Sheath blight (SB; caused by Rhizoctonia solani Kühn AG1–1A [teleomorph: Thanatephorus cucumeris (A. B. Frank) Donk.]) is one of the most important rice diseases in the southern United States. Twenty‐five rice (Oryza sativa L.) germplasm lines (Reg. No. GP‐115, PI 658312 to Reg. No. GP‐139, PI 658336) with high levels of resistance to SB were developed and released by the Department of Plant Pathology and Crop Physiology at the Louisiana State University Agricultural Center, Baton Rouge, LA, and the Rice Research Station, Rayne, LA. The lines were developed from 25 yr of recurrent selections of crosses and backcrosses of various SB‐resistant sources and U.S. cultivars. Sources for SB resistance included LSBR‐5,LSBR‐33, H4/CODF, ‘Taducan’, Rice/Grass, ‘Teqing’, ‘Jasmine 85’, ‘Katy’, ‘Yangdao‐6’, and ‘Azmil’, combined with SB resistance sources from previous crosses. Panicle rows tested in 2007 were derived from crosses made in 1997–2004, based on a modified recurrent‐selection scheme and inoculated each year with SB inoculum. Short‐stature, early‐maturing, high‐yielding lines similar to the commercial rice cultivar ‘Cocodrie’ were selected and yield tested in small plots in 2008. Their SB ratings ranged from 3.3 to 5.2 on a scale of 0 to 9, indicating reactions ranging from resistant to moderately resistant, compared with 8.8 and 7.3 for the susceptible cultivars Cocodrie and ‘CL151’, respectively. The lines should be useful for breeders and researchers interested in developing new varieties with resistance to SB.

With 1 figure and 1 table AbstractHigh molecular weight double‐stranded ribonucleic acids (dsRNAs) were detected in two rice cultivars, ‘M‐201’ and ‘Saturn’, growing in experimental plots and showing virus‐like symptoms. Partial sequencing of these dsRNAs indicated that they were related to the genome of Oryza sativa endornavirus (OSV), which has been reported in Japan infecting many rice cultivars. As this virus has not been reported in the US, 50 rice genotypes from the three major rice‐breeding programmes were tested. The virus was detected in two additional rice cultivars, ‘M‐102’ and ‘Colusa’. Analysis of the pedigree of infected cultivars suggested that the cultivar ‘Colusa’ was likely the source of the virus which was vertically transmitted to the progeny during the breeding process. The frequency of OSV in the tested cultivars was relatively low, compared with the high virus incidence of this virus reported in Japan. The virus does not appear to cause symptoms in rice and it was efficiently transmitted through seed.

Bacterial panicle blight (BPB) is among the three most limiting rice diseases in Louisiana and the southern United States. The identity and characterization of pathogens associated with this disease was unclear. This research details studies carried out on the pathogens causing BPB on rice in Louisiana and other rice producing southern states. Bacterial strains were isolated from BPB-infected sheath, panicle, or grain samples collected from rice fields in Louisiana, Arkansas, Texas, and Mississippi. In greenhouse inoculation tests, 292 of 364 strains were pathogenic on rice seedlings or panicles. Identification of strains in the pathogen complex by growth on S-PG medium, carbon source utilization profile (Biolog), cellular fatty acid analysis, and polymerase chain reaction (PCR) methods revealed that 76 and 5% of the strains were Burkholderia glumae and B. gladioli, respectively. The other strains have not been conclusively identified. Although strains of both species produced similar symptoms on rice, B. glumae strains were generally more aggressive and caused more severe symptoms on rice than B. gladioli. Virulent strains of both species produced toxoflavin in culture. The two species had similar growth responses to temperature, and optima ranged from 38 to 40°C for B. glumae and 35 to 37°C for B. gladioli. PCR was the most sensitive and accurate method tested for identifying the bacterial pathogens to the species level. The 16S rDNA gene and 16S-23S rDNA internal transcribed spacer (ITS) region sequences of the B. glumae and B. gladioli strains from rice showed more than 99% sequence homology with published sequences. A real-time PCR system was developed to detect and quantify this pathogen from infected seed lots. Our results clearly indicate that B. glumae and B. gladioli were the major pathogens causing BPB in the southern United States.

Strains of Burkholderia gladioli were isolated from rice (Oryza sativa) field soil, and its association with rice sheath rot and panicle blight symptoms was demonstrated, both under greenhouse and field conditions for the first time. The B. gladioli strains were identified using Biolog, cellular fatty acid composition, polymerase chain reaction, and sequencing of both 16S rDNA and 16–23S rDNA internal transcribed spacer (ITS) regions. Inoculation of rice with B. gladioli strains isolated from soil caused vertical, linear gray lesions surrounded by dark brown margins on flag-leaf sheaths in greenhouse experiments and significant panicle blighting under field conditions.

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5′ACACGG AACACCTGGGTA3′ and BGR 5′TCGCTCTCCCGAAGAGAT3′) gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5′CGAGCT AATACCGCGAAA3′ and BLR 5′AGACTCGA GTCAACTGA3′) identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5′AGAGTTTGATCCTGGCTCAG3′ and 16SR5′GGCTACCTTGTTACGACTT3′) and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

Crop ScienceVolume 46, Issue 5 p. 2318-2319 Registrations of Cultivars Registration of 'Trenasse' Rice S.D. Linscombe, Corresponding Author S.D. Linscombe slinscombe@agcenter.lsu.edu Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Corresponding author (slinscombe@agcenter.lsu.edu)Search for more papers by this authorX. Sha, X. Sha Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorJ.A. Bond, J.A. Bond Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorK. Bearb, K. Bearb Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorM.C. Rush, M.C. Rush Louisiana State Univ. Agricultural Center's Plant Pathology, Crop Physiology Dep., Baton Rouge, LA, 70803Search for more papers by this authorQ.R. Chu, Q.R. Chu RiceTec, Inc., P.O. Box 1305, 1925 FM2917, Alvin, TX, 77511Search for more papers by this authorD.E. Groth, D.E. Groth Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorL.M. White, L.M. White Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorR.T. Dunand, R.T. Dunand Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this author S.D. Linscombe, Corresponding Author S.D. Linscombe slinscombe@agcenter.lsu.edu Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Corresponding author (slinscombe@agcenter.lsu.edu)Search for more papers by this authorX. Sha, X. Sha Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorJ.A. Bond, J.A. Bond Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorK. Bearb, K. Bearb Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorM.C. Rush, M.C. Rush Louisiana State Univ. Agricultural Center's Plant Pathology, Crop Physiology Dep., Baton Rouge, LA, 70803Search for more papers by this authorQ.R. Chu, Q.R. Chu RiceTec, Inc., P.O. Box 1305, 1925 FM2917, Alvin, TX, 77511Search for more papers by this authorD.E. Groth, D.E. Groth Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorL.M. White, L.M. White Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorR.T. Dunand, R.T. Dunand Louisiana State Univ. Agricultural Center's Rice Research Station, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this author First published: 01 September 2006 https://doi.org/10.2135/cropsci2006.03.0208Citations: 8 Research supported in part by the Louisiana Rice Research Board. Approved for publication by the Director of the Louisiana Agricultural Experiment Station as manuscript no. 06-61-0166. Registration by CSSA. Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat No abstract is available for this article.Citing Literature Volume46, Issue5September–October 2006Pages 2318-2319 RelatedInformation

Crop ScienceVolume 46, Issue 3 p. 1417-1417 Registrations of Mapping Population Registration of a C/M Doubled Haploid Mapping Population of Rice Q.R. Chu, Corresponding Author Q.R. Chu qchu@ricetec.com Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Corresponding author (qchu@ricetec.com)Search for more papers by this authorS.D. Linscombe, S.D. Linscombe Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorM.C. Rush, M.C. Rush Plant Pathology, LSU AgCenter, Baton Rouge, LA, 70803Search for more papers by this authorD.E. Groth, D.E. Groth Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorJ. Oard, J. Oard Agronomy Dep., LSU AgCenter, Baton Rouge, LA, 70803Search for more papers by this authorX. Sha, X. Sha Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorH.S. Utomo, H.S. Utomo Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this author Q.R. Chu, Corresponding Author Q.R. Chu qchu@ricetec.com Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Corresponding author (qchu@ricetec.com)Search for more papers by this authorS.D. Linscombe, S.D. Linscombe Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorM.C. Rush, M.C. Rush Plant Pathology, LSU AgCenter, Baton Rouge, LA, 70803Search for more papers by this authorD.E. Groth, D.E. Groth Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorJ. Oard, J. Oard Agronomy Dep., LSU AgCenter, Baton Rouge, LA, 70803Search for more papers by this authorX. Sha, X. Sha Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this authorH.S. Utomo, H.S. Utomo Rice Research Station, LSU AgCenter, 1373 Caffey Rd., Rayne, LA, 70578Search for more papers by this author First published: 01 May 2006 https://doi.org/10.2135/cropsci2005.0199Citations: 4 Approved for publication by the Director of the Louisiana Agricultural Experiment Station as manuscript number 05-61-0130. Registration by CSSA. Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat No abstract is available for this article.Citing Literature Volume46, Issue3May 2006Pages 1417-1417 RelatedInformation

Abstract Breeding programs can benefit from transfer of a foreign gene from one transgenic plant to commercial cultivars through continuous backcrossing, especially to cultivars in which it is difficult to transfer a foreign gene directly through biotechnology. In this study, two homogeneous transgenic plants, T-28 and T-64 (from Taipei 309), and one homogeneous transgenic plant, N-84 (from Nipponbare), were used as donors of Bar gene. Commercial cultivars, Cypress and Laffite, were used as the recurrent parents. Three to five backcrosses were made using the transgenic plants as donor parents and the commercial cultivars as recurrent parent. The results from selected progeny rows, and two-years of yield tests with selected lines, indicated that the target Bar gene could be transferred to lines from homozygous transformants in 2–3 years of backcrossing, giving lines similar to the recurrent parents in phenotype and yield potential.

AIM:To identify antimicrobial peptides with high lytic activity against Rhizoctonia solani strain LR172, causal agent of rice sheath blight and aerial blight of soyabeans in the US. METHODS AND RESULTS:Among 12 natural and synthetic antimicrobial peptides tested in vitro, the wheat-seed peptide, purothionin, showed the strongest inhibitory activity that was similar to the antifungal antibiotics, nystatin and nikkomycin Z. Cecropin B, a natural peptide from cecropia moth, and synthetic peptide D4E1 produced the highest inhibitory activity against R. solani among linear peptides. Membrane permeabilization levels strongly correlated with antifungal activity of the peptides. Noticeable changes in membrane integrity were observed at concentrations of >/=0.5 micromol l(-1) for purothionin, 2 micromol l(-1) for cecropin B, D4E1, D2A21, melittin, and phor21, and 8 micromol l(-1) for magainin II and phor14. An increase of nuclear membrane permeabilization was observed in fungal cells treated with cecropin B, but not with purothionin. Diffusion of nuclear content was observed by fluorescent microscopy 10 min after adding a lethal concentration of cecropin B. Evaluation by electron microscopy confirmed severe cytoplasmic degradation and plasma membrane vesiculation. Purothionin and cecropin B were the most stable against proteolytic degradation when added to liquid cultures of R. solani. CONCLUSIONS:Purothionin, cecropin B, D4E1 and phor21 were shown to exhibit high in vitro lytic activity against R. solani strain LR172 for rice and soyabean. These peptides are greater than 16 amino acids long and rapidly increase fungal membrane permeabilization. Resistance to proteolysis is important for sufficient antifungal activity of antimicrobial peptides. SIGNIFICANCE AND IMPACT OF THE STUDY:Selected antimicrobial peptides offer an attractive alternative to traditional chemicals that could be utilized in molecular breeding to develop crops resistant to rice sheath blight and aerial blight of soyabean.

White leaf streak, caused by Mycovellosiella oryzae (Deighton and Shaw) Deighton (syn. Ramularia oryzae), was found in Louisiana rice. The symptoms closely resemble those of narrow brown leaf spot caused by Cercospora janseana (Racib.) O. Const. (syn. C. oryzae (Miyake)), and it is difficult to distinguish between these two diseases. Initially both produce similar elongated light brown lesions, but later the lesions of white leaf streak become wider with a whitish center and are surrounded by a narrow light brown margin (2,3). The disease was first observed at the Rice Research Station, Crowley, LA, in 1996 on older leaves of the cultivar Lemont at maturity. Leaves containing the unusual lesion types were placed in a moist chamber and incubated at 28°C for 5 days. Abundant conidia were produced and the fungus was isolated on acidified potato dextrose agar (APDA) by single spore isolation and by plating infected tissues after surface sterilization in 40% Clorox for 10 to 15 min. The colonies grew slowly on APDA and were dark gray in color. The conidia formed in branched chains or singly. They were hyaline, cylindrical with tapering ends and a thick hilum; 0 to 3 septate, and 15 to 35 m long (1,3). Pathogenicity tests were conducted in the greenhouse on the Lemont and Cypress rice cultivars by spraying a conidial suspension (103–4 conidia per ml) onto leaf blades at boot stage. Conidia were produced by growing the fungus on PDA for 10 to 14 days. Inoculated plants were placed inside a humid chamber in a greenhouse and maintained for 4 to 5 weeks. Many elongated lesions similar to those observed in the field were produced 3 to 4 weeks after inoculation. Reisolation from these lesions yielded M. oryzae. With the same methods, 45 cultivars and lines were inoculated to determine their reactions to this disease. Most of the cultivars grown in the southern United States were moderately susceptible or susceptible to white leaf streak. Foreign cultivars tested, including BR-7, BR-11, Cica-4, Cica-6, Cica-7. Cica-8, Cica-9, Oryzica llanos, Rax clear, Teqing, and Tetep, were resistant. In 1997, the disease was found prevalent on many cultivars grown at the Rice Research Station, Crowley, LA. As symptoms of both white leaf streak and narrow brown leaf spot were sometimes observed on the same leaf; it is possible that the disease has been present, but not identified as a separate disease because of the similarity of the symptoms of the two diseases. A thorough survey is necessary to determine the extent of its occurrence and further studies are necessary to determine its yield loss potential. At present it appears to be a minor problem for Louisiana rice. White leaf streak has previously been recorded from Papua New Guinea on cultivated Oryza sativa, and from the Solomon Islands, Sabah, Nizeria, and Sierra Leone on cultivated O. glabberima Steudel and on wild perennial rice O. berthii A. Chev. (2). This is the first report of white leaf streak on cultivated rice in the United States. References: (1) F. C. Deighton. Mycol. Pap., CMI 144:1,1979. (2) F. C. Deighton and D. Shaw. Trans. Br. Mycol. Soc. 43: 515, 1960. (3) B. C. Sutton and A. K. M. Shahjahan. Nova Hedwigia 25:197, 1981.