Background Chronic total coronary occlusion (CTO) is an extremely hazardous condition that leads to various clinical phenomena and complications and results in social and economic burdens. Hyperuricemia (HU) is often associated with atherosclerosis. Few studies, however, have investigated the risk of CTO in individuals with HU and the role of traditional cardiovascular risk factors in this setting. Methods A cohort of 1245 individuals without chronic kidney disease from southwest China who underwent coronary angiography between February 2018 and June 2021 were enrolled. CTO was defined as a total occlusion of any coronary artery or arteries for more than 3 months. HU was defined as a serum uric acid level of ≥420 µmol/L in men and ≥360 µmol/L in women. Univariate and multivariate logistic regression models and subgroup analyses were applied to assess the relationship between HU and CTO. Results After adjustment, HU was noted to be associated with a 1.47-fold increase in the risk of CTO [odds ratio (OR), 1.47; 95% confidence interval (CI), 1.06–2.58; P = 0.026]. As a continuous variable, uric acid was an independent predictor of CTO (OR, 1.002; 95% CI, 1.001–1.004; P = 0.047). Subgroup analyses showed that the risk of CTO was higher among individuals under 65 years of age (OR, 2.77; 95% CI, 1.3–5.89), nonobese individuals (OR, 1.9; 95% CI, 1.16–3.1), and those with dyslipidemia (OR, 1.8; 95% CI, 1.04–3.11), while sex, smoking, hypertension, and diabetes did not show similar effects. Interaction analyses revealed no interaction among subgroups. Conclusion Among individuals residing in southwest China, HU was associated with an increased risk of CTO in non-CKD individuals, especially those under 65 years of age and nonobese and dyslipidemic individuals.

The pathogenesis of Alzheimer’s disease (AD) involves multiple pathophysiological processes. Oxidative stress is a major cause of AD-associated neuronal injury. The current research was designed to examine whether a novel (-)-meptazinol-serotonin hybrid (Mep-S) with potent antioxidant activity and additional inhibitory properties for acetylcholinesterase (AChE) activity could attenuate oxidative neuronal damage and cognitive deficits. In human SH-SY5Y cells, Mep-S suppressed H2O2-induced apoptosis by restoring mitochondrial membrane potential and inhibiting caspase-3 activation. Meanwhile, it attenuated oxidative stress elicited by H2O2 through lessening generation of reactive oxygen species as well as enhancing production of glutathione (GSH) and activity of superoxide dismutase (SOD). Mechanistically, Mep-S promoted nuclear translocation of a transcription factor nuclear factor E2-related factor-2 (Nrf2) in H2O2-challenged cells. This effect was accompanied by reduction in Kelch-like ECH-associated protein-1 (Keap1) levels as well as augmentation of Akt phosphorylation and expression of heme oxygenase-1 (HO-1) and NAD(P)H quinine oxidoreductase-1 (NQO-1). Molecular docking analysis revealed that Mep-S may disrupt the protein-protein interactions between Keap1 and Nrf2. In an in vivo mouse model, Mep-S attenuated scopolamine-caused cognitive deficits with inhibition of apoptotic neuronal death and brain AChE activity. Furthermore, the scopolamine-induced impairment of total antioxidant capacity and reduction in SOD1, SOD2, and γ-glutamate-cysteine ligase expression in the brain were counteracted by Mep-S, accompanied by decreased Keap1 levels, increased Akt catalytic subunit and Nrf2 phosphorylation, and decreased Nrf2, HO-1, and NQO-1 expression. Collectively, our results suggest that Mep-S ameliorates apoptotic neuronal death and memory dysfunction associated with oxidative stress by regulating the Nrf2/antioxidant enzyme pathway through inactivating Keap1 and phosphorylating Nrf2 via Akt activation. Therefore, Mep-S may be a potential lead for multitarget neuroprotective agents to treat AD-like symptoms.

Background & Aims Primary hyperparathyroidism(PHPT) has been evolving into a milder asymptomatic disease. No study has assessed the association between famine exposure and such a shift. We aim to explore the effects of China’s Great Famine exposure on the changing pattern of PHPT phenotypes. Methods 750 PHPT patients diagnosed from 2000 to 2019 were studied. The clinical presentations were compared between them in recent 10 years (2010-2019) and previous 10 years (2000-2009). Participants were then categorized into fetal, childhood, adolescent, adult exposure, and unexposed groups. Logistic regression was used to estimate the odds ratios (ORs) and confidence intervals (CIs) of famine exposure as factors contributing to the changes in the clinical presentations of PHPT. Results Serum levels of PTH, albumin-corrected Ca, tumor size, eGFR, BMDs (all P<0.001), and clinical symptoms became milder in recent 10 years. Famine exposure (72.6% vs 58.4%, P<0.001), especially the adult exposure (18.8% vs 4.1%, P<0.001)was significant less in recent 10 years. The ORs (95%CIs) of having upper 3 rd tertile PTH were 2.79(1.34,5.8), 2.07(1.04,4.11), 3.10(1.15,8.38) and 8.85(2.56,30.56) for patients with fetal, childhood, adolescent and adult famine exposure, respectively. The ORs (95%CIs) of upper 3 rd tertile albumin-corrected Ca and upper 3 rd tertile of tumor size was 4.78(1.39, 16.38) and 4.07(1.12,14.84) for participants with adult famine exposure, respectively. All these associations were independent of age, sex, disease duration and other confounders. Conclusions The clinical manifestations of PHPT in China continue to be milder. Exposure to famine is associated with PHPT. Less famine exposure might be responsible for the mile form of PHPT in recent years.

Objectives Fosfomycin resistance has become a clinical concern. In this study, we analysed the dynamic change of fosfomycin MIC in the epidemic Staphylococcus aureus lineages in a teaching hospital in Shanghai for 12 years and sought to elucidate the major underlying mechanisms. Methods MLST was conducted for 4580 S. aureus isolates recovered from 2008 to 2019. Fosfomycin MIC was determined by the agar dilution method. The genome data of 230 S. aureus epidemic lineage isolates were acquired from a next-generation sequencing (NGS) platform. Gene deletion and corresponding complementation mutants were constructed to confirm the mechanism of fosfomycin resistance. Results The predominant S. aureus lineages during the past 12 years were ST5 and ST239 (45.6%; 2090/4580). However, ST5 has been spreading clinically, while ST239 has gradually disappeared recently. Consistent with epidemic trends, fosfomycin-resistant ST5 increased from 19.5% to 67.3%. Most fosfomycin-resistant ST5 isolates (92.7%; 647/698) possessed high-level resistance (MIC > 1024 mg/L) with combined mutations mainly in glpT and uhpT. In contrast, fosfomycin-resistant ST239 isolates (76.8%; 149/194) mainly acquired low-level resistance (MIC = 64-128 mg/L) with mutation primarily in hptA. Deletion of a single resistant gene merely resulted in low-level fosfomycin resistance, while double-gene mutants Delta glpT Delta uhpT, Delta glpT Delta hptA and Delta glpT Delta hptR acquired high-level fosfomycin resistance. Conclusions The high-level fosfomycin resistance of S. aureus epidemic lineage ST5 is mainly due to the accumulation of mutations in the resistant genes related to membrane transporter systems, and partly contributes to its persistent prevalence under clinical antibiotic pressure.

Pneumonia caused by community-associated Staphylococcus aureus (CA-SA) has high morbidity and mortality. Pathogens can express a variety of virulence factors to promote infection. The game between the host immune system and pathogens determines the degree of infection and tissue damage, but its mechanism has not been well explored. In this study, we found that staphylokinase (SAK) is highly expressed in CA-SA lineage ST398 and promotes lung infection in both wild-type and cathelicidins-related antimicrobial peptide CRAMP knockout (CRAMP−/−) mice. Furthermore, our results showed that SAK can activate the host's innate immune inflammatory response. Importantly, SAK can promote the activation of NLRP3 inflammasome by increasing the production of ROS. This may be one of the important mechanisms of SAK aggravating CA-SA pneumonia after excluding its function of promoting fibrinolysis and neutralizing CRAMP. Our results emphasize the importance of controlling inflammation in acute lung infections, and also provides new insights into the pathogenesis of highly virulent CA-SA.

OBJECTIVES:Oxacillin-susceptible mecA-positive Staphylococcus aureus (OS-MRSA) is clinically significant and isolated globally but the mechanism of its occurrence remains indistinct. We sought to assess the mechanism of regulating oxacillin susceptibility in OS-MRSA isolates by evaluating the evolutionary dynamics of OS-MRSA and the discrepancies of mecA-regulating genes in OS-MRSA and oxacillin-resistant MRSA (OR-MRSA).METHODS:Nine OS-MRSA isolates and 77 OR-MRSA isolates were sequenced using next-generation sequencing (NGS) platforms. Two representative OS-MRSA isolates (ET-13, ET-16) were induced to be oxacillin resistant and sequenced also. OS-MRSA ET-16 and its counterpart isolate with induced oxacillin resistance, ET-16I, and their mutants were used to confirm the role of the bla system in regulating methicillin susceptibility. Oxacillin MICs were determined using Etests. Expression of mecA and blaR1 was quantified by quantitative RT-PCR.RESULTS:A deletion in blaR1 in most OS-MRSA isolates (7/9; 77.78%) was found using NGS data, and overexpression of OR-blaR1 in OS-MRSA isolate ET-16 restored its oxacillin resistance. OS-MRSA could be induced to be oxacillin resistant, while growth was suppressed in the induced isolates. Plasmid containing the bla locus was lost in most induced isolates during the induction process and complementation of blaR1-blaI from OS-MRSA ET-16 to the induced isolate ET-16I converted its oxacillin susceptibility.CONCLUSIONS:Deletion in blaR1 resulted in oxacillin susceptibility in OS-MRSA, and loss of the bla regulator in OS-MRSA restored oxacillin resistance. The bla system played a crucial role in regulating oxacillin susceptibility in OS-MRSA isolates.

Abstract We present a case with pulmonary atypical carcinoid and multiple hepatic metastases. Immunohistochemical staining of liver biopsy sample was negative for somatostatin receptor subtype 2, but 68Ga-NODAGA-LM3 PET/CT scan revealed multiple positive lesions. The mismatch was actually caused by heterogeneous expression of somatostatin receptor in liver lesions.

Staphylococcus aureus (S. aureus) is a clinical pathogen of great significance causing metastatic or complicated infections. ST5 clonotype isolates have dominated S. aureus infections for more than 10 years in Shanghai, China, and the proportion of methicillin-susceptible S. aureus (MSSA) has remarkably increased in the past decades. By whole-genome sequencing (WGS) 121 ST5 clonotype S. aureus isolates using next-generation sequencing (NGS) platforms and characterizing the evolutionary dynamics of ST5 linages, we found that MSSA evolved independently, making it a subtype differed from other MRSA clones. Drug resistance gene analysis by using the NGS data demonstrated that ST5 clonotype MRSA might be more tolerant under the threat of antimicrobials, which was confirmed in further in vitro susceptibility tests. However, MSSA subtype isolates exhibited relatively high virulence upon the analysis of virulence factors. Furthermore, MSSA subtype isolates displayed higher hemolysis capacity and higher ability to adhere to epithelial cells including A549 human alveolar epithelial cells and HaCaT human skin keratinocytes, caused more severe infections in murine abscess model. With its high virulence and enhanced magnitude in the past decades, the ST5 MSSA subtype poses a serious clinical threat hence more attention should be paid to the prevention and control.

The global increase of community-associated (CA) infections with methicillin-resistant Staphylococcus aureus (MRSA) is a major healthcare problem. Although sequence type (ST) 398 MRSA was first described as a livestock-associated (LA) lineage, human-adapted MRSA (HO-MRSA) ST398 without livestock contact has subsequently been reported from China in our previous study and other later research. The proportion of ST398 HO-MRSA has also remarkably increased in recent years in China. Based on 3878 S. aureus isolates that were collected in a general hospital between 2008 and 2018, we identified 56 ST398 HO-MRSA isolates. The four early appearing isolates of them have been sequenced by whole-genome sequencing (WGS) in our previous study. Here, by usage of WGS on the later-appearing 52 isolates and analyzing the phylogenetic dynamics of the linage, we found that 50 isolates clustered together with the former 4 isolates, making it a main clade out of MSSA clones and other MRSA clones, although ST398 HO-MRSA evolved with multiple origins. Drug resistance and virulence gene analysis based on the WGS data demonstrated that ST398 HO-MRSA main clade exhibited a similar pattern in both parts. Furthermore, they all carried a conserved variant of prophage 3 to guarantee virulence and a short SCCmec type V element of class D to maintain considerable lower methicillin resistance. Further phenotypical research verified that the epidemic HO-MRSA ST398 displayed enhanced biofilm formation ability when keeping high virulence. The dual advantages of virulence and biofilm formation in the HO-MRSA ST398 subtype promote their fitness in the community and even in the healthcare environment, which poses a serious threat in clinical S. aureus infections. Therefore, further surveillance is required to prevent and control the problematic public health impact of HO-MRSA ST398 in the future.

Objective To study the effect of N-Methyl-D-asparticacid ( NMDA ) on the intracellular free calcium concentration ( [ Ca2+] i ) in primary cultured rat calvaria osteoblasts. Methods A calcium imaging technique was applied to observe [ Ca2+] i changes in primary cultured rat calvaria osteoblasts after stimulating by NMDA with various concentrations or pretreated with NMDA receptor noncompetitive antagonism MK801 ( Dizocilpin) . Results Different concentrations of NMDA caused [ Ca2+] i increases in varying degrees and by different ways. NMDA could evoke transient increase and secondary change in [ Ca2+] i including calcium oscillation or steady increase. MK801 inhibited NMDA-induced [ Ca2+] i increase in varying degrees. Conclusion These results indicated that there are abundant functional NMDA receptors expressed in primary cultured rat calvaria osteoblasts, showing different forms and varying degrees of [ Ca2+] i increases in response to different concentrations of NMDA. The characters of the blocking effect of MK801 to NMDA-induced [ Ca2+] i increasing, indicated that the NMDA receptors expressed in primary cultured rat calvaria osteoblasts differ in channel properties from those in central nervous system.

We aimed to investigate associations among serum levels of LCN2, bone resorption marker carboxy-terminal cross-linking telopeptide of type-1 collagen (CTx), bone formation marker osteocalcin (OCN), and bone mineral densities (BMDs) in ambulatory healthy women.

BACKGROUND The aim of this study was to investigate the optimal vitamin D status in the middle-aged and elderly population residing in Shanghai, China. MATERIAL AND METHODS A total of 1,829 males and postmenopausal females older than 45 years of age in the Changfeng community of Shanghai were included in this study. The optimal vitamin D level was determined according to the suppression of parathyroid hormone (PTH) and the highest bone mineral density (BMD). Locally weighted scatter plot smoothing (LOWESS) was performed to study the correlations of 25(OH)D with PTH and BMD in the lumbar spine and total hip, adjusting for gender, age, weight, use of calcium and vitamin D supplements, eGFR, smoking status, and alcohol consumption. RESULTS The mean serum 25(OH)D concentration was 48.0±19.2 nmol/L for the whole study population. The circulating PTH was maximally suppressed by the serum 25(OH)D of 55 nmol/L in the total population (60 nmol/L for males and 50 nmol/L for females). The 25(OH)D concentrations corresponding to the highest BMD at lumbar spine (L1-L4) and total hip were 53 nmol/L and 75 nmol/L, respectively, for the whole population. These values were also higher in males than females. CONCLUSIONS The optimal 25(OH)D concentration of 55 nmol/L is sufficient to maintain the bone health and metabolic status in middle-aged and elderly individuals living in Shanghai. Males probably need higher vitamin D concentration than females. There are differences between vitamin D status based on lumbar spine BMD and total hip BMD.

Bone is an endocrine organ involved in modulating glucose homeostasis. The role of the bone formation marker osteocalcin (OCN) in predicting diabetes was reported, but with conflicting results. No study has explored the association between baseline bone resorption activity and incident diabetes or prediabetes during follow-up. Our objective was to examine the relationship between the baseline bone resorption marker crosslinked C-telopeptide of type I collagen (CTX) and glycemic dysregulation after 4 years. This longitudinal study was conducted in a university teaching hospital. A total of 195 normal glucose tolerant (NGT) women at baseline were invited for follow-up. The incidence of diabetes and prediabetes (collectively defined as dysglycemia) was recorded. A total of 128 individuals completed the 4-year study. The overall conversion rate from NGT to dysglycemia was 31.3%. The incidence of dysglycemia was lowest in the middle tertile [16.3% (95% confidence interval (CI), 6.8%-30.7%)] compared with the lower [31.0% (95% CI, 17.2%-46.1%)] and upper [46.5% (95% CI, 31.2%-62.6%)] tertiles of CTX, with a significant difference seen between the middle and upper tertiles (P=0.002 5). After adjusting for multiple confounding variables, the upper tertile of baseline CTX was associated with an increased risk of incident dysglycemia, with an odds ratio of 7.09 (95% CI, 1.73-28.99) when the middle tertile was the reference. Osteoclasts actively regulate glucose homeostasis in a biphasic model that moderately enhanced bone resorption marker CTX at baseline provides protective effects against the deterioration of glucose metabolism, whereas an overactive osteoclastic function contributes to an increased risk of subsequent dysglycemia.

Accumulating evidence suggests that oxidative stress is associated with osteoporosis. Serum uric acid (UA) is a strong endogenous antioxidant. Therefore, we investigated the relationship between the serum UA and BMD in Chinese men with T2DM. In this cross-sectional study of 621 men with T2DM, BMDs at lumbar spine (L2–4), femoral neck (FN), and total hip (TH) were measured by dual-energy X-ray absorptiometry (DXA). Serum levels of UA, calcium (Ca), 25-OH vitamin D3 (vitD3), parathyroid hormone (PTH), and creatinine (Cr) were also tested. Data analyses revealed that serum UA levels were positively associated with BMD at all sites (p<0.05) in men with T2DM after adjusting for multiple confounders. The serum UA levels were positively correlated with body weight (r=0.322), body mass index (BMI) (r=0.331), Ca (r=0.179), and Cr (r=0.239) (p<0.001) and were also positively associated with the concentrations of PTH (r=0.10,p<0.05). When compared with those in the lowest tertile of UA levels, men with T2DM in the highest tertile had a lower prevalence of osteoporosis or osteopenia (adjusted odds ratio 0.54, 95% confidence interval [CI] 0.31–0.95). These data suggest that higher serum levels of UA are associated with higher BMDs and lower risks of osteoporosis in Chinese men with T2DM.

Hyperphosphatemic familial tumoral calcinosis (HFTC) is a rare, autosomal recessive genetic disease. This disease is characterized by the progressive calcification of soft tissues leading to symptoms of pressure and hyperphosphatemia but normal concentrations of serum calcium with or without an elevation of 1,25-dihydroxyvitamin D3 levels.HFTC is caused by loss-of-function mutations in the GALNT3, FGF23 or KL genes. Here, we identified two novel mutations in the GALNT3 gene in a Chinese family with HFTC. Identification of a novel genotype in HFTC provides clues for understanding the phenotype-genotype relationships in HFTC and may assist not only in the clinical diagnosis of HFTC but also in the interpretation of the genetic information used for prenatal diagnosis and genetic counseling.

Searchable abstracts of presentations at key conferences on calcified tissues ISSN 2052-1219 (online)

Mammalian target of rapamycin (mTOR) is a Ser/Thr kinase conserved through evolution that coordinates extra cellular signals associated with cell growth. Main functions of mTOR present in the form of two complexes, namely mTORC1 and mTORC2, which are distinct in their unique components, raptor and rictor. In the current study, using a Cre/loxp system, we found an anabolic effect of mTORC2 signaling on skeleton. Osteoblast differentiation was reduced, with down-regulation of mTORC2 signaling activity in primary cultures of osteoblasts that did not contain rictor. Mice with a specific deletion of rictor in mature osteoblasts showed a significant reduction in lean mass and bone mineral density by dual energy x-ray absorptiometry analysis. Micro-computed tomography, histomorphometric, and molecular biological analyses revealed a marked impairment of the cortical bone mass and microarchitecture, as well as minor changes in trabecular bone, of the Rictorob-/- mice. Cortical bone mass and thickness of the femoral mid-shaft were dramatically reduced, with unusual increases in porosity and marrow area in Rictorob-/- mice. Thinner trabeculae were found in the L4 vertebrae with relatively normal structural indices of trabecular numbers and separation. A lower rate of bone turnover was observed, as the consequence of the decreased individual osteoblast activity and bone resorption. Furthermore, these changes were associated with significantly decreased bone biomechanical properties. In conclusion, expression of rictor in osteoblasts is essential for the maintenance of normal bone remodeling and microarchitecture, especially for the maintenance of the cortical bone.

Diabetes is a disease characterized by hyperglycemia and a series of chronic complications. Evidence from rodents and human studies indicates defective bone quality and a higher risk of fractures in the diabetic state. Thus, bone should be an additional target organ for diabetes treatment. Liraglutide, a glucagon-like peptide-1 (GLP-1) receptor agonist (GLP-1RA), is effective in treating diabetes. Because functional receptors for GLP-1 are expressed on osteoblasts, it is interesting to ask whether GLP1RA treatment in diabetic rodents has any effect on the skeleton. Indeed, continuous subcutaneous infusion of GLP-1 for 3 days in both insulin-resistant and type 2 diabetic rat models can normalize impaired trabecular architecture and promote bone formation. These findings highlight the potential use of GLP-1RAs in combating diabetes-related bone defects. However, it is not clear whether daily liraglutide injections could also have osteogenic effects in diabetic rat models. Thus, the aim of the present study was to assess changes in bone mineral density (BMD) and bone micro-architecture in spontaneous diabetic GotoKakizaki (GK) rats receiving daily administration of liraglutide. Twelve 2-week-old male diabetic GK rats were treated with daily subcutaneous liraglutide injections (0.4 mg/kg per day) or vehicle (normal saline) for 4 weeks (n = 6 in each group), as described previously. Another six agematched male Wistar rats were used as a normal control group. After 4 weeks treatment, rats were killed by an overdose of sodium pentobarbital. The right femurs and lumbar vertebrae were kept in 4% paraformaldehyde in 0.1 mol/L phosphate-buffered saline (PBS; pH 7.4) for micro-computed tomography (micro-CT; GE Explore Locus SP Specimen Scanner; GE Healthcare, London, UK), whereas the bone marrow was flushed out of the left femurs with 0.1 mol/L ice-cold PBS, which were then packed with aluminum foil and stored at −80°C until polymerase chain reaction (PCR). The bone volume/total volume (BV/TV) ratio, trabecular number (Tb.N), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), and cortical thickness were determined in right femurs and vertebrae by micro-CT using Explore MicroView version 2.2 (GE Healthcare). Total RNA was extracted from left femurs using Trizol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was then generated using the Reverse Transcription System (Promega, Madison, WI, USA) and analyzed using SYBR Premix Ex Taq (TAKARA, Otsu, Japan) in a light cycler instrument (Roche, Basel, Switzerland). All reactions were performed in triplicate and expression of target genes was normalized against that of the housekeeping gene GAPDH. The PCR primer sequences obtained from the Primerbank website (http://pga.mgh .harvard.edu/primerbank/, accessed 13 March 2015) were as follows: GAPDH: CTCAACTACATGGTCTA CATGT (forward) and CTTCCCATTCTCAGCCTT GACT (reverse); runt-related transcription factor 2 (Runx2), ACTGGCGGTGCAACAAGA (forward) and TAGTTCTCATCATTCCCGGC (reverse); alkaline phosphatase (ALP), CCAAAAACTCAACAC CAACG (forward) and TCCATCTCCAGCCGTGTCT (reverse); collagen 1 (COLL), TGTCCCAACCCCC AAAAA (forward) and ATGACTTCTGCGTCTGGT GAT (reverse); osteocalcin (OC), TGCAGACCTA GCAGACACCAT (forward) and ACTCAGAGTCG CTGGGCTTT (reverse); osteoprotegerin (OPG), CAT Correspondence Jian-min Liu, 197 Rui-jin Er Road, Shanghai, China. Tel.: +86 21 64370045 665391 Fax: +86 21 64373514 Email: liujianmin@medmail.com.cn

Recently, a number of studies have demonstrated the potential beneficial role for novel anti-diabetic GLP-1 receptor agonists (GLP-1RAs) in the skeleton metabolism in diabetic rodents and patients. In this study, we evaluated the impacts of the synthetic GLP-1RA Liraglutide on bone mass and quality in osteoporotic rats induced by ovariectomy (OVX) but without diabetes, as well as its effect on the adipogenic and osteoblastogenic differentiation of bone marrow stromal cells (BMSCs). Three months after sham surgery or bilateral OVX, eighteen 5-month old female Wistar rats were randomly divided into three groups to receive the following treatments for 2 months: (1) Sham + normal saline; (2) OVX + normal saline; and (3) OVX + Liraglutide (0.6 mg/day). As revealed by micro-CT analysis, Liraglutide improved trabecular volume, thickness and number, increased BMD, and reduced trabecular spacing in the femurs in OVX rats; similar results were observed in the lumbar vertebrae of OVX rats treated with Liraglutide. Following in vitro treatment of rat and human BMSCs with 10 nM Liraglutide, there was a significant increase in the mRNA expression of osteoblast-specific transcriptional factor Runx2 and the osteoblast markers alkaline phosphatase (ALP) and collagen α1 (Col-1), but a significant decrease in peroxisome proliferator-activated receptor γ (PPARγ). In conclusion, our results indicate that the anti-diabetic drug Liraglutide can exert a bone protective effect even in non-diabetic osteoporotic OVX rats. This protective effect is likely attributable to the impact of Liraglutide on the lineage fate determination of BMSCs.