Skin and hair development is regulated by multitude of programs of activation and silencing of gene expression to maintain normal skin and hair follicle (HF) development, homeostasis, and cycling. Here, we have identified E74-like factor 5 (Elf5) transcription factor, as a novel regulator of keratinocyte proliferation and differentiation processes in skin. Expression analysis has revealed that Elf5 expression was localised and elevated in stem/progenitor cell populations of both the epidermis (basal and suprabasal) and in HF bulge and hair germ stem cell (SCs) compartments during skin and hair development and cycling. Expressional and functional analysis using RT-qPCR, western blot and colony forming assays, revealed that Elf5 plays an important role in regulating keratinocyte proliferation and differentiation processes as well as potentially determining cell fate by regulating the stem/progenitor cell populations in skin and HFs. These data will provide a platform for pharmacological manipulation of Elf5 in skin, leading to advancements in many areas of research, including stem cell, regenerative medicine, and ageing.

Skin and hair development is regulated by complex programs of gene activation and silencing and microRNA-dependent modulation of gene expression to maintain normal skin and hair follicle development, homeostasis, and cycling. In this study, we show that miR-148a, through its gene targets, plays an important role in regulating skin homeostasis and hair follicle cycling. RNA and protein analysis of miR-148a and its gene targets were analyzed using a combination of in vitro and in vivo experiments. We show that the expression of miR-148a markedly increases during telogen (bulge and hair germ stem cell compartments). Administration of antisense miR-148a inhibitor into mouse skin during the telogen phases of the postnatal hair cycle results in accelerated anagen development and altered stem cell activity in the skin. We also show that miR-148a can regulate colony-forming abilities of hair follicle bulge stem cells as well as control keratinocyte proliferation/differentiation processes. RNA and protein analysis revealed that miR-148a may control these processes by regulating the expression of Rock1 and Elf5 in vitro and in vivo. These data provide an important foundation for further analyses of miR-148a as a crucial regulator of these genes target in the skin and hair follicles and its importance in maintaining stem/progenitor cell functions during normal tissue homeostasis and regeneration.

MicroRNAs (miRNAs) are a family of small noncoding RNAs (~19-24 nt) playing a key role in the execution of gene expression programs in various cells and tissues. Many technical challenges have been encountered when investigating miRNAs, in particular, determining the spatiotemporal expression pattern of miRNAs in cells and tissues. We describe here a well-established in situ hybridization protocol for the detection and analysis of spatiotemporal expression patterns of miRNAs in skin and its appendages such as the hair follicle in both frozen and paraffin-embedded tissue sections. We describe in detail the different steps that are associated with utilizing in situ hybridization procedure on either frozen or paraffin-embedded tissues for miRNAs localization. Postfixation, tissues are hybridized with LNA double labeled probes with digoxygenin. Detection of hybridized probes is performed by using an alkaline phosphatase coupled antibody against digoxygenin. The final step involves the use of substrates to develop the color of alkaline phosphatase-LNA-probe structure leading to identification of the spatiotemporal location of target miRNAs in target tissue and cells. We also discuss two options for substrate color development in these procedures: (1) NBT/BCIP and (2) BM Purple. This method is a simple and convenient way of determining the spatiotemporal expression pattern of miRNAs, which has been a challenge since their discovery, due to their relatively small size. Knowledge gained from in situ hybridization is crucial for better understanding of the roles of individual miRNA(s) during distinct stages of development in various cells and tissues. These protocols will be beneficial to the wider scientific community.

Aging is a complex process characterized by progressive decline in physiological and biochemical performance of individual tissues and organs. In aged skin, reduced cell proliferation and functional decline of epithelial and mesenchymal cells underlie age-related changes, such as dry skin (xerosis), loss of elasticity, and functional senescence, leading to increased susceptibility to aging-associated conditions such as skin cancer and poor wound healing (Engelke et al., 1997Engelke M. Jensen J.M. Ekanayake-Mudiyanselage S. Proksch E. Effects of xerosis and ageing on epidermal proliferation and differentiation.Br J Dermatol. 1997; 137: 219-225Crossref PubMed Scopus (123) Google Scholar, Zhang et al., 2009Zhang M. Poplawski M. Yen K. Cheng H. Bloss E. Zhu X. et al.Role of CBP and SATB-1 in aging, dietary restriction, and insulin-like signaling.PLOS Biol. 2009; 7: e1000245Crossref PubMed Scopus (79) Google Scholar). MicroRNAs (miRNAs) are small noncoding RNAs involved in the post-transcriptional regulation of coding-gene expression. They provide an additional level of control for important cellular processes such as growth, differentiation, and remodeling of skin (Botchkareva, 2017Botchkareva N.V. The molecular revolution in cutaneous biology: noncoding RNAs: new molecular players in dermatology and cutaneous biology.J Invest Dermatol. 2017; 137: e105-e111Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). In addition, miRNAs can regulate the expression of important epigenetic regulators, including DNA methyltransferases, histone deacetylases, and polycomb group genes. Disruption of the miRNA-epigenetic regulatory network was shown to interfere with normal physiological cellular functions, leading to activation of disease processes (reviewed in [Sato et al., 2011Sato F. Tsuchiya S. Meltzer S.J. Shimizu K. MicroRNAs and epigenetics.FEBS Journal. 2011; 278: 1598-1609Crossref PubMed Scopus (480) Google Scholar]). By fine-tuning biological systems, miRNAs can contribute to healthy aging or development of age-related diseases, and may serve as useful diagnostic or prognostic biomarkers for age-related diseases (Olivieri et al., 2012Olivieri F. Spazzafumo L. Santini G. Lazzarini R. Albertini M.C. Rippo M.R. et al.Age-related differences in the expression of circulating microRNAs: miR-21 as a new circulating marker of inflammaging.Mech Ageing Dev. 2012; 133: 675-685Crossref PubMed Scopus (183) Google Scholar). MicroRNA-21 (miR-21) plays an important role in the development of a number of pathological skin conditions including psoriasis, tumorigenesis, and poor wound-healing (Ahmed et al., 2011Ahmed M.I. Mardaryev A.N. Lewis C.J. Sharov A.A. Botchkareva N.V. MicroRNA-21 is an important downstream component of BMP signalling in epidermal keratinocytes.J Cell Sci. 2011; 124: 3399-3404Crossref PubMed Scopus (59) Google Scholar, Meisgen et al., 2012Meisgen F. Xu N. Wei T. Janson P.C. Obad S. Broom O. et al.MiR-21 is up-regulated in psoriasis and suppresses T cell apoptosis.Exp Dermatol. 2012; 21: 312-314Crossref PubMed Scopus (127) Google Scholar, Yang et al., 2011Yang X. Wang J. Guo S.L. Fan K.J. Li J. Wang Y.L. et al.miR-21 promotes keratinocyte migration and re-epithelialization during wound healing.Int J Biol Sci. 2011; 7: 685-690Crossref PubMed Scopus (131) Google Scholar). However, the role of miR-21 in skin aging has not been investigated yet. Here, we identify miR-21 as a contributor to skin aging, at least in part, by negative regulation of the chromatin remodeler SATB1 in keratinocytes. The expression of miR-21 was examined in skin of young and aged mice (8-week-old vs 2-year-old) and human female donors (48, 60–62, and 78 years old; Supplementary Materials and Methods). Quantitative reverse transcriptase–PCR (RT-qPCR) analysis revealed a prominent increase in miR-21 expression in both mouse and human aged skin (Figure 1a and b). In contrast to miR-21, the level of miRNA-199a, which is not detectable in the epidermis of either mouse or human skin, was used as a control for this study (Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C.J. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (628) Google Scholar, Yi et al., 2006Yi R. O'Carroll D. Pasolli H.A. Zhang Z. Dietrich F.S. Tarakhovsky A. et al.Morphogenesis in skin is governed by discrete sets of differentially expressed microRNAs.Nat Genet. 2006; 38: 356-362Crossref PubMed Scopus (452) Google Scholar) and was not altered during the aging process in human skin (Figure 1b). Using in situ hybridization, we confirmed increased miR-21 expression in the epidermis and dermis of aged mouse and human skin (Figure 1c and d). Our data are consistent with published reports showing the elevation of miR-21 in age-associated cardiovascular diseases in human patients (Olivieri et al., 2012Olivieri F. Spazzafumo L. Santini G. Lazzarini R. Albertini M.C. Rippo M.R. et al.Age-related differences in the expression of circulating microRNAs: miR-21 as a new circulating marker of inflammaging.Mech Ageing Dev. 2012; 133: 675-685Crossref PubMed Scopus (183) Google Scholar) and in kidneys of aged mice (Sataranatarajan et al., 2012Sataranatarajan K. Feliers D. Mariappan M.M. Lee H.J. Lee M.J. Day R.T. et al.Molecular events in matrix protein metabolism in the aging kidney.Aging Cell. 2012; 11: 1065-1073Crossref PubMed Scopus (34) Google Scholar).Figure 1MiR-21 is elevated in aging skin and targets SATB1 in keratinocytes. (a, b) RT-qPCR analysis of miR-21 expression in young vs aged mice (8-week-old vs. 2-year-old) and human female donor skins (F48, F60–62, F78); miR-21 expression is upregulated in aged mouse and human epidermis. Data are presented as mean ± SEM values from three (mouse) or two (human) independent samples and three independent experiments each. (c, d) Representative photomicrographs of in situ hybridization for miR-21; miR-21 expression is elevated in the epidermis (arrowheads) and dermis of aged mouse and human skins. Data are presented from three (mouse) and two (human) independent samples. (e) RT-qPCR analysis of differentiation-related genes in young versus aged mice; a decrease in expression is observed for all genes analyzed. Data are presented as mean ± SEM values from three independent samples and experiments. (f) RT-qPCR analysis in young versus aged human skin; a decrease in expression is observed for all differentiation-associated genes analyzed. Data are presented as mean ± SEM values from two independent samples and three independent experiments. (g, h) Transfection with pro-miR-21 mimic in primary mouse and human keratinocytes causes a significant decrease in the expression of Krt1 and Ivl (mouse) and KRT1, KRT10, KRT14, and IVL (human). Data is presented as mean ± SEM values from three independent experiments. (i) Venn diagram of predicted miR-21 gene targets. A table showing the top ten miR-21 target genes listed as the most conserved between human and mouse genomes, including SATB1. (j) Significant reduction in luciferase activity in HaCaT cells cotransfected with pro-miR-21 mimic and the SATB1-3′ UTR (wt-3′UTR) construct encompassing the putative miR-21 target site. No changes in luciferase activity were detected when the miRNA binding site was mutated (mut-3′UTR). Bold letters represent miR-21 seed region. Underlined letters represent predicted binding sites within SATB1-3'UTR. Each sample was normalized to Renilla luciferase activity. Data is presented as mean ± SEM values from three independent experiments. (k–n) RT-qPCR and western blot analysis; SATB1 mRNA and protein levels are significantly decreased and increased after transfection with pro-miR-21 or anti-miR-21, respectively, in both primary mouse and human keratinocytes. Data are presented as mean ± SEM values from three independent experiments. Western blot data shown are from a single representative experiment out of three repeats. *P < 0.05, **P < 0.01, ***P < 0.001; Student's t-test. The broken lines demarcate the epidermal–dermal border. miR-199a, microRNA-199a; miR-21, microRNA-21; mut, mutated; RT-qPCR, quantitative reverse transcriptase–PCR; SEM, standard error of the mean; UTR, untranslated region; wt, wild type. Bar = 50μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Human skin aging is associated with a decrease in the expression of keratinocyte differentiation-associated markers (Engelke et al., 1997Engelke M. Jensen J.M. Ekanayake-Mudiyanselage S. Proksch E. Effects of xerosis and ageing on epidermal proliferation and differentiation.Br J Dermatol. 1997; 137: 219-225Crossref PubMed Scopus (123) Google Scholar). Indeed, a significant reduction in the expression of keratinocyte differentiation-related genes was observed in aged mouse (P < 0.05) and human skin (Figure 1e and f). Forced expression of miR-21 in both primary mouse and human keratinocytes transfected with pro-miR-21 mimic resulted in significant reduction in Krt1 and Ivl (P < 0.05, mouse) and KRT1 (P < 0.01), KRT10, KRT14, and IVL expressions (P < 0.05, human) (Figure 1g and h). This suggests that miR-21 potentially can contribute to skin aging by downregulating keratinocyte differentiation-related genes, possibly leading to cellular senescence (Dellago et al., 2013Dellago H. Preschitz-Kammerhofer B. Terlecki-Zaniewicz L. Schreiner C. Fortschegger K. Chang M.W.F. et al.High levels of oncomiR-21 contribute to the senescence-induced growth arrest in normal human cells and its knock-down increases the replicative lifespan.Aging Cell. 2013; 12: 446-458Crossref PubMed Scopus (88) Google Scholar) and contributing to increased susceptibility to age-related pathological conditions. To identify potential putative miR-21 targets, we performed bioinformatics analysis as done previously (Ahmed et al., 2014Ahmed M.I. Alam M. Emelianov V.U. Poterlowicz K. Patel A. Sharov A.A. et al.MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway.J Cell Biol. 2014; 207: 549-567Crossref PubMed Scopus (49) Google Scholar). By interrogating predicted miR-21 targets from three different databases, we identified 35 potential genes whose expression may be regulated by miR-21. Ten of these genes, including Satb1, have highly conserved miR-21 target sequences between human and mouse genomes (Figure 1i). SATB1 is a nuclear protein operating as a genome organizer, which originally was identified as an essential mediator of normal T-cell development regulating the large-scale chromatin remodeling and enhancer–promoter interactions in several lineage-specific gene loci (Cai et al., 2003Cai S. Han H.J. Kohwi-Shigematsu T. Tissue-specific nuclear architecture and gene expression regulated by SATB1.Nat Genet. 2003; 34: 42-51Crossref PubMed Scopus (345) Google Scholar). In the skin, SATB1 is essential for higher-order chromatin folding and transcriptional regulation of the epidermal differentiation complex locus in keratinocytes (Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar). Interestingly, genetic ablation of Satb1 in mouse skin causes thinning of the epidermis accompanied by downregulation in the expression of terminal differentiation-associated genes (Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar). We confirmed the direct regulation of Satb1 by miR-21 using a luciferase reporter assay. Cotransfection of HaCaT cells with pro-miR-21 mimic and the Satb1 3′ untranslated region reporter construct caused a significant reduction in luciferase activity (P < 0.001) compared with their corresponding controls, whereas this effect was not detected when miR-21 binding sites in the Satb1 3′ untranslated region were mutated (Figure 1j). This is consistent with published data showing miR-21 targeting of SATB1 in rectal cancer cells (Lopes-Ramos et al., 2014Lopes-Ramos C.M. Habr-Gama A. Quevedo Bde S. Felício N.M. Bettoni F. Koyama F.C. et al.Overexpression of miR-21-5p as a predictive marker for complete tumor regression to neoadjuvant chemoradiotherapy in rectal cancer patients.BMC Med Genomics. 2014; 7: 68Crossref PubMed Scopus (65) Google Scholar). The functional interactions of miR-21 and SATB1 in keratinocytes were evaluated by transfecting primary human and mouse epidermal keratinocytes with pro-miR-21 mimic and anti-miR-21, which resulted in the decreased and increased expression of SATB1 mRNA and protein, respectively, as determined by RT-qPCR and western blot (Figure 1k–n, Supplementary Materials and Methods). Additionally, reduced Satb1 expression was confirmed by RT-qPCR and immunofluorescent analysis in both mouse and human aged epidermis (Figure 2a–d). To further explore the plausible functional link between miR-21 and SATB1 in skin aging, we overexpressed SATB1 and miR-21 in keratinocytes using SATB1-expressing lentiviral particles or pro-miR-21 mimic. We confirmed the increased expression of Satb1 (SATB1 Leti + miR-Control) or miR-21 (Control Leti + pro-miR-21) in primary mouse epidermal keratinocytes as determined by RT-qPCR (Figure 2e and f, Supplementary Materials and Methods). However, coexpression of both SATB1 and miR-21 (SATB1 Leti + pro-miR-21) significantly reduced SATB1 expression (Figure 2e). RT-qPCR analysis also revealed that Satb1 induces expression of differentiation-associated genes, supporting its role as a promoter of terminal keratinocyte differentiation (Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar). Forced expression of miR-21 abolished SATB1-induced upregulation of Krt1, Krt10, and Krt17 (Figure 2g). Therefore, our data suggest that miR-21 contributes to the age-associated alterations in gene expression, at least in part, by targeting Satb1. The downregulation of SATB1 in human keratinocytes by miRNA-191 has been shown to establish epigenetic modifications leading to senescence (Lena et al., 2012Lena A.M. Mancini M. Rivetti di Val Cervo P. Saintigny G. Mahé C. Melino G. et al.MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation.Biochem Biophys Res Commun. 2012; 423: 509-514Crossref PubMed Scopus (49) Google Scholar). SATB1 has also been associated with increased lifespan, whereas a reduction in its expression was seen with age and in age-related pathologies, such as diabetes in mice, demonstrating the general involvement of SATB1 in counteracting the senescence and/or aging pathways (Zhang et al., 2009Zhang M. Poplawski M. Yen K. Cheng H. Bloss E. Zhu X. et al.Role of CBP and SATB-1 in aging, dietary restriction, and insulin-like signaling.PLOS Biol. 2009; 7: e1000245Crossref PubMed Scopus (79) Google Scholar). An increasing number of studies have identified miR-21 as a senescence, inflammation, and cancer-associated miRNA (Olivieri et al., 2013Olivieri F. Rippo M.R. Procopio A.D. Fazioli F. Circulating inflamma-miRs in aging and age-related diseases.Front Genet. 2013; 4: 121Crossref PubMed Scopus (145) Google Scholar). Therefore, our data suggest that the negative regulation of SATB1 by miR-21 in keratinocytes may be an important age-phase–specific regulation leading to senescence and promoting disease states in skin. Taken together, we demonstrate that (i) miR-21 expression is increased in human and mouse aging skin; (ii) SATB1 expression is inversely correlated with miR-21 in young and aged skin; and (iii) Satb1 serves as a genuine direct target of miR-21 in keratinocytes. Thus, by regulating SATB1 in epidermal keratinocytes, miR-21 may contribute to the higher-order chromatin remodeling and establishment of enhancer–promoter networks involved in epidermal differentiation, as well as increase susceptibility to age-related pathological conditions, such as tumorigenesis. These data provide a platform for the establishment of novel approaches for pharmacological manipulation of skin aging via modulation of the miR-21 activity in keratinocytes. Mohammed I. Ahmed: http://orcid.org/0000-0002-9051-7681 Maximilian E. Pickup: http://orcid.org/0000-0002-6006-2540 Alexander G. Rimmer: http://orcid.org/0000-0002-3038-9948 Majid Alam: http://orcid.org/0000-0002-5783-6605 Andrei N. Mardaryev: http://orcid.org/0000-0002-7826-5506 Krzysztof Poterlowicz: http://orcid.org/0000-0001-6173-5674 Natalia V. Botchkareva: http://orcid.org/0000-0002-5202-6822 Vladimir A. Botchkarev: http://orcid.org/0000-0002-9119-0895 The authors state no conflict of interest. This work was supported by funding from Nottingham Trent University, United Kingdom, UoA03 QR and Capital Funds (MIA), as well as by the grant from Amway, USA to VAB and NVB. Conceptualization: MIA, NVB, VAB; Data Curation: MIA, AGR, KP, MAA, MEP, ANM, NVB, VAB; Formal Analysis: MIA, AGR, KP, MAA, MEP, ANM, NVB, VAB; Funding Acquisition: MIA, VAB, NVB; Investigation: MIA, AGR, KP, MAA, MEP, ANM, NVB, VAB; Supervision: MIA, NVB, VAB; Writing - Original Draft Preparation: MIA, NVB, VAB. Animal studies were performed in accordance with protocols approved by the UK Home Office Project License. C57Bl/6 mice were purchased from Charles River Laboratories. Skin samples were collected at 8 weeks (young sample) and 2 years old (aged samples) and snap frozen in liquid nitrogen for histological and RNA analysis. Human skin was obtained from healthy donors (42–78 years old) undergoing face-lift and abdominoplasty surgery. Donor age and sites of tissue biopsies can be seen in Supplementary Table S1. Tissue was obtained with full written consent adhering to the Declaration of Helsinki principles, following ethical and institutional approval under human tissue act guidelines. Quantitative reverse transcriptase–PCR total RNA was isolated using the miRNeasy Kit (Qiagen, Hilden, Germany). For detection of the mature form of microRNA-21 (miR-21) TaqMan, quantitative reverse transcriptase–PCR was performed using TaqMan Real Time PCR Assay (Applied Biosystems, Foster City, CA) under the following cycling conditions: 95 °C for 10 minutes, followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 60 seconds. Differences between samples and controls were calculated based on the Ct (ΔΔCt) method and normalized to the U6 values. Data from triplicates were pooled, mean ± standard error of the mean was calculated, and statistical analysis was performed using unpaired Student's t-test. For detection of Satb1 and epidermal differentiation genes, 1 μg of total RNA was converted into cDNA using the qPCRBIO cDNA Synthesis Kit system (PCR Biosystems, London, United Kingdom). Gene expression was performed on QuantStudio5 Real Time PCR System (Life Technologies, Carlsbad, CA) using qPCRBIO SyGreen mix (PCR Biosystems). PCR primers were designed with Beacon Designer software (PREMIER Biosoft International, Palo Alto, CA; Supplementary Table S2). Amplification was performed at the following conditions: 95 °C for 5 minutes, followed by 40 cycles of denaturation (95 °C for 15 seconds), annealing (30 seconds at temperature experimentally determined for each primer pairs), and elongation (72 °C for 15 seconds). Differences between samples and controls were calculated based on the Ct (ΔΔCt) method and normalized to mouse (Actb) or human ACTB (actin). Data from triplicates were pooled, mean ± standard error of the mean was calculated, and statistical analysis was performed using unpaired Student's t-test. Skin cryosections (10 μm) were fixed in 4% paraformaldehyde for 10 minutes at room temperature. Tissues sections were acetylated in triethanolamine buffer (4.5 mM triethanolamine, 6 M NCl, and 3 mM acetic anhydride) for 10 minutes and permeabilized (1% Triton X-100/1x diethyl pyrocarbonate–treated phosphate buffered saline) for 30 minutes; slides were hybridized with 2.5 pmol double DIG-labelled miR-21 (Exiqon, Copenhagen, Denmark) and diluted in hybridization buffer (50% formamide DI, 2x saline sodium citrate, 1% dextran sulfate, and 0.4 mg/ml transfer RNA) for 16–18 hours at 60 °C overnight. Slides subsequently were washed in 2x saline sodium citrate (10 minutes, 4 times, 65 °C), 0.1x saline sodium citrate (60 minutes, 65 °C), and 0.2x saline sodium citrate (10 minutes, room temperature). Immunodetection of miR-21 was performed with sheep alkaline phosphatase–conjugated anti-DIG antibody (1:2500, Life Technologies) followed by a staining reaction with BM Purple solution (Life Technologies). Skin cryosections (10 μm) were fixed in 4% paraformaldehyde for 10 minutes at room temperature and were stained overnight with rabbit Satb1 (Abcam, Cambridge, United Kingdom; 1:200, ab49061), followed by application of corresponding donkey anti-rabbit Alexa-555 antibody (Life Technologies, 1:200) for 45 minutes at room temperature. Incubation steps were interspersed by washes with phosphate buffered saline. Sections were counter stained with DAPI. Primary human epidermal keratinocytes were isolated as previously described (Aunin et al., 2017Aunin E. Broadley D. Ahmed M.I. Mardaryev A.N. Botchkareva N.V. Exploring a Role for Regulatory miRNAs in Wound Healing during Ageing: involvement of miR-200c in wound repair.Sci Rep. 2017; 7: 3257Crossref PubMed Scopus (33) Google Scholar) and grown in keratinocyte media 2 (PromoCell, Heidelberg, Germany), containing 0.06 mM CaCl2, epidermal growth factor (0.125 ng/ml), and bovine pituitary extract (40 μg/ml). Primary mouse epidermal keratinocytes were prepared from newborn mice at postnatal days 2–3, as described previously (Ahmed et al., 2014Ahmed M.I. Alam M. Emelianov V.U. Poterlowicz K. Patel A. Sharov A.A. et al.MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway.J Cell Biol. 2014; 207: 549-567Crossref PubMed Scopus (49) Google Scholar). Primary mouse epidermal keratinocytes were grown in EMEM calcium-free medium (Lonza, Basel, Switzerland) supplemented with 0.05 mM calcium, at 33 °C, 8% CO2 (Scientific Laboratory Suppliers, Nottingham, United Kingdom) until 60–70% confluent. Human and mouse keratinocytes were transfected with 200 nM of pro-miR-21 mimic, anti-miR-21, and corresponding miR-controls (Dharmacon, Lafayette, CO) using Lipofectamine RNAiMAX (Life Technologies) as published previously (Ahmed et al., 2011Ahmed M.I. Mardaryev A.N. Lewis C.J. Sharov A.A. Botchkareva N.V. MicroRNA-21 is an important downstream component of BMP signalling in epidermal keratinocytes.J Cell Sci. 2011; 124: 3399-3404Crossref PubMed Scopus (59) Google Scholar). Cells were harvested 24 hours (pro-miR-21) and 48 hours (anti-miR-21) after transfection and used for further analyses. Proteins were extracted from cultured cells using RIPA lysis buffer (50 mm Tris-HCl, 1% NP-40, 0.25% sodium deoxycholate, 150 mm NaCl, and 1 mm EDTA; pH 7.4) and cOmplete ULTRA Protease Inhibitor Cocktail (Sigma-Aldrich, St. Louis, MO), as described previously (Ahmed et al., 2014Ahmed M.I. Alam M. Emelianov V.U. Poterlowicz K. Patel A. Sharov A.A. et al.MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway.J Cell Biol. 2014; 207: 549-567Crossref PubMed Scopus (49) Google Scholar). In brief, 10–20 micrograms of protein were processed for western blot analysis, followed by membrane incubation with primary antibody against SATB1 (Abcam; ab49061, 1:1,000), glucose-6-phosphate dehydrogenase (Abcam; ab8245, 1:10,000), or tubulin (Abcam; ab7291, 1:20,000) overnight at 4 °C. Horseradish peroxidase–tagged IgG antibodies were used as secondary antibodies (Thermo Fisher Scientific, Waltham, MA; 1:5,000). Antibody binding was visualized with an enhanced chemiluminescence's system (SuperSignal West Pico Kit, Thermo Fisher Scientific) and autoradiographed with X-ray film (CL-Xposure Film, Thermo Fisher Scientific) or iBright Gel-Doc Imager (Thermo Fisher Scientific). Possible miR-21 target genes were estimated as a consensus from the following three different prediction algorithms: TargetScan (http://www.targetscan.org/) predicts biological targets of microRNAs by searching for the presence of conserved sites that match the seed region of each microRNA, miRanda (http://microrna.sanger.ac.uk) uses an algorithm to predict microRNA–mRNA pairs, and PicTar (http://genie.weizmann.ac.il/pubs/mir07/mir07_data.html) confirms candidates predicted by the other two algorithms. HaCaT cells were grown in DMEM (Life Technologies) supplemented with heat-inactivated 10% fetal bovine serum in an atmosphere of 5% CO2 at 37 °C, until 60–70% confluent as described previously (Ahmed et al., 2014). 3′ UTR fragments of Satb1 containing miR-21 putative target sites were amplified from mouse genomic DNA using forward and reverse primers containing XhoI and NotI restriction sequences, respectively. For 3′ UTR of Satb1 fragment, 5′- CTCCTGCAGCATCATGTCAT -3′ and 5′- ACCACTCCTAATCAGCACATTTC -3′ forward and reverse primers, respectively, were used. Site-directed mutagenesis was performed using a QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA) to mutate the Satb1 binding site according to the manufacturer's instructions. For the dual luciferase assay, these constructs (200 ng) were cotransfected with 200 nM pro-miR-21 mimic or negative control mimic (Life Technologies) into HaCaT cells using 0.5 μl Lipofectamine 2000 (Life Technologies) in 96-well plates. At 24 hours after transfection, the relative luciferase activities were determined using Dual-Glo Luciferase Assay System (Promega, Madison, WI). The assay was performed in triplicate for three independent trials. For production of control and Satb1-expressing lentiviruses, HEK293T cells were cotransfected with control plasmid (Genecopoeia, Rockville, MD) and pEZ-Lv215-Satb1-eGFP (Genecopoeia, LPP-Mm19720-Lv215) and helper plasmids (pTAT, pREV, pHagp2[GAG/Pol], and pVSV-G) using Lenti-Pac HIV Expression Packaging Kit (Genecopoeia, HPK-LvTR) as per the manufacturer's protocol. Cell culture medium containing viruses was collected 24 hours, 48 hours, and 72 hours after transfection, followed by precipitation of the viral particles using PEG-it Virus Precipitation Solution (System Biosciences) as per the manufacturer's protocol. Primary mouse epidermal keratinocytes were infected with Satb1 and corresponding control lentiviral particles in combination with 10 μg/ml polybrene (Sigma-Aldrich) for 48 hours. To examine the regulatory effects of miR-21 on Satb1-induced gene expression, keratinocytes were transfected with 200 nM synthetic pro-miR-21 mimic or microRNA negative controls for 4 hours (post–48-hour lentiviral treatments). All experiment groups were collected for quantitative reverse transcriptase–PCR analysis 24 hours after pro-miR-21 mimic treatment. Download .xlsx (.01 MB) Help with xlsx files Supplementary Tables 1 and 2