Although immune checkpoint inhibitors (ICIs) targeting pathways involving programmed cell death 1 (PD-1) and its ligand (PD-L1) are promising for some diseases, they have shown modest responses in ovarian cancer patients. Multiple studies have shown that ICI resistance is associated with the prevalence of transforming growth factor (TGF)-β signaling in the tumor microenvironment (TME). In patients with ovarian cancer, TGF-β expression is associated with immunosuppressive features in the TME and poor prognosis. PD-1 and TGF-β inhibitory pathways play independent yet complementary roles in immunosuppression, providing rationale for simultaneous targeting of both pathways. However, agnostic inhibition of the TGF-β pathway has historically led to detrimental side effects. Therefore, we developed a bispecific Biclonics® antibody that conditionally blocks the TGF-β pathway through TGFβR2, only on immunosuppressed T cells that coexpress PD-1. In this study, we tested the efficacy of the dual PD-1- and TGFβR2-binding Biclonics® antibody, INCA33890, in models of ovarian cancer. We used patient ascites (N=6) as a model of ovarian TME. INCA33890 treatment resulted in significantly higher levels of secreted interferon (IFN)-γ compared with control antibodies targeting only PD-1 (pembrolizumab) or TGFβR2 (TGF-1). A significant increase in T-cell activation markers, such as CD137, CD25, and CD69, was also observed in some samples treated with INCA33890 compared with controls. Next, we tested INCA33890 in an autologous coculture of tumor-infiltrating lymphocytes expanded from an enzymatically digested-patient tumor and enriched tumor cells from the same patient. In these cocultures, IFN-γ levels were significantly higher with INCA33890 treatment compared with pembrolizumab; levels were similar compared with TGF-1. For an in vivo assessment, we used double huPD1/huTGFβR2 knock-in mice implanted with ovalbumin (ova) and luciferase-expressing murine ovarian cancer ID8 cells. Mice treated with INCA33890 showed a significant reduction in tumor burden and improved survival compared with controls. A significant increase in tumor-associated ova-specific CD8+ T cells was observed with INCA33890 treatment compared with controls. Phenotypic analysis of CD8+ T cells revealed a skew toward an effector memory subset (CD44high; CD62Llow expression) with INCA33890 treatment. Thus, INCA33890 showed favorable results in a humanized ovarian cancer model and demonstrated a tumor antigen-specific T-cell response resulting in reduced tumor burden. Altogether, we show that INCA33890 presents a promising immunotherapy option for patients with advanced ovarian cancer by targeting 2 prominent immunosuppressive pathways, leading to a coordinated immune response. Clinical assessment of INCA33890 for various advanced malignancies, including ovarian cancer, is ongoing (NCT05836324). Veethika Pandey, Kay M. Foos, Isabella Pargiolas, Mathilde Poussin, Ashwini Kulkarni, Liang-Chuan Wang, Patrick Mayes, Daniel J. Powell Jr. INCA33890, a bispecific antibody targeting PD-1 and TGFβR2, shows enhanced immune responses in models of ovarian cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2025; Part 1 (Regular Abstracts); 2025 Apr 25-30; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2025;85(8_Suppl_1):Abstract nr 6074.

PDF file - 1935K, Figure S3. shRNA based silencing of FRa in A1847 ovarian cancer cells. The parental human ovarian cancer cell line A1847 which expresses surface mesothelin and FRa protein was transduced with lentiviral particles encoding for an shRNA specific for silencing FRa gene expression (A1847 sh4 M+/F-). To determine surface antigen expression, cells were stained with an anti-mesothelin biobody reagent (P4 Bb) and anti-FRa antibody or proper isotype antibody controls. FRa expression was unaltered after engineering cells with control shRNA (A1847 csh M+/F+).

PDF file - 583K, Figure S6. Trans-, but not cis-, signaling CART cells exhibit more limited in vitro activity against cells bearing single antigen. IFN-γ secretion by trans M-z/F-28 CART cells was significantly reduced in response to A1847M+/F- cells compared with parental A1847M+/F+. M-z, M-z/F-28, or M-28z transduced T cells (1 x 105 T cells) were cultured alone (none) or stimulated overnight with an equal number of C30, A1847M+/F+ or A1847M+/F- cells. Cell-free supernatant was harvested after ~20 hours of incubation and the IFN- γ levels were measure with ELISA. Mean IFN- γ concentration plus-minus SEM (pg/ml) from triplicate cultures is shown. *P < 0.05 comparing the IFN- γ secretion produced by M-z/F-28 CART cells against A1847M+/F+ versus A1847M+/F- cells.

Supplementary Figure Legend - PDF file 61K, Supplementary figure legend

PDF file - 514K, Figure S4. A1847 (M+/F+) and A1847 (M+/F-) cells exhibit similar in vitro growth rate. 1 x 106 A1847 (M+/F+) and A1847 (M+/F-) cells were seeded on day 0 and their in vitro growth kinetics were monitored by determining viable cells using the trypan blue exclusion method.

Peripheral T-cell lymphomas (PTCLs) are a heterogeneous group of lymphoid malignancies associated with poor prognosis due to ineffective treatment options and high rates of relapse. The success of chimeric antigen receptor T-cell (CART) therapy for certain hematologic malignancies makes it an attractive treatment option for PTCLs. However, shared expression of potential target antigens by both malignant and healthy T cells poses a challenge. Current prospective CART approaches cause a high degree of on-target, off-tumor activity, resulting in fratricide during CART expansion, depletion of healthy T cells in vivo, and immune compromise in the patient. To limit off-tumor targeting, we sought to develop a CART platform specific for a given T-cell receptor vβ (TCRvβ) family that would endow CAR-modified T cells with the ability to mediate lysis of the clonal malignant population while preserving the majority of healthy T cells. Here, CAR constructs specific for multiple TCRvβ family members were designed and validated. Our results demonstrate that TCRvβ-family-specific CARTs (TCRvβ-CARTs) recognize and kill TCRvβ-expressing target cells. This includes specific self-depletion of the targeted cell subpopulation in the CART product and lysis of cell lines engineered to express a target TCRvβ family. Furthermore, TCRvβ-CARTs eliminated the dominant malignant TCRvβ clone in 2 patient samples. Finally, in immunodeficient mice, TCRvβ-CARTs eradicated malignant cells in a TCRvβ-dependent manner. Importantly, the nontargeted TCRvβ families were spared in all cases. Thus, TCRvβ-CART therapy provides a potential option for high-precision treatment of PTCL with limited healthy T-cell depletion.

Supplementary Figure 4 from In Vivo Persistence, Tumor Localization, and Antitumor Activity of CAR-Engineered T Cells Is Enhanced by Costimulatory Signaling through CD137 (4-1BB)

PDF file - 67K, Upper. CD28 co-stimulation protects against antigen-induced cell death. Annexin V and 7-AAD staining of T cells (untransduced, BBIR-z and BBIR-28z) following 72 h (grey bars) and 96 h (black bars) co-culture with A1847 at an E:T ratio 1:1, painted with either Bio-IgG1 or Bio-EpCAM antibodies. Apoptosis was quantified as a percentages of apoptotic cells- Annexin V+ and 7AAD+ (means SEM; n = 3). Lower. Annexin V/7-AAD assay plots showing T cells after 96 h co-culture with A1847 cell line labeled with biotinylated IgG1 (Bio-IgG1) (top panels) and biotinylated EpCAM specific (Bio-EpCAM) antybodies, at an E:T ratio of 1:1. One representative FACS analysis is shown (n=3).

Supplementary Figures Legends 1-5 from In Vivo Persistence, Tumor Localization, and Antitumor Activity of CAR-Engineered T Cells Is Enhanced by Costimulatory Signaling through CD137 (4-1BB)

CCR Translation for This Article from CD137 Accurately Identifies and Enriches for Naturally Occurring Tumor-Reactive T Cells in Tumor

Supplementary Figure Legend from Follicle-Stimulating Hormone Receptor as a Target in the Redirected T-cell Therapy for Cancer

The expression of 18S used as a internal control (housekeeper). cDNA was constructed from total RNA isolated from 10e5 cells (cultured at 60-70% confluence). PCR performed using intron-spanning primers. Validation criteria included water blanks, and NO RT samples. For human 18SrRNA 5’CAGCCACCCGAGATTGAGCA3’ and Rev: 5’TAGTAGCGACGGGCGGTGTG3’ (amplicon 253bp) (Genbank:: NR_003286.2). For mouse ID8 cell line Ribosomal RNA for mouse Eukaryotic small ribosomal subunit [Genbank: NR_003278] primers Fw: 5’AGGGGAGAGCGGGTAAGAGA-3’ and Rev: 5’GGACAGGACTAGGCGGAACA3’ were used (amplicon size of 249bp).

Supplementary Methods and Materials from In Vivo Persistence, Tumor Localization, and Antitumor Activity of CAR-Engineered T Cells Is Enhanced by Costimulatory Signaling through CD137 (4-1BB)

PDF file - 1125K, Figure S1. Correlated scFv and GFP transgene expression following F-28 CAR transduction. T cells were lentivirally transduced to express the costimulatory F-28 CAR and 5 days later were stained for surface scFv using biotinylated protein-L followed by SA-APC. Transduction efficiency was also monitored using GFP transgene expression. Transduction efficiencies are indicated with the percentage of CAR expression of the transduced populations. Coordinate expression of surface scFv and GFP was observed in all experiments.

PDF file - 113K, Flow Cytometry analysis of an antigen surface expression on mouse AE17 cell lines transduced to express human FR or mesothelin and human ovarian cancer cell line, A1847. FR-specific mAb Mov18, EpCAM-specific and mesothelin-specific K1 antibody and P4 Biobody were used to measure antigen expression on tumor cell lines (open empty histogram), compared to a matched isotype Ab control (filled gray histogram). Numbers within plots refer to specific mean fluorescent intensity (MFI).

CD137 Supplementary Figs 1, 2 - PDF file 169K, Supplementary Figure 1. Ovarian cancer containing tumor specific reactive T cells. Supplementary Figure 2. CD137-enriched ovarian cancer TILs slow tumor growth in vivo.

PDF file - 854K, Figure S5. F-28z CART cells produce dramatically less IFN-γ in response to stimulation with A1847 (M+/F-) cells compared to A1847 (M+/F+) cells. A. F-28z CAR expression on human CD3+ T cells upon transduction with lentivirus compared to untransduced T cells. F-28z CART transduced T cells were detected using biotinylated-protein L followed by SA-PE. B. Transduced T cells (1 x 105 T cells) were cultured alone (none) or stimulated overnight with an equal number of either FRa-negative PEO-1 cells or A1847 (M+/F-) cells, or FRa-positive A1847 (M+/F+) cancer cells. Cell-free supernatant was harvested after ~20 hours of incubation and the IFN-γ levels were measured with ELISA. Mean IFN-γ concentration plus-minus SEM (pg/ml) from triplicate cultures is shown. ***P < 0.001 comparing the IFN-γ secretion produced by M-z/F-28 CART cells against A1847M+/F+ versus A1847M+/F- or PEO cells.