On the basis of preclinical studies of NC-6004, a cisplatin-incorporated micellar formulation, we hypothesised that NC-6004 could show lower toxicity than cisplatin and show greater anti-tumour activity in phase I study. A total of 17 patients were recruited in a range of advanced solid tumour types. NC-6004 was administered intravenously (i.v.) every 3 weeks. The dose escalation started at 10 mg m−2 and was increased up to 120 mg m−2 according to the accelerated titration method and modified Fibonacci method. One dose-limiting toxicity (DLT) occurred in a patient who was given 90 mg m−2 of NC-6004, otherwise any significant cisplatin-related toxicity was not observed or generally mild toxicity was observed. Despite the implementation of post-hydration and pre-medication regimen, renal impairment and hypersensitivity reactions still developed at 120 mg m−2, which led to the conclusion that the maximum tolerated dose was 120 mg m−2, and the recommended dose was 90 mg m−2, although DLT was not defined as per protocol. Stable disease was observed in seven patients. The maximum concentration and area under the concentration–time curve of ultrafilterable platinum at 120 mg m−2 NC-6004 were 34-fold smaller and 8.5-fold larger, respectively, than those for cisplatin. The delayed and sustained release of cisplatin after i.v. administration contributes to the low toxicity of NC-6004.

Hypoxia is as an indicator of poor treatment outcome. Consistently, hypoxic HCT116 colorectal cancer cells are resistant to oxaliplatin, although the mechanistic basis is unclear. This study sought to investigate the relative contribution of HIF-1 (hypoxia-inducible factor-1)-mediated gene expression and drug penetrance to oxaliplatin resistance using three-dimensional spheroids. Hypoxia-inducible factor-1α function was suppressed by the stable expression of a dominant-negative form in HCT116 cells (DN). Cells were drug exposed as monolayer or multicellular spheroid cultures. Cells residing at differing oxygenation status were isolated from Hoechst 33342-treated spheroids using flow cytometry. Sub-populations were subjected to clonogenic survival assays and to Inductively-Coupled Plasma Mass Spectroscopy to determine oxaliplatin uptake. In spheroids, a sensitivity gradient (hypoxic

A pharmacokinetic–pharmacodynamic study was carried out to investigate the feasibility and potential importance of therapeutic monitoring following high-dose carboplatin treatment in children. High-dose carboplatin was administered over 3 or 5 days, with the initial dose based on renal function, to achieve target area under the plasma concentration–time curve (AUC) values of 21 or 20 mg ml −1 .min, respectively. Dose adjustment was carried out based on observed individual daily AUC values, to obtain the defined target exposures. Platinum–DNA adduct levels were determined in peripheral blood leucocytes and toxicity data were obtained. Twenty-eight children were studied. Based on observed AUC values, carboplatin dose adjustment was performed in 75% (21 out of 28) patients. Therapeutic monitoring resulted in the achievement of carboplatin exposures within 80–126% of target AUC values, as compared to estimated exposures of 65–213% of target values without dose adjustment. The carboplatin AUC predicted with no dose modification was positively correlated with pretreatment glomerular filtration rate (GFR) values. Higher GFR values were observed in those patients who would have experienced AUC values >25% above the target AUC than those patients attaining AUC values >25% below the target AUC, following renal function-based dosing. Platinum–DNA adduct levels correlated with observed AUC values on day 1 of carboplatin and increased over a 5-day course of treatment. Real-time monitoring of carboplatin pharmacokinetics with adaptive dosing is both feasible and necessary for the attainment of consistent AUC values in children receiving high-dose carboplatin treatment. Pharmacodynamic data suggest a strong correlation between carboplatin pharmacokinetics and the drug–target interaction.

The degree of damage to DNA following ifosfamide (IFO) treatment may be linked to the therapeutic efficacy. The pharmacokinetics and metabolism of IFO were studied in 19 paediatric patients, mostly with rhabdomyosarcoma or Ewings sarcoma. Ifosfamide was dosed either as a continuous infusion or as fractionated doses over 2 or 3 days. Samples of peripheral blood lymphocytes were obtained during and up to 96 h after treatment, and again prior to the next cycle of chemotherapy. DNA damage was measured using the alkaline COMET assay, and quantified as the percentage of highly damaged cells per sample. Samples were also taken for the determination of IFO and metabolites. Pharmacokinetics and metabolism of IFO were comparable with previous studies. Elevations in DNA damage could be determined in all patients after IFO administration. The degree of damage increased to a peak at 72 h, but had returned to pretreatment values prior to the next dose of chemotherapy. There was a good correlation between area under the curve of IFO and the cumulative percentage of cells with DNA damage (r2=0.554, P=0.004), but only in those patients receiving fractionated dosing. The latter patients had more DNA damage (mean±s.d., 2736±597) than those patients in whom IFO was administered by continuous infusion (1453±730). The COMET assay can be used to quantify DNA damage following IFO therapy. Fractionated dosing causes a greater degree of DNA damage, which may suggest a greater degree of efficacy, with a good correlation between pharmacokinetic and pharmacodynamic data.

SJG-136, a pyrrolo[2,1-c][1,4]benzodiazepine (PBD) dimer, is a highly efficient interstrand crosslinking agent that reacts with guanine bases in a 5'-GATC-3' sequence in the DNA minor groove. SJG-136 crosslinks form rapidly and persist compared to those produced by conventional crosslinking agents such as nitrogen mustard, melphalan or cisplatin which bind in the DNA major groove. A panel of Chinese hamster ovary (CHO) cells with defined defects in specific DNA repair pathways were exposed to the bi-functional agents SJG-136 and melphalan, and to their mono-functional analogues mmy-SJG and mono-functional melphalan. SJG-136 was > 100 times more cytotoxic than melphalan, and the bi-functional agents were much more cytotoxic than their respective mono-functional analogues. Cellular sensitivity of both SJG-136 and melphalan was dependent on the XPF-ERCC1 heterodimer, and homologous recombination repair factors XRCC2 and XRCC3. The relative level of sensitivity of these repair mutant cell lines to SJG-136 was, however, significantly less than with major groove crosslinking agents. In contrast to melphalan, there was no clear correlation between sensitivity to SJG-136 and crosslink unhooking capacity measured using a modified comet assay. Furthermore, repair of SJG-136 crosslinks did not involve the formation of DNA double-strand breaks. SJG-136 cytotoxicity is likely to result from the poor recognition of DNA damage by repair proteins resulting in the slow repair of both mono-adducts and more importantly crosslinks in the minor groove.

Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) (K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities (K-values=from 1 to >100pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive (K-values: 2–7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin–DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence.

We tested the hypothesis that bifunctional DNA adducts formed by a nitrogen mustard-based anticancer drug were more efficient than monofunctional adducts at causing elevation of p53, consistent with the difference in cytotoxicity. Human leukemia cell line ML-1 was exposed for 1 h to melphalan or its monofunctional derivative monohydroxymelphalan. Levels of DNA adducts, measured by specific immunoassay, were linearly related to the concentration of alkylating agent. Monohydroxymelphalan formed twice as many adducts as did equal concentrations of melphalan. After the removal of the alkylating agent, adduct levels were maintained or increased slightly up to 8 h and then decreased by 27 to 44% by 24 h. Alkaline elution analyses confirmed the absence of detectable DNA interstrand cross-links in cells exposed to monohydroxymelphalan. DNA single-strand breaks were detected after monohydroxymelphalan but not after melphalan. Levels of p53 were quantified by sensitive fluorogenic enzyme-linked immunosorbent assay at intervals up to 24 h after exposure of cells to various concentrations of melphalan and monohydroxymelphalan. The level of initially formed DNA adducts needed to cause elevation of p53 from a baseline level of 0.5 ng/mg total protein to 2 ng/mg was 5- to 8-fold higher for monohydroxymelphalan than melphalan. The concentrations of melphalan and monohydroxymelphalan (+/-S.D.) causing 50% growth inhibition were 1.2 +/- 0.4 and 28.1 +/- 1.6 microg/ml, respectively, a 23-fold difference. The adduct levels induced by these exposures were 9.3 and 420 nmol/g DNA for melphalan and monohydroxymelphalan, respectively, a 45-fold difference, which is considerably greater than the difference in efficacy at elevating p53.

Purpose: A novel regimen designed to maximize antileukemia activity of carboplatin through inhibiting repair of platinum-DNA adducts was conducted in poor prognosis, acute leukemia patients. Experimental Design: Patients received fludarabine (10 to 15 mg/m2 × 5 days), carboplatin (area under the curve 10 to 12 by continuous infusion over 5 days), followed by escalated doses of topotecan infused over 72 hours (fludarabine, carboplatin, topotecan regimen). Twenty-eight patients had acute myelogenous leukemia (7 untreated secondary acute myelogenous leukemia, 11 in first relapse, and 10 in second relapse or refractory), 1 patient had refractory/relapsed acute lymphoblastic leukemia, and 2 patients had untreated chronic myelogenous leukemia blast crisis. Six patients had failed an autologous stem cell transplant. Patients ranged from 19 to 76 (median 54) years. Measurement of platinum-DNA adducts were done in serial bone marrow specimens. Results: Fifteen of 31 patients achieved bone marrow aplasia. Clinical responses included 2 complete response, 4 complete response with persistent thrombocytopenia, and 2 partial response. Prolonged myelosuppression was observed with median time to blood neutrophils ≥200/μl of 28 (0 to 43) days and time to platelets ≥20,000/μl (untransfused) of 40 (24 to 120) days. Grade 3 or greater infections occurred in all of the patients, and there were 2 infection-related deaths. The nonhematologic toxicity profile was acceptable. Five patients subsequently received allografts without early transplant-related mortality. Maximum tolerated dose of fludarabine, carboplatin, topotecan regimen was fludarabine 15 mg/m2 × 5, carboplatin area under the curve 12, and topotecan 2.55 mg/m2 over 72 hours. An increase in bone marrow, platinum-DNA adduct formation between the end of carboplatin infusion and 48 hours after the infusion correlated with bone marrow response. Conclusions: Fludarabine, carboplatin, topotecan regimen is a promising treatment based on potential pharmacodynamic interactions, which merits additional study in poor prognosis, acute leukemia patients.

We report for the first time the use of a selective small-molecule inhibitor of DNA repair to potentiate topoisomerase II (topo II) poisons, identifying DNA-dependent protein kinase (DNA-PK) as a potential target for leukemia therapy. Topo II poisons form cleavable complexes that are processed to DNA double-strand breaks (DSBs). DNA-PK mediates nonhomologous end joining (NHEJ). Inhibition of this DSB repair pathway may sensitize cells to topo II poisons. We investigated the effects of a novel DNA-PK inhibitor, NU7026 (2-(morpholin-4-yl)-benzo[h]chomen-4-one), on the response to topo II poisons using K562 leukemia cells. NU7026 (10 microM) potentiated the growth inhibition of idarubicin, daunorubicin, doxorubicin, etoposide, amsacrine (mAMSA), and mitroxantrone with potentiation factors at 50% growth inhibition ranging from approximately 19 for mAMSA to approximately 2 for idarubicin (potentiation of etoposide was confirmed by clonogenic assay). In contrast, NU7026 did not potentiate camptothecin or cytosine arabinoside (araC). NU7026 did not affect the levels of etoposide-induced topo IIalpha or beta cleavable complexes. NU7026 alone had no effect on cell cycle distribution, but etoposide-induced accumulation in G2/M was increased by NU7026. A concentration-dependent increase in etoposide-induced DSB levels was increased by NU7026. The mechanism of NU7026 potentiation of topo II poisons involves inhibition of NHEJ and a G2/M checkpoint arrest.

Tumor resistance to current drugs prevents curative treatment of human colon cancer. A pressing need for effective, tumor-specific chemotherapies exists. The non-receptor-tyrosine kinase c-Src is overexpressed in >70% of human colon cancers and represents a tractable drug target. KM12L4A human metastatic colon cancer cells were stably transfected with two distinct kinase-defective mutants of c-src. Their response to oxaliplatin, to SN38, the active metabolite of irinotecan ( drugs active in colon cancer), and to activation of the death receptor Fas was compared with vector control cells in terms of cell cycle arrest and apoptosis. Both kinase-defective forms of c-Src co-sensitized cells to apoptosis induced by oxaliplatin and Fas activation but not by SN38. Cells harboring kinase-defective forms of c-Src carrying function blocking point mutations in SH3 or SH2 domains were similarly sensitive to oxaliplatin, suggesting that reduction in kinase activity and not a Src SH2-SH3 scaffold function was responsible for the observed altered sensitivity. Oxaliplatin-induced apoptosis, potentiated by kinase-defective c-Src mutants, was dependent on activation of caspase 8 and associated with Bid cleavage. Each of the stable cell lines in which kinase-defective mutants of c-Src were expressed had reduced levels of Bcl-x(L). However, inhibition of c-Src kinase activity by PP2 in vector control cells did not alter the oxaliplatin response over 72 h nor did it reduce Bcl-x(L) levels. The data suggest that longer term suppression of Src kinase activity may be required to lower Bcl-x(L) levels and sensitize colon cancer cells to oxaliplatin-induced apoptosis.

Melphalan is a chemotherapeutic drug that exerts its cytotoxic effect mainly through the formation of DNA adducts. We report the specific immunohistochemical detection and visualisation of melphalan–DNA adducts using the monoclonal antibody MP5/73 in cultured tumour cells and solid tumour tissue from colorectal liver metastases from patients treated with melphalan. The human colon cancer cell lines HT29, SW480 and SW1116, and the rat colon cancer cell line CC531 were exposed to different concentrations of melphalan. In addition, tumour samples from 17 patients with colorectal liver metastases treated by isolated hepatic perfusion with high dose melphalan (200 mg) were collected. Cell lines and tumour samples were stained with the MP5/73 antibody against melphalan–DNA adducts and cell viability was determined by an MTT assay. Melphalan–DNA adducts could be visualised by immunohistochemistry in both cultured cells and solid tumour tissue. A correlation between melphalan exposure concentration, the subsequent melphalan–DNA adduct staining intensity, and melphalan cytotoxicity existed for each individual cell line, but the level of both parameters independently differed between cell lines. Specific staining for melphalan–DNA adducts also was feasible in the human solid tumour tissue. There was considerable variation in melphalan–DNA adduct staining, staining intensity, and distribution in the tumour stroma and the tumour epithelium among the different patients. Melphalan–DNA adducts appeared to be more intense in tumour cells at the border of the tumour nodules than in tumour cells in the centre. Thus, visualisation of melphalan–DNA adducts by immunohistochemistry allows the study of distribution of melphalan–DNA adducts in solid tumours.

Previously reported detection of melphalan-DNA adducts by immunofluorescent staining indicated considerable intercell variation in fluorescence levels. Investigations were undertaken to determine whether this variation reflected actual intercell differences in adduct levels. Melphalan-treated CCRF-CEM leukaemia cells were analysed by the trapped-in-agarose DNA immunostaining (TARDIS) method using fluorescein immunofluorescence and Hoechst dye-DNA fluorescence. Increasing the time of DNA denaturation in alkali affected the staining intensity, in agreement with known adduct properties, but failed to reduce intercell heterogeneity. To test the hypothesis that heterogeneity resulted from variation in levels of DNA strand breaks, drug-treated cells were exposed to ionising radiation. An increase in level and reduction in heterogeneity of immunofluorescence were observed, optimal at 10 Gy. When samples were irradiated after lysis, 1 Gy was optimal. At the optimal doses, irradiation before or after lysis resulted in similar levels of DNA strand breaks. Our conclusions are as follows: (a) There was no major intercell variation in the number of adducts other than from variation in DNA content. (b) Detection of melphalan, and possibly other adducts, by immunofluorescence can be markedly influenced by the level of strand breaks present in the DNA. (c) Samples analysed for melphalan adducts by immunofluorescence should be irradiated to minimise errors due to this factor.

Idarubicin (IDA) is an anthracycline used during treatment of acute myelogenous leukaemia (AML) and is clinically important because of its potency and lipophilicity (compared to the related compounds daunorubicin and doxorubicin). These drugs target DNA topoisomerase II (topo II), a nuclear enzyme that regulates DNA topology. Topo II poisoning leads to the trapping of an intermediate in the enzyme's cycle termed the "cleavable complex." This study aims to increase understanding of drug interactions by use of the 'TARDIS' (trapped in agarose DNA immunostaining) assay to measure drug-induced topo II cleavable complexes in individual cells treated with anthracyclines. Mammalian cells contain two isoforms of topo II (α and β) and the TARDIS assay enables visualisation of isoform-specific complexes. Drug-treated cells were embedded in agarose, lysed and incubated with anti-topo II antibodies to microscopically detect topo IIα or β complexes. Results for K562 cells (at clinically relevant concentrations) showed that IDA and idarubicinol, its metabolite, formed mainly topo IIα cleavable complexes, the level of which decreases at doses >1 μM for IDA. Our data suggest that this decrease is due to catalytic inhibition by IDA at these doses. Doxorubicin formed low levels of topo IIα complexes and negligible topo IIβ complexes. In cytotoxicity studies, IDA and idarubicinol were equipotent, but both were more potent than daunorubicin and doxorubicin. We showed for the first time that there was a persistent increase in levels of topo IIα cleavable complexes after removal of IDA, suggesting that its greater effectiveness may be associated with both the longevity and high levels of these complexes.

The growth inhibitory effects of cisplatin and etoposide on neuroblastoma cell lines were investigated in several scheduled combinations. Results were analyzed using median effect and combination index analyses. In all schedules in which cisplatin was administered prior to etoposide a synergistic effect was observed. Conversely, an antagonistic effect was seen in all schedules where etoposide was administered before cisplatin.