Programmed cell death (apoptosis) during oogenesis is conserved across metazoans and linked to regulation of oocyte number and quality. In oogenic germlines, the removal of developing oocytes by apoptosis ensures that oocytes do not contain DNA damage or multiple nuclei. Beyond this chromatin-quality control assurance role, it was unknown how apoptosis contributes to oocyte quality. We used the nematode Caenorhabditis elegans to study the consequences of loss of apoptosis on oogenesis. Blocking apoptosis reduced fecundity in hermaphrodites at peak fertility and caused germline architectural defects, such as abnormal rachis morphology and perturbed arrangement and distribution of oogenic germline compartments. Our results suggest that the loss of germline apoptosis arises due to lack of sufficient space for, and reduced cytoplasmic flows into, developing oogonia. In support of this idea, oocytes and embryos are abnormally small and exhibit low viability in animals unable to execute apoptosis. These findings suggest that, in addition to preventing ploidy defects during oogenesis, apoptosis contributes to fertility by preserving the homeostatic germline structure required for the fidelity of oogenesis.

Germline architecture plays a critical role in the production of functional gametes. Across species, oogenesis involves not only the preparation of the genome for sexual reproduction, but also the dramatic enlargement of a cell compartment to reach a volume sufficient to support embryogenesis. Creating exceptionally large cells is accomplished by a syncytial structure, in which many nucleus-containing compartments are interconnected by cytoplasmic bridges. Maintenance and function of the intricate multi-compartment architecture of syncytia requires cortical contractility, cytoplasmic flows, and germline extrinsic forces that deform and displace the germline and its constituent compartments. The dynamic interplay between local and global force production in shaping syncytial architecture makes the germline an excellent model to study the force-form-function connection in cell biology. Here, we highlight work that has combined physical modeling with cell biological measurements to define the force-form-function connection, using the Caenorhabditis elegans oogenic germ- line as an archetype.

Septins are a highly conserved family of proteins that form palindromic hetero-oligomeric rods, which anneal into non-polar filaments. Via association with the plasma membrane, septin filaments recognize micron-scale membrane curvature, create diffusion barriers, and regulate cell morphogenic events via scaffolding other cytoskeletal polymers (i.e., filamentous actin [F-actin] and microtubules) and biochemical regulators of cell division, cell migration, and polarity establishment.1,2 Although interaction with cellular membranes is thought to be crucial for septin polymer dynamics and function, how septins associate with membranes is not understood. Three polybasic regions (PB1, PB2, and PB3) and an amphipathic helix (AH) are each sufficient for membrane interaction in vitro, and while the AH domain has been implicated in conferring membrane curvature sensing in vivo in the filamentous fungus Ashbya, the functionality of these domains in the context of intact septin complexes in vivo is still incompletely defined.3,4,5,6,7,8,9 We identified and characterized an isoform of Caenorhabditis elegans septin UNC-61 that was predicted to contain a transmembrane domain (TMD; UNC-61a). UNC-61a was expressed in a subset of tissues where the known septins act, and the TMD was required for tissue integrity of the egg-laying apparatus. We found predicted TMD-containing septins across much of opisthokont phylogeny and demonstrated that the TMD-containing sequence of a primate TMD-septin is sufficient for localization to cellular membranes. Together, our findings reveal a novel mechanism of septin-membrane association with profound implications for septin dynamics and regulation.

Actomyosin rings are specializations of the nonmuscle actomyosin cytoskeleton that drive cell shape changes during division, wound healing, and other events. Contractile rings throughout phylogeny and in a range of cellular contexts are built from conserved components, including nonmuscle myosin II, actin filaments, and cross-linking proteins. To explore whether diverse actomyosin rings generate contractile force and close via a common mechanism, we studied three instances of ring closure within the continuous cytoplasm of the Caenorhabditis elegans syncytial oogenic germline: mitotic cytokinesis of germline stem cells, apoptosis of meiotic compartments, and cellularization of oocytes. The three ring types exhibited distinct closure kinetics and component protein abundance dynamics. We formulated a physical model to relate measured closure speed and molecular composition dynamics to ring active stress and viscosity. We conclude that these ring intrinsic factors vary among the ring types. Our model suggests that motor and nonmotor cross-linkers' abundance and distribution along filaments are important to recapitulate observed closure dynamics. Thus, our findings suggest that across ring closure contexts, fundamental contractile mechanics are conserved, and the magnitude of contractile force is tuned via regulation of ring component abundance and distribution. These results motivate testable hypotheses about cytoskeletal regulation, architecture, and remodeling.

Metastatic disease remains the primary cause of mortality in cancer patients. Yet the number of available in vitro models to study metastasis is limited by challenges in the recapitulation of the metastatic microenvironment in vitro, and by difficulties in maintaining colonized-tissue specificity in the expansion and maintenance of metastatic cells. Here, we show that decellularized scaffolds that retain tissue-specific extracellular-matrix components and bound signalling molecules enable, when seeded with colorectal cancer cells, the spontaneous formation of three-dimensional cell colonies that histologically, molecularly and phenotypically resemble in vivo metastases. Lung and liver metastases obtained by culturing colorectal cancer cells on, respectively, lung and liver decellularized scaffolds retained their tissue-specific tropism when injected in mice. We also found that the engineered metastases contained signet ring cells, which has not previously been observed ex vivo. A culture system with tissue-specific decellularized scaffolds represents a simple and powerful approach for the study of organ-specific cancer metastases.

PURPOSE Financial toxicity (FT) adversely influences patient quality of life and is a barrier to clinical trial enrollment. Early-phase clinical trials (EPCTs) recruit patients who may have high baseline FT and require additional visits and procedures, potentially increasing FT. METHODS In this prospective survey study, we sought to assess FT at baseline and after 2 months among patients with advanced solid malignancies participating in EPCTs. Participants were age 18 years and older, were English-speaking, and were treated at the Yale Cancer Center (Yale) and the Tisch Cancer Institute at Mount Sinai (Mount Sinai). At the time of consent and 2 months later, patients completed a sociodemographic questionnaire as well as the 11-item validated Comprehensive Score for Financial Toxicity (COST) instrument. Primary outcomes were baseline COST score and change in COST score from baseline to 2 months. Lower score is associated with higher FT. RESULTS One hundred forty-six patients completed survey 1. Mean age was 61.5 years and 50.7% were male. The most common histologies were lung (17.8%), colorectal (16.4%), and breast (12.3%) cancers. Mean baseline COST score was 22.12 (standard deviation, 8.01). FT was associated with being a primary wage earner ( P = .044) and inversely associated with age ( P = .025). Seventy-one patients completed survey 2. Among 71 patients who completed both surveys, there was no significant difference in COST score between surveys 1 and 2 ( P = .28). Race, ethnicity, education, and household income were not associated with baseline COST score or change in FT. CONCLUSION Moderate FT was reported at baseline and on trial among EPCT participants. No change in FT was observed between time points. Additional efforts should be made to decrease FT associated with EPCT participation to maximize access to novel therapies.

Septins, a conserved family of filament-forming proteins, contribute to eukaryotic cell division, polarity, and membrane trafficking. Septins scaffold other proteins to cellular membranes, but it is not fully understood how septins associate with membranes. We identified and characterized an isoform of Caenorhabditis elegans septin UNC-61 that was predicted to contain a transmembrane domain (TMD). The TMD isoform is expressed in a subset of tissues where the known septins were known to act, and TMD function was required for tissue integrity of the egg-laying apparatus. We found predicted TMD-containing septins across much of opisthokont phylogeny and demonstrated that the TMD-containing sequence of a primate TMD-septin is sufficient for localization to cellular membranes. Together, our findings reveal a novel mechanism of septin-membrane association with profound implications for septin dynamics and regulation.

The actomyosin cortex is an active material that generates force to drive shape changes via cytoskeletal remodeling. Cytokinesis is the essential cell division event during which a cortical actomyosin ring closes to separate two daughter cells. Our active gel theory predicted that actomyosin systems controlled by a biochemical oscillator and experiencing mechanical strain would exhibit complex spatiotemporal behavior. To test whether active materials in vivo exhibit spatiotemporally complex kinetics, we imaged the C. elegans embryo with unprecedented temporal resolution and discovered that sections of the cytokinetic cortex undergo periodic phases of acceleration and deceleration. Contractile oscillations exhibited a range of periodicities, including those much longer periods than the timescale of RhoA pulses, which was shorter in cytokinesis than in any other biological context. Modifying mechanical feedback in vivo or in silico revealed that the period of contractile oscillation is prolonged as a function of the intensity of mechanical feedback. Fast local ring ingression occurs where speed oscillations have long periods, likely due to increased local stresses and, therefore, mechanical feedback. Fast ingression also occurs where material turnover is high, in vivo and in silico. We propose that downstream of initiation by pulsed RhoA activity, mechanical feedback, including but not limited to material advection, extends the timescale of contractility beyond that of biochemical input and, therefore, makes it robust to fluctuations in activation. Circumferential propagation of contractility likely allows for sustained contractility despite cytoskeletal remodeling necessary to recover from compaction. Thus, like biochemical feedback, mechanical feedback affords active materials responsiveness and robustness.

BACKGROUND:Cystic fibrosis transmembrane conductance regulator (CFTR) modulators improve pulmonary outcomes in cystic fibrosis (CF) by stabilizing the CFTR protein on respiratory epithelial surfaces. To determine the efficacy of CFTR modulators on sinonasal outcomes in patients with CF, we performed a meta-analysis of clinical trials to date that include functional and radiographic evidence of sinus disease. METHODS:English full-text articles were searched in PubMed, Embase, and Scopus databases. Two reviewers screened articles and a third reviewer resolved disagreements. Articles were included if they reported functional or radiological sinonasal outcomes in patients with CF before and after CFTR modulator therapies. Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines were followed, and the risk of bias in non-randomized studies of interventions tool was used for quality assessment. The generic inverse variance method with random effects model was used for meta-analysis. Standardized mean difference (SMD) and mean difference (MD) were used as effect measurements. RESULTS:Seven prospective and two retrospective studies representing 248 patients were included in this analysis. There was a significant improvement in sinonasal outcome test-22 scores on elexacaftor‒tezacaftor‒ivacaftor (MD = 12.80, [95% confidence interval, CI: 10.46‒15.13], p < 0.001, n = 222), with no heterogeneity detected (I2 = 0%, p = 0.820). There was also a significant improvement in Lund‒Mackay scores (SMD = 1.25, [95% CI: 0.58‒1.91], p < 0.001, n = 88), with heterogeneity detected (I2 = 67%, p = 0.030). CONCLUSIONS:CFTR modulators improve functional and radiologic sinonasal outcomes. Given the utility of CFTR modulators, the treatment paradigm for CF-related chronic rhinosinusitis promises to evolve.

Acute invasive fungal sinusitis (AIFS) is an aggressive disease with significant mortality and morbidity. Surgical debridement is a mainstay of treatment. However, orbital involvement may limit its efficacy and is an independent risk factor for mortality. Traditionally, orbital exenteration has been utilized in cases with orbital invasion and ophthalmoplegia or vision loss. Retrobulbar liposomal amphotericin B injection may improve disease control and has the potential to spare the morbidity associated with exenteration. In this video article, we document the use of serial endonasal debridement with retrobulbar injections to salvage the eye in a patient with significant orbital involvement. A 28-year-old immunocompromised female patient presented with acute onset restricted right extraocular movement, progressive orbital pain, V2 trigeminal numbness, and 20/40 vision. The patient underwent recurrent debridement and retrobulbar injections of liposomal amphotericin B. Her serial exams, including changes in extraocular muscle appearance and gradual improvement in extraocular movement, were documented. The exam six months after initial presentation demonstrated 20/20 vision, minimal extraocular movement restriction, and proper healing of the orbit and ethmoid. The salvage of the patient's orbit suggests that liposomal amphotericin B injections with debridement may be a viable treatment alternative in patients with acute invasive fungal sinusitis and orbital involvement.

Oocytes must be exceptionally large cells in order to support embryonic development. Throughout animal phylogeny, a specialized cell called a syncytium, wherein many nuclei share a continuous cytoplasm, achieves oogenesis. The syncytial nature of germline architecture is key to its function and depends on conserved components of the cortical cytoskeleton. Septins form non-polar cytoskeletal polymers that associate with membranes. In the syncytial germline of the nematode Caenorhabditis elegans, septins are highly enriched on the cortex and generally required for fertility, but the role of septins in the germline is poorly understood. We report that the C. elegans septins, UNC-59 and UNC-61, are important for germline extension during development, the maintenance of its syncytial architecture, and production of oocytes. While much of our findings substantiate the idea that the two C. elegans septins act together, we also found evidence that they have distinct functions. Loss of UNC-61 perturbed germline extension during germline development, while the loss of UNC-59 function severely affected germline architecture in adult hermaphrodites. Consultation of clustering results from a large-scale high-throughput screen suggested that septins are involved in germ cell proliferation and/or differentiation. In sum, our findings implicate a conserved cytoskeletal component in the complex architecture of a germline syncytium.

The nasoseptal flap is a workhorse reconstructive option for anterior skull base defects during endonasal surgery. This paper highlights the versatility of the nasoseptal flap. After providing a brief historical perspective, this review will focus on the relevant primary literature published in the last ten years. We will touch upon new applications of the flap, how the flap has been modified to expand its reach and robustness, and some of the current limitations. We will conclude by discussing what the future holds for improving upon the design and use of the nasoseptal flap in anterior skull base reconstruction.

Resistance to antitumor treatment contributes to patient mortality. Functional proteomic screening of organoids derived from chemotherapy-treated patients with breast cancer identified nuclear receptor corepressor 2 (NCOR2) histone deacetylase as an inhibitor of cytotoxic stress response and antitumor immunity. High NCOR2 in the tumors of patients with breast cancer predicted chemotherapy refractoriness, tumor recurrence and poor prognosis. Molecular studies revealed that NCOR2 inhibits antitumor treatment by regulating histone deacetylase 3 (HDAC3) to repress interferon regulatory factor 1 (IRF-1)-dependent gene expression and interferon (IFN) signaling. Reducing NCOR2 or impeding its epigenetic activity by modifying its interaction with HDAC3 enhanced chemotherapy responsiveness and restored antitumor immunity. An adeno-associated viral NCOR2–HDAC3 competitor potentiated chemotherapy and immune checkpoint therapy in culture and in vivo by permitting transcription of IRF-1-regulated proapoptosis and inflammatory genes to increase IFN-γ signaling. The findings illustrate the utility of patient-derived organoids for drug discovery and suggest that targeting stress and inflammatory–repressor complexes such as NCOR2–HDAC3 could overcome treatment resistance and improve the outcome of patients with cancer. Weaver and colleagues use breast cancer patient-derived organoids and mouse models to find an inhibitory role for the nuclear repressor NCOR2 in chemotherapy response and antitumor immunity, which can be targeted by blocking NCOR2–HDAC3 interaction.

267 Background: Financial toxicity (FT) adversely influences patient quality of life and is a barrier to clinical trial enrollment. Early phase clinical trials (EPTs) primarily recruit patients with advanced malignancies who have received all standard therapy regimens and may thus have high levels of FT. We sought to assess baseline FT and its association with clinicodemographic factors in patients participating in early phase clinical trials. Methods: We conducted a study to assess baseline FT in English-speaking patients (pts) with advanced metastatic solid tumors who were participating in EPTs at the Yale Cancer Center (Yale) and the Tisch Cancer Institute at Mount Sinai (Sinai). Pts were consented after EPT consent and prior to day 1 of study treatment. Pts completed a clinical and demographic questionnaire as well as the 11-item validated Comprehensive Score for Financial Toxicity (COST) FT instrument. Primary endpoints included baseline FT and association with clinicodemographic variables. Statistical analysis was performed using two-sided T-tests and Pearson correlations for numeric data and Fisher’s Exact Test for categorical data. Multivariate analysis was performed using a linear regression model. Results: 138 pts enrolled in this study, of whom 132 completed the COST instrument (Yale, N = 84; Sinai, N = 48). Median age was 62 and 49.2% were male. 71.2% patients self-identified as White and 15.2% as Black; 7.2% identified as Hispanic. 32.6% reported an annual income of < $50,000. Insurance providers included private insurers (50%), Medicare (31.8%), Medicaid (10.6%), and Medicaid with Medicare supplemental (3.8%). 56.8% reported monthly out of pocket medical expenses of $100 or more. Median FT score was 22.5 out of a maximum score of 44 (mean 21.5). FT scores ≥ 22.5 in pts were associated with age < 65 (OR = 2.229, P = 0.04), being the household money manager (OR = 2.98, P = 0.02), and being the primary wage earner (OR = 3.12, P = 0.004). FT scores < 22.5 in pts was associated with retirement (OR = 0.15, P = 3.67e-05). In multivariate analysis, retirement was associated with FT score < 22.5 (OR = 0.18, P = 0.02). There was no statistically significant difference in FT scores between Yale and Sinai pts. However, Sinai pts were more racially diverse (p = 3.05e-05), had lower household income (P = 0.01), out of pocket expenses (P = 0.01), ED visits (P = 0.0075), and dependents (P = 0.004) and were less likely to have private insurance (P = 0.004). Conclusions: Pts with advanced cancers consenting to EPTs report significant baseline FT. Our study encompasses a diverse population from two large urban academic centers. Baseline FT was higher among pts < 65 years of age, primary wage earners, and those who managed household finances independently. Retirement was a protective factor, which may be explained by the life savings often required to retire. Ongoing work will compare baseline and 2 month FT in this patient population.

Actomyosin cortical contractility drives many cell shape changes including cytokinetic furrowing. While positive regulation of contractility is well characterized, counterbalancing negative regulation and mechanical brakes are less well understood. The small GTPase RhoA is a central regulator, activating cortical actomyosin contractility during cytokinesis and other events. Here we report how two novel cytokinetic ring components, GCK-1 (germinal center kinase-1) and CCM-3 (cerebral cavernous malformations-3), participate in a negative feedback loop among RhoA and its cytoskeletal effectors to inhibit contractility. GCK-1 and CCM-3 are recruited by active RhoA and anillin to the cytokinetic ring, where they in turn limit RhoA activity and contractility. This is evidenced by increased RhoA activity, anillin and nonmuscle myosin II in the cytokinetic ring, and faster cytokinetic furrowing, following depletion of GCK-1 or CCM-3. GCK-1 or CCM-3 depletion also reduced RGA-3 levels in pulses and increased baseline RhoA activity and pulsed contractility during zygote polarization. Together, our results suggest that GCK-1 and CCM-3 regulate cortical actomyosin contractility via negative feedback. These findings have implications for the molecular and cellular mechanisms of cerebral cavernous malformation pathologies.

Figure 1. CYLC-2::mNeonGreen localizes to sperm and has no effect on sperm function: DIC and fluorescence images of young adult hermaphrodites (A-B), males (C-D), and dissected spermatids (E-F). Fluorescence signal clearly labels sperm in and near the spermatheca in the hermaphrodite and spermatids in the male. Scale bar, 50 μm (A-D). Scale bar, 5 μm (E-F). When AD294 males mate with N2 hermaphrodites, the CYLC-2::mNG labeled male sperm are visible in the hermaphrodite reproductive tract (G). Scale bar, 50 μm. Total outcross progeny (H) and percent outcross progeny (I) are comparable between control him-5 males and cylc-2::mNG; him-5 males indicating that tagging CYLC-2 with mNG has no effect on sperm formation or function. Median and 95% confidence intervals are shown in the graphs. Description The gene products of C. elegans ORFs Y59E9AL.6 and C41G7.6 were assigned the names CYLC-1 and CYLC-2, respectively, due to their homology to human cylicins (Lacroix et al.. 2016). In mammals, expression of cylicin I and cylicin II is testis-specific and immunohistochemistry shows the proteins localize to the cytoskeletal calyx of the sperm head (Hess et al. 1993; Hess et al. 1995; Rousseaux-Prèvost et al. 2003). To determine the localization of C. elegans CYLC-1 and CYLC-2 we used CRISPR/Cas9 to endogenously tag each protein with mNeonGreen (mNG). We find that 9/29/2020 Open Access CYLC-2::mNG localizes to sperm in both hermaphrodites and males (Figure 1A-F). Examination of spermatids dissected from males shows CYLC-2::mNG concentrated in puncta (Figure 1F). Based on their size and position in the spermatids, we predict that these puncta correspond to the membranous organelles (MOs). However, further studies will be necessary to confirm whether CYLC-2 is concentrated in the MOs of spermatids and to determine if any changes in subcellular localization take place upon sperm activation. We present CYLC-2::mNG as another genetically encoded sperm marker that can be used to track sperm presence, transfer, and movement (Figure 1G). For fertility studies it is often important to know if hermaphrodite self sperm are present in the spermathecae or if males have successfully mated and transferred sperm to a hermaphrodite. The creation of bright, sperm-specific fluorescent markers in C. elegans has been notoriously challenging (Wong et al.. 2020). Traditionally, the transfer and movement of sperm has been studied by indiscriminately marking male cells with vital dyes such as Mitotracker Red CMXRos or SYTO 17 (Hu et al. 2019; Singson et al.. 1999; Hill and L’Hernault 2001). Alternatively, fixation and staining with DAPI has been a blunt tool to confirm the presence or absence of sperm (Singaravelu et al. 2015; Krauchunas et al.. 2018). Most recently, the Stanfield lab has shown that combining two unlinked sperm histone::mCherry transgenes into the same strain significantly improved the fluorescent signal without impacting sperm function (Wong et al.. 2020). CYLC-2::mNG is bright enough that it can be seen with just a fluorescence stereo microscope, allowing for the transfer of sperm to be monitored over time in free living hermaphrodites on a culture plate. It also makes crossing this sperm marker into mutant backgrounds relatively straightforward. Finally, it adds a bright, non-nuclear sperm marker to our community toolkit. By marking one population of sperm with a nuclear marker such as histone::mCherry and another with CYLC2::mNG we can differentiate between hermaphrodite self sperm and male sperm, or sperm from two different males, within the hermaphrodite reproductive tract. There is no statistically significant difference in the total number of progeny sired by males with tagged CYLC-2 as compared to control males (p-value = 0.4, Figure 1H). In addition, there is no difference in the percentage of progeny produced that are outcross progeny (p-value = 0.58, Figure 1I). From these data, we infer that tagging CYLC-2 with mNG has no discernable effect on the ability of the sperm to migrate, compete with hermaphrodite sperm, or fertilize the egg. We conclude that CYLC-2::mNG makes an excellent sperm marker to observe sperm transfer and migration in C. elegans. In addition, it is intriguing that the presence of these cylicin-like cytoskeletal proteins in sperm is conserved since C. elegans sperm have neither actin nor tubulin (L’Hernault and Roberts 1995). In the future, mutant studies will help us determine the role of cylicins in spermatogenesis, sperm structure, and sperm function. Methods Request a detailed protocol Strains and Husbandry C. elegans strains were cultured at 20oC using standard methods (Brenner, 1974). Strains used: MDX44 C41G7.6/cylc-2(mon2[C41G7.6::mNG^3xFLAG) I AD294 C41G7.6/cylc-2(mon2[C41G7.6::mNG^3xFLAG) I; him-5(e1490) V N2 Bristol wild-type CB61 dpy-5(e61) mNG = mNeonGreen CRISPR/Cas9 genome editing to create cylc-2::mNG CRISPR lines were generated using SEC (Self-Excising Cassette)-CRISPR system (Dickinson et al. 2015). In short, a guide sequence for C41G7.6 (gatgagaagaaggagtgagc) was introduced into pDD162 using the NEB Q5 site directed mutagenesis kit. 500-700 base pair repair constructs were generated by PCR and cloned into pDD268. The PAM site used for C41G7.6 was part of the guide sequence and was left unchanged in the repair sequence. After isolation of CRISPR insertion lines, verified lines were subjected to heat shock treatment to remove the SEC cassette. Imaging AD294 c41g7.6(mon2[c41g7.6::mNG^3xFlag); him-5(e1490) hermaphrodites and males were separated from one another at the L4 stage and imaged the following day. Whole live worms were mounted in M9 with levamisole on 2% agarose pads. To observe transfer of marked sperm to unmarked hermaphrodites, several AD294 males were placed with several N2 L4 hermaphrodites. The hermaphrodites were mounted and imaged approximately 24 hours later. To observe isolated spermatids, virgin males were dissected in Sperm Medium (10 mM dextrose, 1 mM MgSO4, 5 mM CaCl2, 50 mM NaCl, 25 mM KCl, and 5.5 mM HEPES pH 7.8). Differential interference contrast microscopy (DIC) and fluorescent images of 9/29/2020 Open Access live worms or dissected spermatids were obtained using a Zeiss Universal microscope and captured with a ProgRes camera (Jenoptik) using ProgResCapturePro software. Male fertility assay Crosses were set up between dpy-5(e61) L4 hermaphrodites and either him-5(e1490) or AD294 c41g7.6/cylc2(mon2[c41g7.6::mNG^3xFlag); him-5(e1490) males in a 1:4 ratio. 24 hours later, the males were removed and the hermaphrodites were transferred to new plates. The hermaphrodites continued to be transferred to new plates every 24 hours for a total of 4 days. On the last day the hermaphrodites were removed but not transferred to new plates. Three days after the hermaphrodite was removed from the plate, the number of Dpy and non-Dpy progeny was counted. Outcross progeny is the total number of non-Dpy progeny produced by a single hermaphrodite during the four days. Percent outcross progeny is the total number of non-Dpy progeny divided by the total number of progeny (Dpy + non-Dpy) produced by a single hermaphrodite during the four days. Mann-Whitney tests were performed to determine if there were statistically significant differences in the total number of outcross progeny or the percent outcross progeny. References Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77: 71-94. PMID: 4366476. Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a SelfExcising Drug Selection Cassette. Genetics 200: 1035-49. PMID: 26044593. Hess H, Heid H, Franke WW. 1993. Molecular characterization of mammalian cylicin, a basic protein of the sperm head cytoskeleton. J Cell Biol 122: 1043-52. PMID: 8354692. Hess H, Heid H, Zimbelmann R, Franke WW. 1995. The protein complexity of the cytoskeleton of bovine and human sperm heads: the identification and characterization of cylicin II. Exp Cell Res 218: 174-82. PMID: 7737358. Hill KL, L'Hernault SW. 2001. Analyses of reproductive interactions that occur after heterospecific matings within the genus Caenorhabditis. Dev Biol 232: 105-14. PMID: 11254351. Hu M, Legg S, Miller MA. 2019. Measuring Sperm Guidance and Motility within the Caenorhabditis elegans Hermaphrodite Reproductive Tract. J Vis Exp : . PMID: 31233026. Krauchunas AR, Mendez E, Ni JZ, Druzhinina M, Mulia A, Parry J, Gu SG, Stanfield GM, Singson A. 2018. spe-43 is required for sperm activation in C. elegans. Dev Biol 436: 75-83. PMID: 29477340. Lacroix B, Ryan J, Dumont J, Maddox PS, Maddox AS. 2016. Identification of microtubule growth deceleration and its regulation by conserved and novel proteins. Mol Biol Cell 27: 1479-87. PMID: 26985017. L'Hernault SW, Roberts TM. 1995. Cell biology of nematode sperm. Methods Cell Biol 48: 273-301. PMID: 8531729. Rousseaux-Prévost R, Lécuyer C, Drobecq H, Sergheraert C, Dacheux JL, Rousseaux J. 2003. Characterization of boar sperm cytoskeletal cylicin II as an actin-binding protein. Biochem Biophys Res Commun 303: 182-9. PMID: 12646184. Singaravelu G, Rahimi S, Krauchunas A, Rizvi A, Dharia S, Shakes D, Smith H, Golden A, Singson A. 2015. Forward Genetics Identifies a Requirement for the Izumo-like Immunoglobulin Superfamily spe-45 Gene in Caenorhabditis elegans Fertilization. Curr Biol 25: 3220-4. PMID: 26671668. Singson A, Hill KL, L'Hernault SW. 1999. Sperm competition in the absence of fertilization in Caenorhabditis elegans. Genetics 152: 201-8. PMID: 10224254. Wong A, He J, Wiltsie A, Krawiec V, Stanfield G. 2020. Crossing two sperm chromatin-localized mCherry transgenes into a single C. elegans strain boosts signal intensity without harming sperm function. MicroPubl Biol 2020: . PMID: 32550502. Funding: NIH R01HD054681 to AS and NIH R01GM201390 and NSF 1616661 to ASM Author Contributions: Amber R Krauchunas: Conceptualization, Formal analysis, Investigation, Visualization, Wri

Primary ciliary dyskinesia (PCD) is a genetic disorder in which impaired ciliary function leads to chronic airway disease. Exome sequencing of a PCD subject identified an apparent homozygous frameshift variant, c.887_890delTAAG (p.Val296Glyfs*13), in exon 5; this frameshift introduces a stop codon in amino acid 308 of the growth arrest-specific protein 2-like 2 (GAS2L2). Further genetic screening of unrelated PCD subjects identified a second proband with a compound heterozygous variant carrying the identical frameshift variant and a large deletion (c.867_*343+1207del; p.?) starting in exon 5. Both individuals had clinical features of PCD but normal ciliary axoneme structure. In this research, using human nasal cells, mouse models, and X. laevis embryos, we show that GAS2L2 is abundant at the apical surface of ciliated cells, where it localizes with basal bodies, basal feet, rootlets, and actin filaments. Cultured GAS2L2-deficient nasal epithelial cells from one of the affected individuals showed defects in ciliary orientation and had an asynchronous and hyperkinetic (GAS2L2-deficient = 19.8 Hz versus control = 15.8 Hz) ciliary-beat pattern. These results were recapitulated in Gas2l2(-/-) mouse tracheal epithelial cell (mTEC) cultures and in X. laevis embryos treated with Gas2l2 morpholinos. In mice, the absence of Gas2l2 caused neonatal death, and the conditional deletion of Gas2l2 impaired mucociliary clearance (MCC) and led to mucus accumulation. These results show that a pathogenic variant in GAS2L2 causes a genetic defect in ciliary orientation and impairs MCC and results in PCD.