) – which are expressed on the surface of infected cells and packaged to varying degrees into shed virus particles. Among these surface proteins, F and G serve as the primary targets of the adaptive immune response, as well as the leading candidates for vaccine development and prophylaxis (McLellan et al., 2013b; Fedechkin et al., 2018; Gilman et al., 2016; Collarini et al., 2009). The fusion protein, F, mediates the merger between viral and cellular membranes during RSV entry (Battles and McLellan, 2019) and has recently been reported to induce outside-in signaling via IGF-1R to facilitate this process (Griffiths et al., 2020). The glycoprotein, G, mediates attachment through the chemokine receptor CX3CR1 (Johnson et al., 2015; Chirkova et al., 2015; Zhivaki et al., 2017) and, when expressed in soluble form, helps antagonize immune responses (Bukreyev et al., 2012). While antibodies against F can provide potent protection both in vitro and in vivo, the conformational rearrangements this protein undergoes have historically presented challenges in vaccine design (Graham, 2017). Although antibodies against the prefusion conformation of F (pre-F) are frequently capable of blocking viral entry, antibodies that bind to the postfusion conformation of F (post-F) often fail to do so (Goodwin et al., 2018). Numerous recent breakthroughs in protein design are helping to overcome this challenge through the development of stabilized pre-F antigens as vaccine candidates (McLellan et al., 2013a; Marcandalli et al., 2019; Crank et al., 2019). However, in the context of natural infection, both pre- and post-F conformations occur, and high antibody titers against post-F have been associated with enhanced disease severity and increased activation of complement in the lungs (Polack et al., 2002; Acosta et al., 2015). Understanding how antibodies and RSV antigens contribute to complement activation could provide new insights into vaccine development and mechanisms of RSV pathogenesis. To investigate how RSV-specific antibodies contribute to activation of complement, we developed a fluorescence imaging-based approach to simultaneously quantify antibody binding, the abundance of viral antigens, and the deposition of complement proteins on RSV at the single-virus level. These experiments identify an antigenic hierarchy for complement deposition, where antibodies that bind to some antigenic sites activate the classical pathway while other antibodies do not. This hierarchy is dictated by accessibility of the antibody Fc for binding by C1, the initiator of the classical pathway. We also identify a role for the complement defense protein CD55 (DAF), which is packaged into virus particles and restricts C3 deposition. Finally, we identify biophysical features of individual RSV particles within heterogeneous populations that enhance their tendency to drive complement deposition. In particular, we find that the detachment of the RSV matrix from the viral envelope – a transition that can be induced by physical perturbations but also occurs under normal physiological conditions in vitro – significantly enhances complement deposition by a range of antibodies targeting either pre-F, post-F, or both conformations of F. Collectively, these results identify a constellation of mechanisms that contribute to complement activation and immune complex formation by RSV, and inform models for how complement may shape disease severity and the adaptive immune response to infection. Results A fluorescence-based approach to measuring complement deposition on RSV particles To identify determinants of complement activation by RSV, we developed a fluorescence assay to quantify antibody binding and opsonization with complement C3 across populations of individual virus particles. Following our previous work using influenza A virus (Vahey and Fletcher, 2019a), we engineered a strain of RSV A that was amenable to fluorescence imaging of infected cells and shed virus particles (Supplementary file 1, Figure 1—figure supplement 1A). To track viral infection, we inserted a fluorescent reporter (mTagBFP2) downstream of the NS1 stop codon but upstream of the gene-end sequence using an internal ribosome entry site (IRES). Separately, we inserted a ybbR-tag at the C-terminus of G and a pentaglycine tag immediately following the signal sequence in F. Sfp synthase (Yin et al., 2006) can be used to conjugate CoA-based fluorescent probes to the tag on G, while the tag on F becomes exposed following cleavage of the signal sequence, creating a suitable substrate for the enzyme Sortase A (SrtA) to conjugate small peptide-based fluorophores (Theile et al., 2013). These modifications allow us to visualize RSV particles and measure abundance of antigen (i.e. F or G) on the viral surface independent of conformational changes in F (i.e. prefusion vs. postfusion) and while preserving antigenic sites. Viruses labeled in this way retain levels of infectivity matching unlabeled controls (Figure 1—figure supplement 1B), demonstrating that the attachment of fluorophores is non-disruptive. Additional characterization of this labeling approach and our image acquisition settings verified that intensity measurements are linear with fluorophore concentration on RSV particles (Figure 1—figure supplement 2), and that a high percentage (~90%) of F on the surface of RSV particles is labeled (Figure 1—figure supplement 3) (see also Materials and methods). Using this system, we sought to characterize activation of the classical pathway by RSV particles. We enzymatically labeled F on the surface of RSV particles collected from A549 cells and immobilized these viruses onto PEGylated coverslips functionalized with the anti-G antibody 3D3 (Fedechkin et al., 2018). This allowed us to quantify opsonization following incubation of fluorescent viruses with normal human serum (NHS) supplemented with defined fluorescent monoclonal antibodies (mAbs) and labeled C3 (Figure 1A). Initial tests using NHS resulted in robust C3 deposition in the absence of supplemental mAbs (Figure 1—figure supplement 4A, left column). Incubating virus with this serum for 30 min at 4°C also inhibited binding of a high-affinity pre-F-specific mAb (5C4) ~ 2-fold and a post-F-specific mAb (ADI-14359) by ~10-fold, suggesting the presence of competing polyclonal IgG/IgM within the serum (Figure 1—figure supplement 4B). In contrast, IgG/IgM-depleted NHS showed little C3 deposition in the absence of supplemental mAbs, but robust opsonization with C3 when F-specific mAbs were added (Figure 1—figure supplement 4A, right column). IgG/IgM-depleted serum therefore provides a means of determining the ability of individual mAbs to drive complement deposition, allowing us to identify antibody features that are predictive of potency. Figure 1 with 4 supplements see all Download asset Open asset Complement activation and C3 deposition vary across antigenic sites of RSV F. (A) A fluorescence-based approach to measuring opsonization of RSV particles with mAbs and C3. RSV particles with site-specifically labeled F are immobilized on coverslips and incubated with normal human serum (IgG/IgM-depleted), specific mAbs, and fluorescent C3 prior to imaging. Right: RSV particles opsonized with mAb (CR9501 IgG1 in the image shown) and C3. (B) Antibodies used in this study and their antigenic sites. A ‘*’ denotes mAbs specific to prefusion F while a ‘†’ denotes mAbs specific to postfusion F. (C) Distributions of integrated antibody and C3 intensities on opsonized virus particles with predominantly prefusion F. Gray points indicate data for individual virus particles. Dashed regions indicate criteria for C3-positive particles. Data is combined from three biological replicates. (D) Top: Data from C, plotted as percentage of C3-positive RSV particles, defined by integrated C3 intensities > 104. Points show results from three biological replicates with the mean across the replicates shown as a line. Antibodies determined to be activators of the classical pathway (>10% C3-positive particles) are shown in magenta. Bottom: Plot of average mAb:F intensity per RSV particle across the same antibodies and replicates as in the plots above. (E) Conversion of pre-F to post-F on RSV filaments via ~24 hr incubation in buffer with low ionic strength but balanced osmolarity. Post-F is detected using the site I-directed mAb ADI-14359. Images are displayed at matching contrast levels. (F) and (G): Results corresponding to C and D but for RSV particles containing predominantly post-F. (H) Comparison of C3 deposition by IgM and IgG1 antibodies. Top: Schematic of antibodies based on 5C4. The antibodies contain matching light chains and VH domains coupled to the human heavy chain μ (for IgM), or a human IgG1 Fc. IgM is additionally co-expressed with a J chain plasmid. All heavy chains contain a c-terminal ybbR tag for site-specific conjugation of a fluorophore for quantification of bound antibody. Bottom: Contour plots showing distributions of C3 and IgM/IgG1 heavy chains per RSV particle, based on fluorescence intensities. The IgM distribution is determined from 317594 RSV particles; the IgG distribution is determined from 126372 RSV particles. See also Figure 1—source data 1. Figure 1—source data 1 Matlab code and data for Figure 1, Figure 1—figure supplement 1, Figure 1—figure supplement 2, Figure 1—figure supplement 3, and Figure 1—figure supplement 4. https://cdn.elifesciences.org/articles/70575/elife-70575-fig1-data1-v1.zip Download elife-70575-fig1-data1-v1.zip Complement deposition driven by F-specific antibodies varies by antigenic site We expressed and purified a panel of human IgG1 mAbs targeting six antigenic sites of RSV F (Gilman et al., 2016; Figure 1B). Each mAb was modified to contain a ybbR-tag (Yin et al., 2006) at the C-terminus of the heavy chain, to permit quantitative site-specific labeling and the ability to measure the amounts of antibody bound to individual virus particles. For these experiments, we use mAbs at concentrations similar to those measured for dominant clonotypes in post-vaccination serum (Lavinder et al., 2014) (10–20 μg/ml), well above the equilibrium-binding affinity of these antibodies. By using mAbs at concentrations that saturate binding, we were able to separate the intrinsic capacity of a given mAb to drive complement deposition when bound to antigen from that mAb’s binding affinity. At saturated binding, these mAbs vary markedly in their ability to activate the classical pathway. Among the pre-F-binding mAbs tested, 5C4 (McLellan et al., 2013b) (site 0), CR9501 (Gilman et al., 2019) (site V), and Motavizumab (Wu et al., 2007a) (site II) showed the greatest potency. In contrast, ADI-19425 (Goodwin et al., 2018; Wu et al., 2007a) (site III) and 101F (Wu et al., 2007b) (site IV) showed only background levels of C3 deposition (Figure 1C & D). Thus, although each pre-F-binding mAb achieved similar levels of binding to RSV F (Figure 1D, lower plot), only three out of five led to C3 deposition above background levels. Several F-specific antibodies bind to the postfusion conformation of F, either exclusively or in addition to the prefusion conformation. This includes several antibodies in our panel: 101F and Motavizumab (which bind to both pre- and post-F) as well as ADI-14359 and ADI-14353 (which bind specifically to post-F) (Goodwin et al., 2018). To compare C3 deposition driven by these antibodies upon binding to post-F, we first incubated viruses bound to coverslips for 24 hr in buffer with low ionic strength (300 mM mannitol, 10 mM HEPES pH 7.2), based on the previous finding that pre-F spontaneously converts to post-F in buffers with low salt concentrations (Hicks et al., 2018; Chaiwatpongsakorn et al., 2011). This treatment increased binding of the post-F-specific antibodies ADI-14359 and ADI-14353 ~300-fold without obvious changes in the morphology of virus particles (Figure 1E). Conversion of RSV particles to a predominantly post-F form increased C3 deposition from post-F-specific mAbs ADI-14359 and ADI-14353 to levels comparable to or greater than the most potent pre-F-specific antibodies in the context of pre-F antigens (Figure 1F & G). For the conformation-independent mAbs 101F and Motavizumab, C3 deposition following pre-to-post-F conversion followed different trends, increasing ~6-fold for 101F but decreasing by a similar ratio for Motavizumab, despite similar levels of antibody binding (Figure 1F & G). The classical pathway is activated when the C1 initiation complex binds to IgM or IgG that has assembled on activating surfaces. While activation via IgG requires the assembly of a hexameric complex of antibody Fc regions (Diebolder et al., 2014; Ugurlar et al., 2018; Wang et al., 2016), IgM is pre-assembled as an activating platform, with C1-binding sites exposed only upon engagement with surface antigen (Sharp et al., 2019). As a comparison with our IgG antibodies, we tested activation of the classical pathway by recombinant IgM with VH and VL domains from 5C4. As expected, this high-affinity IgM was considerably more potent than its IgG1 counterpart, leading to >100-fold more C3 deposition per bound heavy chain than the corresponding IgG1 mAb (Figure 1H). Given the importance of establishing a platform for C1 binding in activation of the classical pathway, we sought to identify how the IgG antibodies in our panel may differ in this regard. A consistent trend among the IgG1 antibodies that most efficiently drive complement deposition is the angle with which they bind to either pre- or post-F. 101F and Motavizumab, antibodies that bind to both conformations but with alternating Fc orientations, illustrate this effect. For both antibodies, C3 deposition increases ~6-fold when the Fc is oriented away from the viral membrane as opposed to toward it. Projection of the Fc region further above the viral membrane is common to all of the activating antibodies we tested (Figure 2A). This may increase accessibility for binding by C1, and positioning the Fc regions on a plane above the surrounding canopy of F could also facilitate Fc hexamer formation (Diebolder et al., 2014) by avoiding steric hindrance from neighboring proteins in the viral membrane. Consistent with this model, we observe more binding by C1 (as detected by an anti-C1q antibody) to mAbs that bind to pre-F with their Fcs projected outward (CR9501, 5C4, Motavizumab) compared to those where the Fc lies within or below the plane of F trimers in the viral membrane (ADI-19425, 101F) (Figure 2B & C). Of note, we still observe C1 binding for mAbs that do not drive C3 deposition (e.g. ADI-19425), suggesting that attachment of C1 to these mAbs may be less likely to produce an active C1 complex. This could occur if a high density of antibodies permitted C1 to attach, but assembly of the activating hexamer was occluded by F, G, or other proteins present at high densities on the viral surface. Figure 2 Download asset Open asset Complement activation and C1q binding varies with Fc position. (A) Modeling Fc positions for F-specific mAbs. Structures for RSV F (or portions thereof) with bound antibodies (PDB IDs 6OE4, 5W23, 4ZYP, 3IXT, 6APD, 6APB, and 3O45) were aligned with human IgG1 (PDB ID 1HZH) to determine representative locations accessible to antibody Fc regions (indicated by dashed outline). Distances from the viral membrane range from ~1 nm (101F) to ~18 nm (CR9501, ADI-14359). (B) C1q binding to predominantly pre-F RSV particles opsonized with different antibodies. The top plot shows the percentage of C1q+ particles, defined as those with a total intensity of anti-C1qA antibody >103. The bottom plot shows the intensity of anti-F mAb for each condition. Individual points represent values for three biological replicates. Antibodies determined to activate complement from pre-F antigens (Figure 1) are shown in magenta. (C) Distributions of anti-F mAb intensities (horizontal axis) and anti-C1qA antibody intensities (vertical axis) for different anti-F mAbs bound to pre-F particles. Particles within the dashed rectangles indicate those that are C1q-positive, and the percentage of these particles is indicated in the upper left. Distributions are combined from the same three biological replicates represented in B. See also Figure 2—source data 1. Figure 2—source data 1 Matlab code and data for Figure 2. https://cdn.elifesciences.org/articles/70575/elife-70575-fig2-data1-v1.zip Download elife-70575-fig2-data1-v1.zip CD55 is packaged into RSV particles and modulates sensitivity to complement deposition Complement defense proteins anchored in the membranes of host cells can be packaged into enveloped viruses during assembly (Li and Parks, 2018; Hutchinson et al., 2014; Marschang et al., 1995), where they may function to restrict different stages of the complement cascade. To determine if host complement defense proteins restrict opsonization of RSV particles with C3, we focused on the roles of CD46 and CD55. Both proteins are abundantly expressed on A549 cells and function to limit the amplification step of the complement cascade by restricting the formation or stability of new C3 convertases (Noris and Remuzzi, 2013). Using fluorescent Fab fragments or antibodies against CD46 and CD55, we were able to detect both on the surface of RSV particles collected from A549 cells. We proceeded to construct two polyclonal A549 knockout (KO) cell lines where one gene or the other was deleted via CRISPR/Cas9. Following KO and cell sorting, we were no longer able to detect the targeted proteins in cells or shed viruses, verifying the specificity of the antibodies and confirming successful KO (Figure 3A&B). Using these cells lines, we proceeded to compare C3 deposition in the presence or absence of CD55 or CD46. Virus released from CD55 KO cells showed increased sensitivity to C3 deposition across antibodies specific to sites II and V, with percentages of opsonized particles increasing ~2- to 3-fold relative to virus produced by wildtype cells (Figure 3C). Conversely, virus released from CD46 KO cells did not show significant differences in C3 deposition relative to wildtype cells using the site-V-specific mAb CR9501 (Figure 3D). Comparing activation by CR9501 across a range of antibody dilutions suggests that deletion of CD55 increases opsonization to an extent comparable to a 4-fold increase in antibody concentration (Figure 3E&F). While additional complement defense proteins may play critical roles in other aspects of RSV infection, these results show that CD55 plays an outsized role in modulating sensitivity of shed virus particles to opsonization with C3. Figure 3 Download asset Open asset CD55 is packaged into RSV particles and increases thresholds for C3 opsonization. (A) Images of RSV particles with enzymatically labeled F and CD55 or CD46 labeled via fluorescent antibodies. Panels show representative images of virus released from wildtype (wt) A549 cells and CD55 or CD46 knockout (KO) cells, displayed at matching contrast levels. Scale bar = 5 μm. (B) Histograms showing distributions of antibody intensities per RSV particle for wt and KO cell lines. (C) Comparison of C3 deposition on viruses raised in wt cells (open circles) or CD55 KO cells (closed circles) using three different F-specific antibodies and a negative control. Black markers show average values across four biological replicates. Individual replicates are shown in gray. Connecting lines indicate samples that were prepared in parallel, using virus collected from separate batches of wt and CD55 KO cells. p-Values are determined using a paired-sample t-test. (D) Similar plot as in C, but for data obtained from CD46 KO cells. (E) Distributions of antibody and C3 intensities for serial dilutions of CR9501 IgG1. Panels in the top row show results for viruses from CD55 KO cells, while panels from the bottom row show results for viruses from wt cells. The region indicated by the dashed line represents the threshold for C3-positive particles. Percentages in the upper left corners indicate the percentage of C3-postiive particles. Data is combined from three biological replicates. (F) Data from E plotted as percentage C3-positive particles per condition. Bars indicate mean values and points show individual replicates. * indicates p < 0.05 calculated using a two-sample t-test. See also Figure 3—source data 1. Figure 3—source data 1 Matlab code and data for Figure 3. https://cdn.elifesciences.org/articles/70575/elife-70575-fig3-data1-v1.zip Download elife-70575-fig3-data1-v1.zip Globular RSV particles serve as dominant targets of complement deposition Although the efficiency of opsonization with C3 varies depending on the activating antibody and on the presence or absence of host complement defense proteins, we observed a consistent pattern across experimental conditions, where particles opsonized with C3 had more globular morphology than those with low or undetectable levels of C3, which tended to be more filamentous (Figure 4A & B). Figure 4 Download asset Open asset Globular particles are preferentially and rapidly opsonized with C3 and C4. (A) RSV particles opsonized with antibody (CR9501 IgG1) and C3. White arrows in merged panel indicate globular particles with high levels of C3. (B) Comparison of particle aspect ratios across RSV particles that do (green boxes) or do not (gray boxes) show opsonization with C3. Boxes indicate 25th–75th percentiles and points show median values for three biological replicates. Analysis is limited to particles with an area larger than 100 pixels, where morphology can be determined from diffraction-limited images. p-Values are determined based on median values using a paired sample t-test. (C) Time series of C4 accumulation on RSV particles. White arrows indicate first detectable accumulation of C4. (D) C4 accumulation on RSV particles over time, categorized by particle morphology. Data to the left shows C4 accumulation on 742 globular particles; data on the right show C4 accumulation for 607 filamentous particles. In both plots, rows show C4 data for individual particles from 0 to 30 min, sorted from top to bottom according to total C4 accumulation. (E) Data from D, plotted by grouping particles within percentile intervals from 0% to 10%, 10% to 20%, etc. and averaging C4 accumulation in each group. (F) Sample images of globular (top) and filamentous (bottom) RSV particles. Displayed images are sampled at 4 min intervals beginning from 2 min after the addition of serum and complement components (scale bar = 1 μm). See also Figure 4—source data 1. Figure 4—source data 1 Matlab code and data for Figure 4. https://cdn.elifesciences.org/articles/70575/elife-70575-fig4-data1-v1.zip Download elife-70575-fig4-data1-v1.zip The bias in C3 opsonization toward globular particles could reflect a higher intrinsic sensitivity to complement activation in these particles as compared to viral filaments, or it could indicate that particle morphology is altered upon deposition of C3 or other complement proteins. To determine if morphological differences precede or follow from differences in complement deposition, we monitored deposition of C4 on RSV particles over time, using CR9501 as the activating antibody. The lower concentrations of C4 in serum as compared to C3 allowed us to visualize deposition on particles without the high background signal from protein in solution that arises when using C3. Additionally, deposition of C4b is immediately downstream of C1 in the classical pathway, providing rapid detection of activation. Consistent with our endpoint observations of C3 deposition, C4 accumulates on globular particles first, appearing within ~10–15 min of incubation with complement components (Figure 4C). Analysis of C4 deposition across n = 742 globular and n = 607 filamentous particles revealed substantial differences in patterns of opsonization; ~50% of globular particles showed detectable accumulation of C4 within 30 min, compared to <10% of filamentous particles (Figure 4D–F). Moreover, opsonization with C4 proceeds with different kinetics, occurring ~5-fold faster in globular particles than in filamentous ones (Figure 4E&F). These results demonstrate that sensitivity to antibody-dependent complement deposition correlates with RSV particle morphology. Globular particles arise spontaneously over time and are enriched in post-F, but do not require post-F mAbs to drive complement deposition We next sought to determine how the epitopes presented on the surface of globular particles dif

Dengue virus cocirculates globally as four serotypes (DENV1 to -4) that vary up to 40% at the amino acid level. Viral strains within a serotype further cluster into multiple genotypes. Eliciting a protective tetravalent neutralizing antibody response is a major goal of vaccine design, and efforts to characterize epitopes targeted by polyclonal mixtures of antibodies are ongoing. Previously, we identified two E protein residues (126 and 157) that defined the serotype-specific antibody response to DENV1 genotype 4 strain West Pac-74. DENV1 and DENV2 human vaccine sera neutralized DENV1 viruses incorporating these substitutions equivalently. In this study, we explored the contribution of these residues to the neutralization of DENV1 strains representing distinct genotypes. While neutralization of the genotype 1 strain TVP2130 was similarly impacted by mutation at E residues 126 and 157, mutation of these residues in the genotype 2 strain 16007 did not markedly change neutralization sensitivity, indicating the existence of additional DENV1 type-specific antibody targets. The accessibility of antibody epitopes can be strongly influenced by the conformational dynamics of virions and modified allosterically by amino acid variation. We found that changes at E domain II residue 204, shown previously to impact access to a poorly accessible E domain III epitope, impacted sensitivity of DENV1 16007 to neutralization by vaccine immune sera. Our data identify a role for minor sequence variation in changes to the antigenic structure that impacts antibody recognition by polyclonal immune sera. Understanding how the many structures sampled by flaviviruses influence antibody recognition will inform the design and evaluation of DENV immunogens. IMPORTANCE Dengue virus (DENV) is an important human pathogen that cocirculates globally as four serotypes. Because sequential infection by different DENV serotypes is associated with more severe disease, eliciting a protective neutralizing antibody response against all four serotypes is a major goal of vaccine efforts. Here, we report that neutralization of DENV serotype 1 by polyclonal antibody is impacted by minor sequence variation among virus strains. Our data suggest that mechanisms that control neutralization sensitivity extend beyond variation within antibody epitopes but also include the influence of single amino acids on the ensemble of structural states sampled by structurally dynamic virions. A more detailed understanding of the antibody targets of DENV-specific polyclonal sera and factors that govern their access to antibody has important implications for flavivirus antigen design and evaluation.

The four circulating serotypes of dengue virus (DENV1-4) are mosquito-borne flaviviruses that cause 390 million human infections annually [[1]Bhatt S. Gething P.W. Brady O.J. Messina J.P. Farlow A.W. Moyes C.L. et al.The global distribution and burden of dengue.Nature. 2013; 496: 504-507https://doi.org/10.1038/nature12060Crossref PubMed Scopus (5756) Google Scholar]. Approximately 25% of these infections result in symptoms ranging from a mild fever to a potentially fatal disease characterized by hemorrhagic fever or shock syndrome [[1]Bhatt S. Gething P.W. Brady O.J. Messina J.P. Farlow A.W. Moyes C.L. et al.The global distribution and burden of dengue.Nature. 2013; 496: 504-507https://doi.org/10.1038/nature12060Crossref PubMed Scopus (5756) Google Scholar]. Although antibodies are a critical component for flavivirus immunity, complex antibody responses to DENV1-4 hinder the design of effective vaccines. Epidemiological studies have established that intermediate levels of antibodies from a prior DENV infection with one serotype are associated with the development of severe disease following subsequent infection with a different DENV serotype [[2]Katzelnick L.C. Gresh L. Halloran M.E. Mercado J.C. Kuan G. Gordon A. et al.Antibody-dependent enhancement of severe dengue disease in humans.Science. 2017; 358: 929-932https://doi.org/10.1126/science.aan6836Crossref PubMed Scopus (555) Google Scholar]. The prevailing theory suggests that during secondary exposure, pre-existing cross-reactive antibodies of the IgG isotype can bind to DENV particles from a different serotype without neutralizing infectivity. Instead, these antibodies can promote viral uptake into target cells expressing Fc gamma receptors in a process called antibody-dependent enhancement (ADE). Understanding the components and functions of the antibody response to DENV is important for informing the design of safe and effective antibody-based vaccines and therapies. Unlike previous work, which was mostly restricted to analysis of B cells expressing the IgG antibody isotype, in the April 2020 issue of EBioMedicine, Waickman, Gromowski, et al. used single-cell RNA sequencing to obtain a more unbiased profile of the overall B cell repertoire of six individuals who had experienced primary or secondary DENV infection [[3]Waickman A.T. Gromowski G.D. Rutvisuttinunt W. Li T. Siegfried H. Victor K. et al.Transcriptional and clonal characterization of B cell plasmablast diversity following primary and secondary natural DENV infection.EBioMedicine. 2020; 54102733https://doi.org/10.1016/j.ebiom.2020.102733Summary Full Text Full Text PDF Scopus (9) Google Scholar]. The authors examined paired heavy- and light-chain antibody sequences from over 9000 B cells, including short-lived plasmablasts generated early after infection, as well as memory B cells that persist long after the infection has resolved. Among memory B cells, there were no appreciable differences in isotype distribution in primary versus secondary infection. Consistent with a previous study, there was a low prevalence of IgA- relative to IgG-expressing plasmablasts upon secondary infection [[4]Wrammert J. Onlamoon N. Akondy R.S. Perng G.C. Polsrila K. Chandele A. et al.Rapid and massive virus-specific plasmablast responses during acute dengue virus infection in humans.J Virol. 2012; 86: 2911-2918https://doi.org/10.1128/JVI.06075-11Crossref PubMed Scopus (178) Google Scholar]. In contrast, following primary infection, this new study found an unexpectedly high proportion of plasmablasts expressing IgA antibodies, many of which were extensively hypermutated, suggesting a recall response despite no known prior DENV exposure. Further studies are warranted to investigate the origin of these hypermutated IgA plasmablasts detected following primary infection. While IgA antibodies have recently been shown to contribute to the overall serum neutralizing activity against HIV [[5]Jia M. Liberatore R.A. Guo Y. Chan K.-.W. Pan R. Lu H. et al.VSV-displayed HIV-1 envelope identifies broadly neutralizing antibodies class-switched to IgG and IgA.Cell Host Microbe. 2020; 0https://doi.org/10.1016/j.chom.2020.03.024Google Scholar], the functional significance of IgA antibodies in the context of DENV infection remains to be determined. Waickmann, Gromowski, et al. posited that plasmablast-derived DENV-specific IgA antibodies may be protective: as they appeared to recognize epitopes commonly targeted by IgG antibodies, by virtue of their inability to bind to Fc gamma receptors on relevant target cells, IgA antibodies may compete for binding to DENV with their IgG counterparts to abrogate the Fc gamma receptor-mediated ADE pathway. However, it is difficult to reconcile this proposed protective mechanism given the fact that except in the case of infants born to DENV-immune mothers [[6]Kliks S.C. Nimmanitya S. Nisalak A. Burke D.S Evidence that maternal dengue antibodies are important in the development of dengue hemorrhagic fever in infants.Am J Trop Med Hyg. 1988; 38: 411-419https://doi.org/10.4269/ajtmh.1988.38.411Crossref PubMed Scopus (468) Google Scholar], ADE is mostly implicated following secondary infection [[2]Katzelnick L.C. Gresh L. Halloran M.E. Mercado J.C. Kuan G. Gordon A. et al.Antibody-dependent enhancement of severe dengue disease in humans.Science. 2017; 358: 929-932https://doi.org/10.1126/science.aan6836Crossref PubMed Scopus (555) Google Scholar], during which IgA antibodies are apparently less prevalent. Indeed, given the reported characteristics of DENV-specific IgA antibodies in the current study, including 1) abundance during primary infection, 2) overlap in epitope specificity with IgG, and 3) limited neutralizing capacity (at least when tested with IgG Fc), it is equally possible that IgA antibodies could inhibit IgG-mediated neutralization of DENV. Additional studies to deconvolute the contribution of different antibody isotypes [[5]Jia M. Liberatore R.A. Guo Y. Chan K.-.W. Pan R. Lu H. et al.VSV-displayed HIV-1 envelope identifies broadly neutralizing antibodies class-switched to IgG and IgA.Cell Host Microbe. 2020; 0https://doi.org/10.1016/j.chom.2020.03.024Google Scholar] in the humoral response to DENV infection or vaccination will help define their functional significance. A limitation of the study by Waickman, Growmowski, et al. is its restricted sample size and population: six pediatric patients of whom five were infected with DENV1. Studies with a larger sample size that includes multiple age groups infected with other DENV serotypes will be needed to confirm the findings reported here and to ultimately draw correlations with disease outcomes. Nevertheless, this study highlights the utility of single-cell RNA sequencing to efficiently profile a large number of B cells in an unbiased manner, capturing diverse antibody isotypes and cellular states. Other recent studies further demonstrated this technology's capacity to link B cell receptor sequences [[7]Setliff I. Shiakolas A.R. Pilewski K.A. Murji A.A. Mapengo R.E. Janowska K. et al.High-throughput mapping of B cell receptor sequences to antigen specificity.Cell. 2019; 179 (e15): 1636-1646https://doi.org/10.1016/j.cell.2019.11.003Summary Full Text Full Text PDF PubMed Scopus (120) Google Scholar] or transcriptional profiles [[10]Neu K.E. Guthmiller J.J. Huang M. La J. Vieira M.C. Kim K. et al.Spec-seq unveils transcriptional subpopulations of antibody-secreting cells following influenza vaccination.Journal of Clinical Investigation. 2019; 129: 93-105https://doi.org/10.1172/JCI121341Crossref PubMed Scopus (26) Google Scholar] to antigen specificity. In the future, it would be interesting to investigate whether particular B cell transcriptomic signatures can predict antibody functions such as direct neutralization and Fc-dependent effector mechanisms. In addition to single-cell genomics, a 'systems serology' approach [[8]Arnold K.B. Chung A.W Prospects from systems serology research.Immunology. 2018; 153: 279-289https://doi.org/10.1111/imm.12861Crossref PubMed Scopus (43) Google Scholar] to probe the biochemical and biophysical modifications to antibodies will also be important, given the emerging role of Fc glycoforms in regulating dengue disease [[9]Wang T.T. Sewatanon J. Memoli M.J. Wrammert J. Bournazos S. Bhaumik S.K. et al.IgG antibodies to dengue enhanced for FcγRIIIA binding determine disease severity.Science. 2017; 355: 395-398https://doi.org/10.1126/science.aai8128Crossref PubMed Scopus (188) Google Scholar]. Rapid advances in profiling humoral immunity at high throughput and resolution hold promise for comprehensively identifying the correlates of antibody-mediated protection and pathogenesis in DENV and other infections. Authors have no conflicts of interest to disclose. Transcriptional and clonal characterization of B cell plasmablast diversity following primary and secondary natural DENV infectionAntibody-mediated humoral immunity is thought to play a central role in mediating the immunopathogenesis of acute DENV infection, but limited data are available on the diversity, specificity, and functionality of the antibody response at the molecular level elicited by primary or secondary DENV infection. In order to close this functional gap in our understanding of DENV-specific humoral immunity, we utilized high-throughput single cell RNA sequencing to investigate B cells circulating in both primary and secondary natural DENV infections. Full-Text PDF Open Access

Eliciting broadly neutralizing antibodies (bNAbs) against the four dengue virus serotypes (DENV1-4) that are spreading into new territories is an important goal of vaccine design. To define bNAb targets, we characterized 28 antibodies belonging to expanded and hypermutated clonal families identified by transcriptomic analysis of single plasmablasts from DENV-infected individuals. Among these, we identified J9 and J8, two somatically related bNAbs that potently neutralized DENV1-4. Mutagenesis studies showed that the major recognition determinants of these bNAbs are in E protein domain I, distinct from the only known class of human bNAbs against DENV with a well-defined epitope. B cell repertoire analysis from acute-phase peripheral blood suggested that J9 and J8 followed divergent somatic hypermutation pathways, and that a limited number of mutations was sufficient for neutralizing activity. Our study suggests multiple B cell evolutionary pathways leading to DENV bNAbs targeting a new epitope that can be exploited for vaccine design.

Eliciting broadly neutralizing antibodies (bNAbs) against the four dengue virus serotypes (DENV1-4) that are spreading into new territories is an important goal of vaccine design. To delineate bNAb targets, we characterized 28 monoclonal antibodies belonging to expanded and hypermutated clonal families identified by transcriptomic analysis of single plasmablasts from DENV-infected individuals. Among these, we identified two somatically related bNAbs that potently neutralized DENV1-4. Mutagenesis studies revealed that the major recognition determinants of these bNAbs are in E protein domain I, distinct from the only known class of human bNAbs against flaviviruses with a well-defined epitope. B cell repertoire analysis from acute-phase peripheral blood suggested a memory origin and divergent somatic hypermutation pathways for these bNAbs, and a limited number of mutations was sufficient for neutralizing activity. Our study suggests multiple B cell evolutionary pathways leading to DENV bNAbs targeting a novel epitope that can be exploited for vaccine design.

Because antibodies are an important component of flavivirus immunity, understanding the antigenic structure of flaviviruses is critical. Compared to dengue virus (DENV), the loop containing the single N-linked glycosylation site on Zika virus (ZIKV) envelope (E) proteins extends further towards the DII fusion loop (DII-FL) on neighboring E proteins within E dimers on mature viruses. Although ZIKV is poorly neutralized by DII-FL antibodies, we demonstrated significantly increased neutralization sensitivity of ZIKV particles incorporating the DENV glycan loop. Increased neutralization sensitivity was independent of E protein glycosylation: ZIKV lacking E protein glycans remained poorly neutralized, whereas ZIKV loop chimeras with or without an E protein glycan were potently neutralized. ZIKV particles lacking the E protein glycan were capable of infecting Raji cells expressing the lectin DC-SIGNR, suggesting the prM glycan of partially mature particles can facilitate entry. Our study provides insight into the determinants of ZIKV E protein function and antigenicity.

Dengue virus (DENV) infection can result in severe complications. Yet, the understanding of the molecular correlates of severity is limited, partly due to difficulties in defining the peripheral blood mononuclear cells (PBMCs) that are associated with DENV in vivo. Additionally, there are currently no biomarkers predictive of progression to severe dengue (SD). Bulk transcriptomics data are difficult to interpret because blood consists of multiple cell types that may react differently to infection. Here we applied virus-inclusive single cell RNA-seq approach (viscRNA-Seq) to profile transcriptomes of thousands of single PBMCs derived early in the course of disease from six dengue patients and four healthy controls, and to characterize distinct DENV-associated leukocytes. Multiple genes, particularly interferon response genes, were upregulated in a cell-specific manner prior to progression to SD. Expression of MX2 in naive B cells and CD163 in CD14 + CD16 + monocytes was predictive of SD. The majority of DENV-associated cells in the blood of two patients who progressed to SD were naive IgM B cells expressing the CD69 and CXCR4 receptors and antiviral genes, followed by monocytes. Bystander uninfected B cells also demonstrated immune activation, and plasmablasts from two patients exhibited antibody lineages with convergently hypermutated heavy chain sequences. Lastly, assembly of the DENV genome revealed diversity at unexpected genomic sites. This study presents a multi-faceted molecular elucidation of natural dengue infection in humans and proposes biomarkers for prediction of SD, with implications for profiling any tissue and viral infection, and for the development of a dengue prognostic assay. Significance A fraction of the 400 million people infected with dengue annually progresses to severe dengue (SD). Yet, there are currently no biomarkers to effectively predict disease progression. We profiled the landscape of host transcripts and viral RNA in thousands of single blood cells from dengue patients prior to progressing to SD. We discovered cell-type specific immune activation and candidate predictive biomarkers. We also revealed preferential virus association with specific cell populations, particularly naive B cells and monocytes. We then explored immune activation of bystander cells, clonality and somatic evolution of adaptive immune repertoires, and viral genomics. This multi-faceted approach could advance understanding of pathogenesis of any viral infection, map an atlas of infected cells and promote the development of prognostics.

West Nile virus (WNV), a member of the Flavivirus genus, is a leading cause of viral encephalitis in the United States1. The development of neutralizing antibodies against the flavivirus envelope (E) protein is critical for immunity and vaccine protection2. Previously identified candidate therapeutic mouse and human neutralizing monoclonal antibodies (mAbs) target epitopes within the E domain III lateral ridge and the domain I-II hinge region, respectively3. To explore the neutralizing antibody repertoire elicited by WNV infection for potential therapeutic application, we isolated ten mAbs from WNV-infected individuals. mAb WNV-86 neutralized WNV with a 50% inhibitory concentration of 2 ng ml-1, one of the most potently neutralizing flavivirus-specific antibodies ever isolated. WNV-86 targets an epitope in E domain II, and preferentially recognizes mature virions lacking an uncleaved form of the chaperone protein prM, unlike most flavivirus-specific antibodies4. In vitro selection experiments revealed a neutralization escape mechanism involving a glycan addition to E domain II. Finally, a single dose of WNV-86 administered two days post-infection protected mice from lethal WNV challenge. This study identifies a highly potent human neutralizing mAb with therapeutic potential that targets an epitope preferentially displayed on mature virions.