Bioconversion is useful to produce optically pure enantiomers in the pharmaceutical industry, thereby avoiding problems with side reactions during organic synthesis processes. A short-chain dehydrogenase/reductase from Serratia marcescens BCRC 10948 (SmSDR) can stereoselectively convert 1-(3-hydroxyphenyl)-2-(methylamino) ethanone (HPMAE) into (R)-phenylephrine [(R)-PE], which is marketed medically as a nasal decongestant agent. The whole-cell conversion process for the synthesis of (R)-PE using SmSDR was reported to have an unexpectedly low conversion rate. We reported the crystal structure of the SmSDR and designed profitable variants to improve the enzymatic activity by structure-guided approach. Several important residues in the structure were observed to form hydrophobic clusters that stabilize the mobile loops surrounding the pocket. Of these, Phe98 and Phe202 face toward each other and connect the upper curvature from the two arms (i.e., the α7 helix and loopβ4–α4). The mutant structure of the double substitutions (F98YF202Y) exhibited a hydrogen bond between the curvatures that stabilizes the flexible arms. Site-directed mutagenesis characterization revealed that the mutations (F98Y, F98YF202Y, and F98YF202L) of the flexible loops that stabilize the region exhibited a higher transformation activity toward HPMAE. Together, our results suggest a robust structure-guided approach that can be used to generate a valuable engineered variant for pharmaceutical applications.

Aromatic l-amino acid decarboxylase deficiency (AADCD), attributed to mutations in the dopa decarboxylase (DDC) gene, is a rare neurometabolic disease resulting from a defect in the biosynthesis of dopamine and serotonin. The DDC c.714+4A>T mutation is the most prevalent mutation among patients with AADCD, and is also a founder mutation among Taiwanese patients. In this study, the molecular consequences and function of this mutation were examined in AADCD patient-derived lymphoblastoid cells. We identified novel DDC mRNA isoforms spliced with a new exon (exon 6a) in normal and c.714+4A>T lymphoblastoid cells. In addition, we identified the SR proteins (SRSF9 and SRSF6), as well as cis-elements involved in modulating the splicing of this mutated transcript. Notably, we demonstrated that antisense oligonucleotides (ASOs) were able to restore the normal mRNA splicing and increase the level of DDC protein, as well as its downstream product serotonin, in lymphoblastoid cells derived from the patient with AADCD, suggesting that these ASOs might represent a feasible alternative strategy for gene therapy of AADCD in patients with the common c.714+4A>T mutation.

A short-chain dehydrogenase/reductase from Serratia marcescens BCRC10948, SM_SDR, has been cloned and expressed in Escherichia coli for the bioconversion of 1-(3-hydroxyphenyl)-2-(methylamino) ethanone (HPMAE) to (R)-phenylephrine[(R)-PE]. However, only 5.11mM (R)-PE was obtained from 10mM HPMAE after a 9h conversion in the previous report. To improve the biocatalytic efficiency, the homologous expression of the SM_SDR in S. marcescens BCRC10948 was achieved using the T5 promoter for expression. By using 2% glycerol as carbon source, we found that 8.00±0.15mM of (R)-PE with more than 99% enantiomeric excess was produced from 10mM HPMAE after 12h conversion at 30°C and pH 7.0. More importantly, by using 50mM HPMAE as the substrate, 23.78±0.84mM of (R)-PE was produced after a 12h conversion with the productivity and the conversion yield of 1.98mmol (R)-PE/lh and 47.50%, respectively. The recombinant S. marcescens cells could be recycled 6 times for the production of (R)-PE, and the bioconversion efficiency remained at 85% when compared to that at the first cycle. Our data indicated that a high conversion efficiency of HPMAE to (R)-PE could be achieved using S. marcescens BCRC10948 cells that homologously express the SM_SDR.

Lactobacillus pentosus F03, a strain isolated from pig intestines in Taiwan, contains multiple endogenous plasmids. We isolated, completely sequenced, and characterized five of the plasmids present in L. pentosus F03 designated as pF03-1 (3282bp), pF03-2 (3293bp), pF03-3 (1787bp), pF03-4 (2138bp), and pF03-5 (1949bp). The replication types of these plasmids were predicted by comparing the features of the replicon nucleotides and the similarity of replication proteins with those of the plasmids of known replication types. The results of basic local alignment search tool analyses indicate that these plasmids, except for pF03-4, belong to different replicating plasmid families. According to replicon and initiator protein analyses, pF03-1, pF03-2, and pF03-3, were determined to belong respectively to the pMV158, pC194/pUB110, and pT181 families of rolling-circle replication plasmids. However, pF03-5 contains the typical features observed in the family of theta-replicating plasmids and belongs to the pUCL287 family of theta-replicating plasmids.

ABSTRACT Xanthomonas campestris pv. campestris 17 is a Gram-negative bacterium that is phytopathogenic to cruciferous plants in Taiwan. The 4,994,426-bp-long genome consists of 24 contigs with 4,050 protein-coding genes, 1 noncoding RNA (ncRNA) gene, 6 rRNA genes, and 55 tRNA genes.

Cabbage (Brassica oleracea L. var. capitata L.) is one of the most important vegetable crops grown worldwide. Scientists are using biotechnology in addition to traditional breeding methods to develop new cabbage varieties with desirable traits. Recent biotechnological advances in chloroplast transformation technology have opened new avenues for crop improvement. In 2007, we developed a stable plastid transformation system for cabbage and reported the successful transformation of the cry1Ab gene into the cabbage chloroplast genome. This chapter describes the methods for cabbage transformation using biolistic procedures. The following sections are included in this protocol: preparation of donor materials, coating gold particles with DNA, biolistic bombardment, as well as the regeneration and selection of transplastomic cabbage plants. The establishment of a plastid transformation system for cabbage offers new possibilities for introducing new agronomic and horticultural traits into Brassica crops.

(R)-Phenylephrine [(R)-PE] is an α1-adrenergic receptor agonist and is widely used as a nasal decongestant to treat the common cold without the side effects of other ephedrine adrenergic drugs. We identified a short-chain dehydrogenase/reductase (SM_SDR) from Serratia marcescens BCRC 10948 that was able to convert 1-(3-hydroxyphenyl)-2-(methylamino) ethanone (HPMAE) into (R)-PE. The SM_SDR used NADPH and NADH as cofactors with specific activities of 17.35±0.71 and 5.57±0.07mU/mg protein, respectively, at 30°C and pH 7.0, thereby indicating that this enzyme could be categorized as an NADPH-preferring short-chain dehydrogenase/reductase. Escherichia coli strain BL21 (DE3) expressing SM_SDR could convert HPMAE into (R)-PE with more than 99% enantiomeric excess. The productivity and conversion yield were 0.57mmolPE/lh and 51.06%, respectively, using 10mM HPMAE. Fructose was the most effective carbon source for the conversion of HPMAE to (R)-PE.

Background: An amino alcohol dehydrogenase gene (RE_AADH) from Rhodococcus erythropolis BCRC 10909 has been used for the conversion of 1-(3-hydroxyphenyl)-2-(methylamino) ethanone (HPMAE) to (S)-phenylephrine [(S)-PE]. However RE_AADH uses NADPH as cofactor, and only limited production of (S)-PE from HPMAE is achieved.Methods: A short-chain dehydrogenase/reductase gene (SQ_SDR) from Serratia quinivorans BCRC 14811 was expressed in Escherichia coli BL21 (DE3) for the conversion of HPMAE to (S)-PE.Results: The SQ_SDR enzyme was capable of converting HPMAE to (S)-PE in the presence of NADH and NADPH, with specific activities of 26.5 +/- 2.3 U/mg protein and 0.24 +/- 0.01 U/mg protein, respectively, at 30 degrees C and at a pH of 7.0. The E. coli BL21 (DE3), expressing NADH-preferring SQ_SDR, converted HPMAE to (S)-PE with more than 99% enantiomeric excess, a conversion yield of 86.6% and a productivity of 20.2 mmol/I h, which was much higher than our previous report using E. coli NovaBlue expressing NADPH-dependent RE_AADH as the biocatalyst.Conclusion: The SQ_SDR enzyme with its high catalytic activity and strong preference for NADH as a cofactor provided a significant advantage in bioreduction. (C) 2013 Elsevier Ltd. All rights reserved.

Cyclic di-GMP (c-di-GMP) is a novel secondary-messenger molecule that is involved in regulating a plethora of important bacterial activities through binding to an unprecedented array of effectors. Proteins with a canonical PilZ domain that bind c-di-GMP play crucial roles in regulating flagellum-based motility. In contrast, noncanonical type II PilZ domains that do not effectively bind c-di-GMP regulate twitching motility, which is dependent on type IV pili (T4P). Recent data indicate that T4P biogenesis is initiated via the interaction of a noncanonical type II PilZ protein with the GGDEF/EAL-domain protein FimX and the pilus motor protein PilB at high c-di-GMP concentrations. However, the molecular details of such interactions remain to be elucidated. In this manuscript, the first hetero-complex crystal structure between a type II PilZ protein and the EAL domain of the FimX protein (FimX(EAL)) from Xanthomonas campestris pv. campestris (Xcc) in the presence of c-di-GMP is reported. This work reveals two novel conformations of monomeric c-di-GMP in the XccFimX(EAL)-c-di-GMP and XccFimX(EAL)-c-di-GMP-XccPilZ complexes, as well as a unique interaction mode of a type II PilZ domain with FimX(EAL). These findings indicate that c-di-GMP is sufficiently flexible to adjust its conformation to match the corresponding recognition motifs of different cognate effectors. Together, these results represent a first step towards an understanding of how T4P biogenesis is controlled by c-di-GMP at the molecular level and also of the ability of c-di-GMP to bind to a wide variety of effectors.

PilZ domain is one of the key receptors for the newly discovered secondary messenger molecule cyclic di-GMP (c-di-GMP). To date, several monomeric PilZ domain proteins have been identified. Some exhibit strong c-di-GMP binding activity, while others have barely detectable c-di-GMP binding activity and require an accessory protein such as FimX to indirectly respond to the c-di-GMP signal. We now report a novel tetrameric PilZ domain structure of XCC6012 from the plant pathogen Xanthomonas campestris pv. campestris (Xcc). It is one of the four PilZ domain proteins essential for Xcc pathogenicity. Although the monomer adopts a structure similar to those of the PilZ domains with very weak c-di-GMP binding activity, it is nevertheless interrupted in the middle by two extra long helices. Four XCC6012 proteins are thus self-assembled into a tetramer via the extra heptad repeat α3 helices to form a parallel four-stranded coiled-coil, which is further enclosed by two sets of inclined α2 and α4 helices. We further generated a series of XCC6012 variants and measured the unfolding temperatures and oligomeric states in order to investigate the nature of this novel tetramer. Discovery of this new PilZ domain architecture increases the complexity of c-di-GMP-mediated regulation.

The crystal structure of the microbial transglutaminase (MTGase) zymogen from Streptomyces mobaraense has been determined at 1.9-Å resolution using the molecular replacement method based on the crystal structure of the mature MTGase. The overall structure of this zymogen is similar to that of the mature form, consisting of a single disk-like domain with a deep active cleft at the edge of the molecule. A major portion of the prosequence (45 additional amino acid residues at the N terminus of the mature transglutaminase) folds into an L-shaped structure, consisting of an extended N-terminal segment linked with a one-turn short helix and a long α-helix. Two key residues in the short helix of the prosequence, Tyr-12 and Tyr-16, are located on top of the catalytic triad (Cys-110, Asp-301, and His-320) to block access of the substrate acyl donors and acceptors. Biochemical characterization of the mature MTGase, using N-α-benzyloxycarbonyl-l-glutaminylglycine as a substrate, revealed apparent Km and kcat/Km values of 52.66 mm and 40.42 mm−1 min−1, respectively. Inhibition studies using the partial prosequence SYAETYR and homologous sequence SQAETYR showed a noncompetitive inhibition mechanism with IC50 values of 0.75 and 0.65 mm, respectively, but no cross-linking product formation. Nevertheless, the prosequence homologous oligopeptide SQAETQR, with Tyr-12 and Tyr-16 each replaced with Gln, exhibited inhibitory activity with the formation of the SQAETQR-monodansylcadaverine fluorophore cross-linking product (SQAETQR-C-DNS). MALDI-TOF tandem MS analysis of SQAETQR-C-DNS revealed molecular masses corresponding to those of NSQAETQC-C-DNS and C-DNS-NQRC sequences, suggesting the incorporation of C-DNS onto the C-terminal Gln residue of the prosequence homologous oligopeptide. These results support the putative functional roles of both Tyr residues in substrate binding and inhibition.

Bacterial RecA is a multifunctional protein,1-3 participating in a variety of activities such as ATP hydrolysis (as an ATPase), LexA repressor cleavage (as a coprotease), homologous DNA strand exchange (as a recombinase), and SOS responses when assembled on ssDNA and forms a helical nucleoprotein filament. Although homologous recombination plays important roles in maintaining structural and functional integrity of a genome, proteins associated with this activity need to be tightly regulated to prevent unnecessary DNA exchanges that may be lethal.4 Recently, a plethora of proteins exhibiting regulatory function against RecA activities, including RecBCD,5 RecF,6 RecO,7, 8 RecR,9, 10 DinI,11, 12 RdgC,13 and UvrD proteins, and so forth, have been discovered. But regulatory proteins affecting the RecA functions are not completely understood yet, and new members are being added to this regulatory network steadily.4 RecX is a recent addition to this RecA regulatory network. It is first described in 1993 in Pseudomonas aeruginosa as an open reading frame (ORF) located downstream of recA.14 Since then, many recX homologs have been detected in other microorganisms, including Escherichia coli,15-18 Deinococcus radiodurans,19, 20 Neisseria gonorrhoeae,21 Mycobacterium tuberculosis,22 Streptomyces lividans,23 Herbaspirillum seropedicae,24 Thermus thermophilus,25 Thiobacillus ferrooxidans,26 Xanthomonas campestris,27, 28 and X. oryzae.29 Sequence alignments between these RecX proteins indicated that they are moderately conserved with sequence identity values of roughly 30%, having a molecular weight of ∼20 kDa and an alkaline pI ranging from 8.8 to 10.7.30 RecX has been shown to serve different roles in different organisms. For instance, although it is shown to be a potent inhibitor protein against the various RecA functions,15, 16, 31 it is found to be required for UV resistance in E. coli and for recombination in N. gonorrhoeae.21 Overexpression of RecA is also lethal in the recX deletion mutants of P. aeruginosa,14 X. oryzae,27 and S. lividans.23 Furthermore, RecX is also found to repress the induction of antioxidant enzymes in D. readiodurans,19 suggesting that RecX can act as a repressor in regulating the expression of certain genes. These results indicate that RecX protein can be considered as a multifunctional protein but needs more studies to elucidate its various roles. To date, the structural information of RecX is still limited, although RecX has been shown to function as a potent inhibitor against the various RecA activities, such as the ATP hydrolysis,15, 31 LexA repressor cleavage,16 homologous DNA strand exchange,15, 16, 31 and RecA filament capping32 in vitro, among the others. To better understand the structure and function of RecX from X. campestris, we have, in this manuscript, determined its crystal structure to a high resolution of 1.5 Å. The final structure reveals that XcRecX adopts a novel tandem repeats of three-helix bundle. Preliminary docking study of XcRecX with XcRecA indicates that XcRecX can fit into the groove of the XcRecA filament, implying possible inhibition of XcRecX against the various activities of the XcRecA filament. The recX gene was PCR amplified directly from the plant pathogen X. campestris pv. campestris str. 17 (Xcc) using a forward primer 5′-TACTTCCAATCCAATGCTAT GAGTGAGCAAGCGCCCGCACC and a backward primer 5′-TTATCCACTTCCAATGTCAGTCCTCAAGGTCGAAGC GTGTTGCCA, for forming the fragment of required length. The PCR fragment has correct size in a SDS-PAGE experiment and was confirmed by DNA sequencing. A ligation-independent cloning (LIC) approach33, 34 was used to obtain the desired constructs. The final construct codes for a N-terminal His6 tag, a 17 amino acid linker, and the XcRecX target under the control of a T7 promoter. Overexpression of the Hig6-tag target protein was induced by the addition of 0.5 mM IPTG at 293 K for 20 h. The target protein was purified by immobilized metal affinity chromatography (IMAC) on a nickel column (Sigma). The His6-tag and linker was cleaved from XcRecX by tobacco etch virus (TEV) protease at 277 K for 16 h. For crystallization, XcRecX protein was further purified on a Superdex 200 column (AKTA, Pharmacia). The final fresh target protein exhibits purity greater than 99% and contains only an extra tripeptide (SNA) at the N-terminal end. Se-Met-labeled XcRecX was prepared in a similar way and was produced using an E. coli strain BL21 (DE3) as the host in the absence of methionine but with ample amounts of Se-met (100 mg/L). The M9 medium consists of 1 g of NH4Cl, 3 g of KH2PO4, and 6 g of Na2HPO4 supplemented with 20% (W/V) of glucose, 0.3% (W/V) of MgSO4, and 10 mg of FeSO4 in 1 L of double-distilled water. The induction was conducted at 293 K for 24 h by the addition of 0.5 mM IPTG. Purification of the Se-Met-labeled XcRecX protein was performed using the protocols as established for the native proteins. For crystallization, the native protein was concentrated to 8 mg/mL in 40 mM Tris-HCl, 500 mM NaCl using an Amicon Ultra-10 (Millipore). Screening for crystallization condition was performed by using a sitting-drop vapor diffusion method in 96-well plates (Hampton Research) at 277° K by mixing 0.5 μL protein solution with 0.5 μL reagent solution. Initial screens including the Hampton Clear Strategy Screen 1, the Structure Screens 1 and 2, a systematic PEG-pH screen, and a PEG/Ion screen were performed using the Gilson C240 crystallization workstation. Needle-like crystals appeared in 1 week from a reservoir solution comprising 0.1M Tris (pH 8.5), 0.3M Na(OAc), 15% PEG4000. Crystals suitable for diffraction experiments were grown by mixing 1.5 μL protein solution with 1.5 μL reagent solution at 277° K and reached dimensions of 0.1 mm × 0.1 mm × 0.4 mm after 1 week. Se-Met-labeled XcRecX was crystallized in the same way. Crystal was flash-cooled at 100 K under a stream of cold nitrogen. X-ray diffraction data was collected using the National Synchrotron Radiation Research Center (NSRRC) beamline 13B1 in Taiwan. A two-wavelength MAD data setup to 1.5 Å resolution were obtained. The data were indexed and integrated using the HKL2000 processing software,35 giving a data set that is ∼99% complete with overall Rmerge of 5.0–5.6% on intensities. The refinement of selenium atom positions, phase calculation, and density modification were performed using the program SOLVE/RESOLVE.36 The model was manually adjusted using the XtalView/Xfit package. CNS37 was then used for refinement to a final Rcryst of 18.7% and Rfree of 22.2%, respectively. The crystals belong to the P43 space group. The data collection and refinement statistics are summarized in Table I. The coordinates and structural factors of the XcRecX monomer have been deposited in the Protein Data Bank (accession number 3DDFG). Xc2845 was annotated as a RecX protein of the Pfam02631 family with an E value of 8e−09. It is located in a lexA-recA-recX gene cluster that contains a discretepromoter for each gene.27 Its direct interaction with XcRecA was confirmed by an immunoprecipitation experiment in vitro (using anti-XcRecX as a bait to pull down the XcRecX and XcRecA proteins, which was confirmed in a PAGE experiment by the anti-XcRecX and anti-XcRecA antibodies, respectively) and by a yeast two hybrid assay system in vivo (data not shown).16 Furthermore, XcRecX was also found to inhibit the XcRecA-mediated ATPase and coprotease activities (data not shown).15, 16 Having demonstrated that XcRecA exhibits ATPase and coprotease activities and that XcRecX inhibits XcRecA-mediated enzyme activities, we further determined the XcRecX tertiary structure to get a more thorough understanding of its inhibition mechanisms. After extensive tries, we are finally able to obtain needle-like crystals of XcRecX when grown in 0.3M sodium acetate, 15% PEG4000, 0.1M Tris buffer (pH 8.5) by a sitting-drop vapor diffusion method (data not shown). The phases and initial structure were determined by the multiple anomalous dispersion (MAD) approach to a resolution of 2.0 Å using a single crystal of Se-Met-substituted protein. The final structure was obtained by repeated refinement to a resolution of 1.5 Å, with final Rcrys and Rfree values of 18.7% and 22.2%, respectively. The XcRecX crystals belong to the space group of P43 and contain one molecule in each asymmetric unit. The data collection and refinement statistics are shown in Table I. The overall geometry of XcRecX is very good, with no backbone torsional angle deviating from the mostly favorable region in the Ramachandran plot. The final model comprises 142 amino acids, including residues from Gln17 to Phe158, and numerous well-defined water molecules, 256 in total. XcRecX forms a monomer in solution, as clearly demonstrated by the gel filtration and analytical ultracentrifugal experiments (data not shown). It contains 162 amino acids [Fig. 1(a)] and is an all-helix protein, consisting of 69.7% of α helix and 30.3% of random coil. It adopts a unique architecture comprising tandem repeats of three-helix bundle [Fig. 1(a,b)]. However, the geometry between the repeats is not uniform, with the axes between the R2-R3 repeats connected in a more or less collinear way, whereas those between the R1-R2 repeats in a more orthogonal way. The XcRecX thus adopts an “L-shaped” structure, with a short arm comprising the R1 repeat of 46 residues from amino acid Gln17 to Gly62 and a long arm comprising the R2 and R3 repeats of 47 residues and 49 residues, starting from amino acid Trp63 to Glu109 and Gly110 to Phe158, respectively [Fig. 1(a)]. The primary sequence and tertiary structure of XcRecX. (a) The primary sequence and secondary structural elements. Helices of the first helical bundle repeat are drawn above the sequence in blue columns, second repeat in green columns, and third repeat in red columns. (b) The stereo picture of the XcRecX tertiary structure drawn in ribbon. The R1 repeat was colored blue, R2 repeat colored green, and R3 repeat colored red. The axis of the R1 helical bundle forms a nearly 90° angle with the approximately collinear R2-R3 axes, causing the overall structure to form a “L-shaped” conformation. (c) The XcRecX tertiary structure drawn in electrostatic plot. Left figure shows the plot viewed from the concave side, whereas right figure viewed from the convex side. Positive charge is shown in blue and negative charge in red. Distinct bipolar nature is obvious from this figure, which indicates that the convex side is the likely place for interacting with nucleic acid molecules. Tandem repeats are usually consisted of small module, but multiple copies of these modules can be packed in unique ways to form elongated and curved structures for recognizing long nucleic acid sequences.38, 39 This strategy has indeed been incorporated by nature to form three-helix bundle repeats for recognizing various dsDNA.38-41 Similarly, XcRecX also comprises three-helix bundle repeats and contains an apparent bipolar electrostatic surface [Fig. 1(c)] as other three-helix bundles, which enables XcRecX to bind ssDNA and dsDNA (data not shown) through its positive charge-enriched surface. The multiple sequence and structural alignments of the XcRecX three-helix bundles are shown in Figure 2(a). They can superimpose very well with each other except for the loops connecting helix 1 to helix 2 [Fig. 2(b)]. Structural alignment using the MUSTANG program (http://www.cs.mu.oz.au/∼arun/mustang/)42 gives a r.m.s.d of 1.33 Å for 26 Cαs out of 40 residues between R1 and R2, and 0.75 Å for 27 Cαs out of 40 residues between R2 and R3 [Fig. 2(a)]. However, sequence identities between the repeats are not very high; that between R1 and R2 is only 17.6%, and that between R2 and R3 is only 19.2%. This phenomenon is similar to other HTH motifs, in which large sequence diversity can be tolerated within the HTH motif.43 Similar to other helix bundle proteins,44 nonpolar residues from every helix of the XcRecX bundles interdigitiate to form a hydrophobic core, as shown in a typical repeat of R1 in Figure 2(c). Comparison of three-helix bundles. (a) The multiple sequence and structural alignments of the H1, H2, and H3 helices of the R1, R2, and R3 repeats of the XcRecX three-helix bundle. The helices are drawn in columns above the sequences and shown in blue for the first repeat, green for the second repeat, and red for the third repeat, respectively. The highly conserved residues are shown in red, and conserved hydrophobic residues in the core region are marked with gray circles below the sequences. (b) Superimposition of the three repeats of XcRecX in stereo. The first repeat is drawn in blue, second repeat in green, and third in pink. The three-helix bundles in XcRecx can superimpose well with each other, except for the loops connecting helix 1 to helix 2. (c) A typical hydrophobic core of the three-helix bundle in XcRecX. Hydrophobic residues from each helix interdigitate to form a stable hydrophobic core for the three-helix bundle. (d) Superimposition in stereo of the XcRecX R1 three-helix bundle with a typical ds-DNA binding three-helix bundle of the c-Myb protein. The first, second, and third helices of the XcRecX R1 bundle are marked in H1/H2/H3 and colored blue, green, and red, whereas those of the c-Myb marked in h1/h2/h3, and colored light blue, pale green, and pink, respectively. It is clear that while the H3 and h3 helices of the two three-helix bundles superimpose extremely well, the H2/h2 and H1/h1 helices deviate to a significant extent. The helical appositions of the XcRecX three-helix bundles are very different from other three-helix bundles, such as that of the c-Myb tandem repeat (1H88).41 When the two three-helix bundles are superimposed, only one of the helices (H3 or h3) in the bundles can be superimposed well [Fig. 2(d)], whereas both H1 and H2 helices is found to exhibit significant deviations from the h1 and h3 helices, respectively. The c-Myb three-helix bundle repeat structure is also more curved than XcRecX. Thus tandem repeat modules have evolved to exhibit considerable flexibility in binding different DNA sequences.38-41 As stated earlier, the axes of the R1/R2 repeats are more linear, whereas those of the R2/R3 repeats are more orthogonal, resulting in an “L-shaped” architecture for the XcRecX tandem repeats. The angles are well defined by the strong interactions between the R1/R2 and R2/R3 repeats, as shown in Figure 3(a,b), respectively. Plenty of H-bonds, salt bridges, and hydrophobic interactions are extensively employed in this tandem repeat architecture to form the unique angles between the three-helix bundles. In the R1/R2 repeats, four H-bonds are found between the side chain atoms of Arg68, Gln64, Asp66, and Lys35, and the backbone oxygen atoms of Trp63, His32, Lys34, and Thr93, respectively [Fig. 3(a)]. Interestingly, the Cα and Cβ carbons of Ser33 are found to stack very well with the phenyl ring of Phe69 [connected by a dotted gray line in Fig. 3(a)], which, along with the side chains of Val73 and His94, form a hydrophobic core between the R1 and R2 repeats. In the R2/R3 repeats, one H-bond between the backbone atoms of G146 and Leu85, and two H-bonds between the side chain atom and backbone atom of Arg145 and the backbone atoms of Gly81 and Gly83 are detected [Fig. 3(b)]. Besides, three hydrophobic residues, Phe108, Trp112, and Pro84, each from a different helix of the bundle, are found to form interesting interdigitated hydrophobic interactions [connected by dotted gray lines in Fig. 3(b)]. A perpendicular Gly83-Hα and Phe147-phenyl ring interaction is also found [Fig. 3(b)]. Such a special perpendicular CH/π interaction is believed to play a role in stabilizing protein conformation.45 Interactions between the XcRecX three-helical bundle repeats. The R1/R2 and R2/R3 repeat interfaces are shown in stereo in Figure 3(a, b), respectively. The R1 repeat is drawn in blue, R2 in green, and R3 in pink. Residues involved in interfacial interactions are shown in ball-and-stick, with those participating in H-bonds connected in dotted orange lines, and those in hydrophobic interactions in dotted gray lines. Oxygen atoms are shown in red, nitrogen atoms in blue, and carbon atoms in gray. Interesting interdigitated hydrophobic interactions among the Phe108, Trp112, and Pro84 residues, each from a different helix, is observed. A perpendicular CαH-phenyl ring interaction between the Gly83 and Phe147 residues is also found. Interestingly, this “L-shaped” XcRecX structure turns out to fit into the notch of the XcRecA dimer and the deep groove of the XcRecA filament very well (data not shown). Three-helix bundle proteins comprise HTH motif, which is extensively employed in proteins with nucleic acid-binding capability.38, 40, 41, 46 In searches for structural homologs of XcRecX using the DALI program,47 with all three tandem repeats as a search model, no hit with Z-score greater than 5 was found; most returned structures display similarity with only one of the repeats. The other typical three-helix bundle repeat protein, such as the c-Myb,41, 48 is much more curved, exhibiting very different apposition of the component helices, and could not be overlapped with XcRecX at all [Fig. 2(d)]. In this respect, the tandem repeats of the XcRecX three-helix bundle can be considered unique, structurally speaking. In this manuscript, we report the crystal structure of RecX protein from the plant pathogen X. campestris that has been determined to a high resolution of 1.50 Å using X-ray crystallography. It adopts a three-helix bundle tandem repeat that bears significant difference to other reported three-helix bundle repeats. A modeled XcRecA/XcRecX filament structure indicates that XcRecX can fit into the notch and the deep groove of the XcRecA filament very well (data not shown), which can partially explain the inhibition mechanisms of the various XcRecA activities. The coordinates of two other RecX protein structures from E. coli (3C1D, determined to a resolution of 1.80 Å)49 and L. reuteri (3D5L, determined to a resolution of 2.35 Å) are recently released. They also adopt a similar structure of three-helix bundle repeats as XcRecX, except that the structure from L. reuteri contains an extra N-terminal domain comprising five β-strands and one helix. XcRecX can superimpose well to the EcRecX and LrRecX structures, with a r.m.s.d. of 1.52 and 1.40 Å for the superimposition of 94 and 95 Cαs out of 142 Cαs of XcRecX, respectively. But the angles between the short and long arms of the “L” shape tandem repeats are distinctive for each RecX protein. Whether such structural differences are related to their functions remain to be elucidated. The authors thank the Core Facilities for Protein X-ray Crystallography in the Academia Sinica, Taiwan, for help in crystal screening, and the National Synchrotron Radiation Research Center (NSRRC) in Taiwan, and the SPring-8 Synchrotron facility in Japan for assistance of X-ray data collection. The National Synchrotron Radiation Research Center is a user facility supported by the National Science Council, Taiwan, Republic of China, and the Protein Crystallography Facility is supported by the National Research Program for Genomic Medicine, Taiwan, Republic of China.

In this study, plasmid pBBad22K was modulated to be able to coexpress the subunits of Xanthomonas campestris pv. campestris (Xcc) core RNA polymerase (RNAP) in an Escherichia coli host. The subunit-encoding genes of Xcc core RNAP were PCR-amplified respectively to convert into gene cassettes in which an intact subunit-encoding gene and a ribosome binding site (RBS) preceding the gene were contained, and were then cloned one by one into pBBad22K. In addition, a hexahistidine tag (His-tag) was introduced into the C-terminus of α subunit-encoded rpoA during PCR for facilitating purification of Xcc core RNAP. The resultant vectors, pBC-CBA and pBC-CBAZ, were used for overproduction of Xcc core RNAP lacking or containing ω, respectively. The assembly of Xcc core RNAP subunits that were coexpressed from these vectors was demonstrated after purification via two-step column chromatography. The yield of Xcc core RNAP containing ω had a 67% increase compared with that of one lacking ω, indicating that ω promotes the assembly of Xcc core RNAP. In addition, Xcc core RNAP lacking ω showed a 13-fold decrease in enzymatic activity in comparison with that containing ω. Promoter-specific transcription assays by recombinant Xcc core RNAP reconstituted with external added σ factor showed that the absence of ω debilitates the transcriptional activity of Xcc RNAP. Our results demonstrated that ω is not only capable of strengthening the stability, but is also required for the maintenance of enzymatic activity of Xcc RNAP.

The genomic DNA segment encoding the rpoE gene and its flanking region was cloned from Xanthomonas campestris pv. campestris strain 11 (Xc11). The transcriptional start site of rpoE was located at nucleotide G, which is 33 nucleotides preceding the putative translation initiation codon of rpoE, and a extracytoplasmic function sigma factors (sigma(E))-dependent promoter was identified with -35 (5'-GAACTT-3') and -10 (5'-TCTCA-3') consensus sequences. The protein encoded by rpoE gene acted as a sigma (sigma) factor and was sufficient to direct core RNA polymerase to the rpoE promoter and to stimulate initiation of transcription in vitro. The specific binding of the reconstituted Esigma(E) holoenzyme with the Xc11 rpoE promoter was demonstrated by gel retardation assay and DNAse I footprint analysis. This study clearly demonstrated that the rpoE-rseA-mucD genomic organization of X. campestris is similar to that found in Xylella fastidiosa; however, expression of rpoE in X. campestris is autoregulated by its own sigma(E)-dependent promoter.

A novel microbial transglutaminase (TGase) from the cultural filtrate of Streptomyces netropsis BCRC 12429 (Sn) was purified. The specific activity of the purified TGase was 18.2 U/mg protein with an estimated molecular mass of 38 kDa by sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis. The TGase gene of S. netropsis was cloned and an open reading frame of 1,242 bp encoding a protein of 413 amino acids was identified. The Sn TGase was synthesized as a precursor protein with a preproregion of 82 amino acid residues. The deduced amino acid sequence of the mature S. netropsis TGase shares 78.9-89.6% identities with TGases from Streptomyces spp. A high level of soluble Sn TGase with its N-terminal propeptide fused with thioredoxin was expressed in E. coli. A simple and efficient process was applied to convert the purified recombinant protein into an active enzyme and showed activity equivalent to the authentic mature TGase.

A novel restriction-modification (R-M) system, designated as xveIIRM, from chromosomal DNA of the Xanthomonas campestris pv. vesicatoria strain 7-1 (Xcv7-1) was cloned and characterized. The xveIIRM genes involved in this R-M system are aligned in a tail-to-tail orientation and overlapped by 12 base pairs. XveII methyltransferase gene could encode a 299-amino acid protein (M.XveII) with an estimated mass of 33.7 kDa and was classified to be a member of beta-class of m4C-MTase. M.XveII methylates the second cytosine of the 5'-CCCGGG-3' recognition sequence. The predicted amino acid sequence of the intact XveII endonuclease shared 41.9% identity with SmaI. However, a premature TAA translation termination codon was found in the open reading frame of xveIIR and expected to encode an 18.3 kDa truncated protein. The sequence data are consistent with observation of this study that no SmaI-like restriction activity could be detected in the cell extract of Xcv7-1.

Background Genome-wide identification of specific oligonucleotides (oligos) is a computationally-intensive task and is a requirement for designing microarray probes, primers, and siRNAs. An artificial neural network (ANN) is a machine learning technique that can effectively process complex and high noise data. Here, ANNs are applied to process the unique subsequence distribution for prediction of specific oligos. Results We present a novel and efficient algorithm, named the integration of ANN and BLAST (IAB) algorithm, to identify specific oligos. We establish the unique marker database for human and rat gene index databases using the hash table algorithm. We then create the input vectors, via the unique marker database, to train and test the ANN. The trained ANN predicted the specific oligos with high efficiency, and these oligos were subsequently verified by BLAST. To improve the prediction performance, the ANN over-fitting issue was avoided by early stopping with the best observed error and a k-fold validation was also applied. The performance of the IAB algorithm was about 5.2, 7.1, and 6.7 times faster than the BLAST search without ANN for experimental results of 70-mer, 50-mer, and 25-mer specific oligos, respectively. In addition, the results of polymerase chain reactions showed that the primers predicted by the IAB algorithm could specifically amplify the corresponding genes. The IAB algorithm has been integrated into a previously published comprehensive web server to support microarray analysis and genome-wide iterative enrichment analysis, through which users can identify a group of desired genes and then discover the specific oligos of these genes. Conclusion The IAB algorithm has been developed to construct SpecificDB, a web server that provides a specific and valid oligo database of the probe, siRNA, and primer design for the human genome. We also demonstrate the ability of the IAB algorithm to predict specific oligos through polymerase chain reaction experiments. SpecificDB provides comprehensive information and a user-friendly interface.

CLP is a homologue of cyclic AMP-receptor protein in Xanthomonas campestris. In this study, proteomic analysis and Western blotting showed that the clp mutant (TC820) of X. campestris synthesizes less GroESL proteins than the parental P20H. The groESL upstream regions, nt -583 to -32 (552 bp) and nt -178 to -29 (150 bp) relative to the groESL initiation codon, were cloned for transcriptional fusion assays. The 150-bp region, bearing putative sigma24- and sigma32-binding sites and the CIRCE element all known to regulate groESL operon, expressed the same levels of beta-galactosidase (300 U/ml) in both strains, indicating that CLP is not involved in the expression from this region. At early exponential phase, the 552-bp region displayed extremely high levels of promoter activity, 11,000 U/ml in P20H versus 5000 U/ml in TC820. The enzyme levels were about 2000 U/ml at stationary phase in both strains, indicating high levels of expression when cells cease growing. These results suggest that the sequence responding to CLP regulation resides between nt -178 and -583. However, since this region has no CLP-binding site and showed no binding to CLP in gel retardation assay, CLP is likely acting indirectly. This communication appears to be the first description of the positive regulation of a bacterial heat-shock operon by a CRP homologue.

φXo, Xf, φLf, φXv, and Cf are filamentous bacteriophages isolated in Taiwan. Both φXo and Xf specifi- cally infect Xanthomonas oryzae pv. oryzae, and φLf, φXv, and Cf specifically infect X. campestris pv. campestris, X. campestris pv. vesicatoria, and X. campestris pv. citri, respectively. In this study, the φXo gene III (gIII) encod- ing the adsorption protein (pIII) was cloned by probing with the φLf gIII. Sequence analysis revealed that the φXo gIII is 1,023-nt long and able to encode a pre-protein of 340 aa (35,337 Da), with structural features typical of filamentous phage adsorption proteins: an N-terminal signal sequence (18 aa), a central region (90 aa) containing 38 glycine, 29 aspartic acid and 19 histidine residues, and a C-terminal membrane-anchoring domain (17 aa). The φXo pIII purified from the phage particles migrated as a 42-kDa band in SDS-polyacrylamide gel, which is substantially larger than that deduced from the nucleotide sequence, presumably due to the presence of the long stretch of charged residues in the central region. The φXo pIII could cross-react with the antiserum specific to φLf pIII, which also cross-reacts with φXv pIII. Like the situations in φLf and φXv, the pIIIs of φLf and φXo are also interchangeable. The gIII and the flanking regions of φLf, φXv and φXo are highly homologous and similar in size, but φXo has a genome (7.6 kb) larger than that of φLf (6.0 kb) and φXv (6.4 kb), suggesting that φXo is able to accommodate more genes and/or have longer intergenic regions in the remaining part of the genome. Difference in sizes between the pIIIs indicates that φXo and Xf, which has a predicted pre-pIII of 488 aa (51,036 Da), are distinct phages.