Naked mole-rats (NMRs) are unique long-lived mammals that possess marked resistance to cancer including lack of any reported spontaneous skin cancer incidences. Here, we show that in comparison with mice, homeostatic epidermal keratinocytes in NMRs exhibit elevated expression of 324 tumor suppressor genes of different classes including 55 genes regulating DNA damage/repair. Furthermore, NMR skin grafted onto nude mice exhibits complete resistance to 7,12-dimethylbenz[a]-anthracene/12-O-tetradecanoylphorbol-13-acetate (DMBA/TPA)-induced skin carcinogenesis in tissue-autonomous manner. In contrast to mice, DNA-damaged cells are effectively eliminated from DMBA/TPA-treated NMR epidermis, which exhibits a unique transcription response to DMBA/TPA characterized by high expression of anti-cancer genes, activation of ferroptosis, as well as by downregulation of 80 oncogenes including components of NF-kB, Wnt, and tyrosine kinase receptor signaling pathways. Thus, intrinsic multi-level anti-cancer protective program in NMR epithelial cells serves as unique model for further analyses of natural anti-cancer defense mechanisms and their translation to humans.

ObjectiveElectrical epilation of unwanted hair is a widely used hair removal method, but it is largely unknown how this affects the biology of human hair follicles (HF) and perifollicular skin. Here, we have begun to explore how mechanical epilation changes selected key biological read-out parameters ex vivo within and around the pilosebaceous unit.MethodsHuman full-thickness scalp skin samples were epilated ex vivo using an electro-mechanical device, organ-cultured for up to 6 days in serum-free, supplemented medium, and assessed at different time points by quantitative (immuno-)histomorphometry for selected relevant read-out parameters in epilated and sham-epilated control samples.ResultsEpilation removed most of the hair shafts, often together with fragments of the outer and inner root sheath and hair matrix. This was associated with persistent focal thinning of the HF basal membrane, decreased melanin content of the residual HF epithelium, and increased HF keratinocyte apoptosis, including in the bulge, yet without affecting the number of cytokeratin 15+ HF epithelial stem cells. Sebocyte apoptosis in the peripheral zone was increased, albeit without visibly altering sebum production. Epilation transiently perturbed HF immune privilege, and increased the expression of ICAM-1 in the bulge and bulb mesenchyme, and the number of perifollicular MHC class II+ cells as well as mast cells around the distal epithelium and promoted mast cell degranulation around the suprabulbar and bulbar area. Moreover, compared to controls, several key players of neurogenic skin inflammation, itch, and/or thermosensation (TRPV1, TRPA1, NGF, and NKR1) were differentially expressed in post-epilation skin.ConclusionThese data generated in denervated, organ-cultured human scalp skin demonstrate that epilation-induced mechanical HF trauma elicits surprisingly complex biological responses. These may contribute to the delayed re-growth of thinner and lighter hair shafts post-epilation and temporary post-epilation discomfort. Our findings also provide pointers regarding the development of topically applicable agents that minimize undesirable sequelae of epilation. ObjectifL'epilation electrique des poils indesirables est une methode d'epilation largement utilisee, mais on ne connait pas l'ampleur de son effet sur la biologie des follicules pileux humains (FP) et de la peau perifolliculaire. Dans cette etude, nous avons commence a explorer comment l'epilation mecanique modifie certains parametres de mesures biologiques cles ex vivo a l'interieur et autour de l'unite pilo-sebacee.Des echantillons de peau du cuir chevelu humain de pleine epaisseur ont ete epiles ex vivo a l'aide d'un dispositif electromecanique, cultives biologiquement pendant un maximum de 6 jours dans un milieu complet sans serum, et evalues a differents moments par (immuno-)histomorphometrie quantitative pour certains parametres de mesures pertinents dans des echantillons avec epilation et des echantillons temoins avec epilation simulee.ResultatsL'epilation a enleve la plupart des poils, souvent avec des fragments de la gaine de la racine externe et de la matrice pileuse. Cela a ete associe a un amincissement focal persistant de la membrane basale du FP, a une diminution de la teneur en melanine de l'epithelium residuel du FP et a une augmentation de l'apoptose des keratinocytes du FP, y compris dans la surface arrondie, mais sans affecter le nombre de cellules souches epitheliales du FP positives pour la cytokeratine 15. L'apoptose des sebocytes de la zone peripherique etait augmentee, sans pour autant alterer visiblement la production de sebum. L'epilation a temporairement perturbe l'immunoprivilege du FP et a augmente l'expression de l'ICAM-1 dans la surface arrondie et le mesenchyme du bulbe, ainsi que le nombre de cellules perifolliculaires du CMH de classe II et des mastocytes autour de l'epithelium distal, et a favorise la degranulation des mastocytes autour de la zone supra-bulbaire et bulbaire. En outre, par rapport aux echantillons temoins, plusieurs acteurs cles de l'inflammation neurogene cutanee, de la demangeaison et/ou de la thermosensation (TRPV1, TRPA1, NGF et NKR1) ont ete exprimes de maniere differentielle dans la peau apres l'epilation.Ces donnees generees dans la peau du cuir chevelu humain denervee et cultivee biologiquement demontrent que le traumatisme du FP induit par l'epilation mecanique provoque des reponses biologiques etonnamment complexes. Celles-ci peuvent contribuer a retarder la repousse des poils plus fins et plus clairs apres l'epilation, et a provoquer une gene temporaire apres l'epilation. Nos resultats fournissent egalement des pistes concernant le developpement d'agents applicables par voie topique qui minimisent les sequelles indesirables de l'epilation. Human hair follicles experience epilation-induced mechanical trauma that elicits complex biological responses, which might contribute both to the delayed re-growth of thinner and lighter hair shafts post-epilation and to temporary post-epilation discomfort.image

Skin wound healing is driven by proliferation, migration and differentiation of several cell types that are controlled by the alterations in the gene expression programmes. Brahma Gene 1 (BRG1) (also known as SMARCA4) is a core ATPase in the BRG1 Associated Factors (BAF) ATP-dependent chromatin remodelling complexes that alter DNA-histone interaction in chromatin at the specific gene regulatory elements resulting in increase or decrease of the target gene transcription. Using siRNA mediated suppression of BRG1 during wound healing in a human ex vivo and in vitro (scratch assay) models, we demonstrated that BRG1 is essential for efficient skin wound healing by promoting epidermal keratinocytes migration, but not their proliferation or survival. BRG1 controls changes in the expression of genes associated with gene transcription, response to wounding, cell migration and cell signalling. Altogether, our data revealed that BRG1 play positive role in skin repair by promoting keratinocyte migration and impacting the genes expression programmes associated with cell migration and cellular signalling.

The data supporting this study's findings are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions. All human material used in this study was obtained with the informed consent of the patients and the approval from the Charité Universitätsmedizin Berlin ethics committee (EA1/078/18, EA4/193/18, EA1/141/12). No donor-related data was collected.

Naked mole-rats (NMRs, Heterocephalus glaber) are unique long-lived mammals that possess marked resistance to cancer and other age-related pathologies maintaining a sustained healthy life-span for over 30 years. Despite remarkable longevity, there is a lack of any reported spontaneous skin cancer incidents in NMRs, including basal/squamous cell carcinoma and melanoma. To explore the suitability of the NMR skin for studying the mechanisms of epithelial carcinogenesis and cancer resistance, we applied chemical skin carcinogenesis (DMBA/TPA) protocol to NMRs and FVB mice used as controls. In contrast to mice, NMRs showed remarkable resistance to DMBA/TPA and did not develop papillomas for up to 25 weeks after treatment. Furthermore, skin grafts of the NMRs transplanted onto nude mice did not develop epithelial tumors after DMBA/TPA treatment, suggesting that NMR skin possess the unique tumor resistance properties in a tissue-autonomous manner. In contrast to mice, epidermis of the NMRs showed markedly elevated levels of the DNA repair machinery-associated genes including XPA and faster elimination of the gamma-H2AX-positive cells. In addition, RNAseq analyses demonstrated that expression levels of a number of tumor suppressor genes (BTG1, HSPB7, DACH1) show significant upregulation in the NMR epidermis after DMBA/TPA treatment, compared to mice. These data provide novel insights into fundamental mechanisms underlying cancer resistance in the skin, and enhance the innovative potential of securely establishing a place for the NMR as a model organism for studying the biology of human skin and disease resistance.

Naked mole-rats (NMRs) (Heterocephalus glaber) are long-lived mammals that possess a natural resistance to cancer and other age-related pathologies, maintaining a healthy life span >30 years. In this study, using immunohistochemical and RNA-sequencing analyses, we compare skin morphology, cellular composition, and global transcriptome signatures between young and aged (aged 3‒4 vs. 19‒23 years, respectively) NMRs. We show that similar to aging in human skin, aging in NMRs is accompanied by a decrease in epidermal thickness; keratinocyte proliferation; and a decline in the number of Merkel cells, T cells, antigen-presenting cells, and melanocytes. Similar to that in human skin aging, expression levels of dermal collagens are decreased, whereas matrix metalloproteinase 9 and matrix metalloproteinase 11 levels increased in aged versus in young NMR skin. RNA-sequencing analyses reveal that in contrast to human or mouse skin aging, the transcript levels of several longevity-associated (Igfbp3, Igf2bp3, Ing2) and tumor-suppressor (Btg2, Cdkn1a, Cdkn2c, Dnmt3a, Hic1, Socs3, Sfrp1, Sfrp5, Thbs1, Tsc1, Zfp36) genes are increased in aged NMR skin. Overall, these data suggest that specific features in the NMR skin aging transcriptome might contribute to the resistance of NMRs to spontaneous skin carcinogenesis and provide a platform for further investigations of NMRs as a model organism for studying the biology and disease resistance of human skin.

The efficacy of blue light therapy in dermatology relies on numerous clinical studies. The safety remains a topic of controversy, where potentially deleterious effects were derived from in vitro rather than in vivo experiments. The objectives of this work were (1) to highlight the nuances behind "colors" of blue light, light propagation in tissue and the plurality of modes of action; and (2) to rigorously analyze studies on humans reporting both clinical and histological data from skin biopsies with focus on DNA damage, proliferation, apoptosis, oxidative stress, impact on collagen, elastin, immune cells, and pigmentation. We conclude that blue light therapy is safe for human skin. It induces intriguing skin pigmentation, in part mediated by photoreceptor Opsin-3, which might have a photoprotective effect against ultraviolet irradiation. Future research needs to unravel photochemical reactions and the most effective and safe parameters of blue light in dermatology.

Chromatin architectural protein CTCF controls three-dimensional organization of the genome and long-range enhancer/promoter interactions in differentiating cells. In mouse embryonic skin, CTCF protein is expressed in the developing epidermis, dermis and hair follicles. ChiPseq analyses revealed presence of CTCF binding sites at the borders of Topologically-Associating Domains (TADs) harboring Keratin Type I and II gene loci on mouse chromosomes 11 and 15, respectively, as well as within the corresponding TADs. To study the role of CTCF in the control of skin and hair follicle development, K14-Cre/Ctcf fl/fl mice were generated. K14-Cre-mediated Ctcf ablation resulted in marked decrease of CTCF protein in the developing epidermis and hair follicle epithelium, while CTCF expressions in the dermis and hair follicle mesenchyme were not changed compared to the controls. CTCF ablation in keratinocytes resulted in alterations of epidermal and hair follicle development: epidermal thickness and keratinocyte proliferation were decreased, a number of hair follicles was significantly reduced and their development was retarded compared to controls. RNAseq analyses of the primary keratinocytes isolated from newborn K14-Cre/Ctcf fl/fl and wild-type mice revealed alterations in the expression of a number of epidermal keratin genes (Krt6a, Krt6b, Krt10, Krt16, Krt17), hair follicle-specific keratin genes (Krt25, Krt33a, Krt33b, Krt73, Krt75), as well as marked upregulation of embryonic epithelial keratin genes Krt8 and Krt18 upon CTCF ablation. Thus, these data demonstrate that CTCF plays essential roles in the control of terminal keratinocyte differentiation and regulate lineage-specific gene expression in Keratin type I and II loci in the epidermal and hair follicle keratinocytes.

More than 300 genetic risk loci have been identified for male pattern baldness (MPB) but little is known about the exact molecular mechanisms through which the associated variants exert their effects on MPB pathophysiology. Here, we aimed at further elucidating the regulatory architecture of the MPB risk locus on chromosome (chr.) 2q35, where we have previously reported a regulatory effect of the MPB lead variant on the expression of WNT10A. A HaploReg database research for regulatory annotations revealed that the association signal at 2q35 maps to a binding site for the transcription factor EBF1, whose gene is located at a second MPB risk locus on chr. 5q33.3. To investigate a potential interaction between EBF1 and WNT10A during MPB development, we performed in vitro luciferase reporter assays as well as expression analyses and immunofluorescence co-stainings in microdissected human hair follicles. Our experiments confirm that EBF1 activates the WNT10A promoter and that the WNT10A/EBF1 interaction is impacted by the allelic expression of the MPB risk allele at 2q35. Expression analyses across different hair cycle phases and immunhistochemical (co)stainings against WNT10A and EBF1 suggest a predominant relevance of EBF1/WNT10A interaction for hair shaft formation during anagen. Based on these findings we suggest a functional mechanism at the 2q35 risk locus for MPB, where an MPB-risk allele associated reduction in WNT10A promoter activation via EBF1 results in a decrease in WNT10A expression that eventually results in anagen shortening, that is frequently observed in MPB affected hair follicles. To our knowledge, this study is the first follow-up study on MPB that proves functional interaction between two MPB risk loci and sheds light on the underlying pathophysiological mechanism at these loci.

Photoactivation of cryptochrome-family proteins by blue light is a well-established reaction regulating physiology of plants, fungi, bacteria, insects and birds, while impact of blue light on cryptochrome synthesis and/or activity in human non-visual cells remains unknown. Here, we show that 453 nm blue light induces cryptochrome 1 (CRY1) accumulation in human keratinocytes and the hair follicle. CRY1 is prominently expressed in the human anagen hair follicle, including epithelial stem cells. Specific silencing of CRY1 promotes catagen, while stimulation of CRY1 by KL001 prolongs anagen ex vivo by altering the expression of genes involved in apoptosis and proliferation. Together, our study identifies a role for CRY1 in sustaining human hair growth. Previously, we demonstrated positive effects of 453 nm blue light on hair growth ex vivo. Taken all together, our study suggests that CRY1 might mediate blue light-dependent positive effects on hair growth.

The migration of epidermal keratinocytes is the basis for skin reepithelialization during wound healing. The in vitro scratch-wound assay using monolayers of primary human epidermal keratinocytes is a straightforward and effective method to assess their migratory capacity. The mechanical scratch of a confluent monolayer directly disrupts the adhesion of the keratinocytes to one another and to the underlying matrix, resembling the physical trauma of a wound in an in vitro assay. The keratinocytes will undergo an epithelialto-mesenchymal transition, which will confer an ability to migrate toward each other to cover the gap by restructuring cell–cell and cell–extracellular matrix connections. However, a good scratch-wound method and protocol to ensure scratch reproducibility is essential, particularly when using primary cell cultures where donor variability may also impact on results.

Background: Allergic skin reactions are driven by dermal mast cells (MCs) and exhibit circadian differences. In human skin, circadian rhythms may be regulated by cryptochromes (CRYs) and opsins (OPNs), photoreceptors (PRs), which were recently identified to be expressed in a number of human cutaneous cell types. Whether human skin MCs express these receptors is currently unknown Method: We obtained MCs from human skin (breast, foreskin, eyelids) and used also cultured CD34‐positive peripheral blood stem cell‐derived MCs (PSCMCs) and LAD2‐MCs. MCs were analyzed for the expression of CRY1 and OPN 1‐3 by qRT‐PCR and Western Blot as well as for the effects of irradiation with blue light on activation via IgE/anti‐IgE or cortistatin, a MRGPRX2 agonist. Results: We found expression of the blue light sensitive CRY1, OPN1 MW (medium‐wave‐length), OPN2 and OPN3 in LAD2‐MCs, cultured MCs from breast skin and foreskin as well as freshly isolated MCs from breast skin and eyelids, with the exception of OPN2 in eyelid MCs. CRY1 expression was the highest overall, and its presence was confirmed at protein level in cultured as well as freshly isolated MCs from breast skin and foreskin. PSCMCs, however, did not show expression of any of the investigated PRs. Importantly, fresh and cultured skin MCs were sensitive to blue light irradiation (at 453 nm) showing a dose‐dependent reduction in their degranulation after exposure to 2 or 30 J/cm2 blue light as measured by β‐hexosaminidase release. Conclusion: Our results demonstrate, for the first time, that human skin MCs express photoreceptors, i.e. CRY1 and OPN1‐3, and blue light, which activates these receptors, inhibits MC degranulation. These findings may explain, at least in part, circadian differences in allergic skin reactions and may be relevant for the development of photoreceptor‐targeted treatments for patients with MC‐driven skin diseases such as chronic spontaneous or inducible urticaria.

Objectives This review has the following objectives: Firstly, it provides an explanation of the evolution of laser/intense pulsed light (IPL) hair reduction modalities from high fluence professional devices to low fluence home-use appliances. Secondly, it summarises published literature reviews on home-use devices (HUDs) as evidence of their growing credibility. Thirdly, it proposes mechanistic differences in light delivery regimes and the resulting divergences in mode of action. Materials and Methods An extensive literature search was performed to review the progress of laser/IPL-induced hair reduction and determine what evidence is available to explain the mode of action of professional and HUDs for hair removal. Establishing the likely biological mode of action of professional high-fluence systems versus home-use low-fluence appliances was performed by combining data obtained using ex vivo hair follicle (HF) organ culture and the clinical results involving human participants. Results Significant basic science and clinical evidence has been published to confirm the clinical efficacy and technical safety of many laser and IPL home-use devices for hair removal. Clearly, HUDs are different compared to professional systems both in terms of fluence per pulse and in terms of biological mechanisms underlying hair removal. Here we presented data showing that a single low fluence pulse of both 810 nm laser (6.6 J/cm(2), 16 ms) and IPL (9 J/cm(2), 15 ms and 6.8 J/cm(2), 1.9 ms) leads to induction of catagen transition. Catagen transition was characterized by morphological changes similar to what occurs in vivo with occasional detection of apoptosis in the dermal papilla and outer root sheath cells. This suggests that high hair reduction can be expected in vivo and longer-term treatment might result in HF miniaturization due to a cumulative effect on the dermal papilla and outer root sheath cells. In line with this hypothesis, in this review we demonstrate that long-term application of a commercially-available home-use IPL appliance resulted in persistent hair reduction (80%) one year after last treatment. These data are in line with what was previously reported in the literature, where clinical studies with home-use IPL appliances demonstrated high efficacy of hair reduction on female legs, armpits and bikini zones, with full hair regrowth after four treatments following cessation of IPL administration. Limitations of HUDs include lack of hair clearance for very dark skin types and low speed of treatment compared with professional devices. Numerous uncontrolled and controlled clinical efficacy studies and technical safety investigations on consumer-use appliances support many of the leading manufacturers' claims. Analysis & Conclusions Manufacturers make consumer appliances safe and easy to use by considering "human factors," needs and capabilities of a variety of users. Safety is of primary concern to manufacturers, regulators and standards bodies as these appliances may be accessible to children or their use attempted on unsuitable skin types without full awareness of potential side effects. Consumer cosmetic appliances are provided with warnings and obvious safety notices describing the nature of any ocular or dermal hazard and precautions for reducing risk of accidental injury, infection, etc. HUDs employing optical energy are provided with design and engineering controls such as safety switches, alarms and sensors to prevent their incorrect operation or eye exposure. In-vivo studies demonstrated that low fluence home-use hair removal devices can result in high hair reduction efficacy after a short treatment regime, while prolonged and less frequent (once in six weeks) maintenance treatment over a year can lead to high and sustained hair reduction even one year after cessation of treatment. Home-use hair removal devices can be a useful adjunct to professional in-office treatments with high professional awareness. There are sufficient positive arguments for practitioners to make the case to patients for HUDs as "companion" products to professional treatments. In addition, devices for hair removal can be used effectively as stand-alone products by the consumer if they are willing to adopt a regime of regular or frequent use. Further clinical studies involving dynamic observation of HF cycle stage and type (terminal vs. vellus) over the total duration of treatment, for example, using biopsies or non-invasive imaging are necessary to confirm the proposed mode of action of low fluence pulses in a combination with treatment and maintenance regimes. Lasers Surg. Med. 51:481-490, 2019. (c) 2019 Wiley Periodicals, Inc.

For many decades, applied hair research has been hampered by an unproductive intellectual and conceptual divide between researchers who are primarily interested in the hair shaft (HS), its structural properties, visual appearance and cosmetic manipulation, and those investigators who are mainly interested in the fascinating miniorgan that cyclically regenerates the HS, the hair follicle (HF). This article attempts to bridge this unproductive divide between the "dead hair" and "live follicle" worlds by summarizing both current key concepts and major open questions on how the HF, namely, the anagen hair bulb and its precortical hair matrix keratinocytes, generate the HS, focusing on selected key signaling pathways. We discuss current theories of hair shape formation and avenues toward impacting on human HS structure. The article closes by delineating which instructive preclinical research assays are needed to ultimately close the experimental gap between HS and HF researchers in a manner that benefits consumers.

Objective When faced with clinical symptoms of scarring alopecia-the standard diagnostic pathway involves a scalp biopsy which is an invasive and expensive procedure. This project aimed to assess if plucked hair follicles (HFs) containing living epithelial cells can offer a non-invasive approach to diagnosing inflammatory scalp lesions. Methods Lesional and non-lesional HFs were extracted from the scalp of patients with chronic discoid lupus erythematosus (CDLE), psoriasis and healthy controls. RNA was isolated from plucked anagen HFs and microarray, as well as quantitative real-time PCR was performed. Results Here, we report that gene expression analysis of only a small number of HF plucked from lesional areas of the scalp is sufficient to differentiate CDLE from psoriasis lesions or healthy HF. The expression profile from CDLE HFs coincides with published profiles of CDLE from skin biopsy. Genes that were highly expressed in lesional CDLE corresponded to well-known histopathological diagnostic features of CDLE and included those related to apoptotic cell death, the interferon signature, complement components and CD8(+) T-cell immune responses. Conclusions We therefore propose that information obtained from this non-invasive approach are sufficient to diagnose scalp lupus erythematosus. Once validated in routine clinical settings and compared with other scarring alopecias, this rapid and non-invasive approach will have great potential for paving the way for future diagnosis of inflammatory scalp lesions.

Aging is a complex process characterized by progressive decline in physiological and biochemical performance of individual tissues and organs. In aged skin, reduced cell proliferation and functional decline of epithelial and mesenchymal cells underlie age-related changes, such as dry skin (xerosis), loss of elasticity, and functional senescence, leading to increased susceptibility to aging-associated conditions such as skin cancer and poor wound healing (Engelke et al., 1997Engelke M. Jensen J.M. Ekanayake-Mudiyanselage S. Proksch E. Effects of xerosis and ageing on epidermal proliferation and differentiation.Br J Dermatol. 1997; 137: 219-225Crossref PubMed Scopus (123) Google Scholar, Zhang et al., 2009Zhang M. Poplawski M. Yen K. Cheng H. Bloss E. Zhu X. et al.Role of CBP and SATB-1 in aging, dietary restriction, and insulin-like signaling.PLOS Biol. 2009; 7: e1000245Crossref PubMed Scopus (79) Google Scholar). MicroRNAs (miRNAs) are small noncoding RNAs involved in the post-transcriptional regulation of coding-gene expression. They provide an additional level of control for important cellular processes such as growth, differentiation, and remodeling of skin (Botchkareva, 2017Botchkareva N.V. The molecular revolution in cutaneous biology: noncoding RNAs: new molecular players in dermatology and cutaneous biology.J Invest Dermatol. 2017; 137: e105-e111Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). In addition, miRNAs can regulate the expression of important epigenetic regulators, including DNA methyltransferases, histone deacetylases, and polycomb group genes. Disruption of the miRNA-epigenetic regulatory network was shown to interfere with normal physiological cellular functions, leading to activation of disease processes (reviewed in [Sato et al., 2011Sato F. Tsuchiya S. Meltzer S.J. Shimizu K. MicroRNAs and epigenetics.FEBS Journal. 2011; 278: 1598-1609Crossref PubMed Scopus (480) Google Scholar]). By fine-tuning biological systems, miRNAs can contribute to healthy aging or development of age-related diseases, and may serve as useful diagnostic or prognostic biomarkers for age-related diseases (Olivieri et al., 2012Olivieri F. Spazzafumo L. Santini G. Lazzarini R. Albertini M.C. Rippo M.R. et al.Age-related differences in the expression of circulating microRNAs: miR-21 as a new circulating marker of inflammaging.Mech Ageing Dev. 2012; 133: 675-685Crossref PubMed Scopus (183) Google Scholar). MicroRNA-21 (miR-21) plays an important role in the development of a number of pathological skin conditions including psoriasis, tumorigenesis, and poor wound-healing (Ahmed et al., 2011Ahmed M.I. Mardaryev A.N. Lewis C.J. Sharov A.A. Botchkareva N.V. MicroRNA-21 is an important downstream component of BMP signalling in epidermal keratinocytes.J Cell Sci. 2011; 124: 3399-3404Crossref PubMed Scopus (59) Google Scholar, Meisgen et al., 2012Meisgen F. Xu N. Wei T. Janson P.C. Obad S. Broom O. et al.MiR-21 is up-regulated in psoriasis and suppresses T cell apoptosis.Exp Dermatol. 2012; 21: 312-314Crossref PubMed Scopus (127) Google Scholar, Yang et al., 2011Yang X. Wang J. Guo S.L. Fan K.J. Li J. Wang Y.L. et al.miR-21 promotes keratinocyte migration and re-epithelialization during wound healing.Int J Biol Sci. 2011; 7: 685-690Crossref PubMed Scopus (131) Google Scholar). However, the role of miR-21 in skin aging has not been investigated yet. Here, we identify miR-21 as a contributor to skin aging, at least in part, by negative regulation of the chromatin remodeler SATB1 in keratinocytes. The expression of miR-21 was examined in skin of young and aged mice (8-week-old vs 2-year-old) and human female donors (48, 60–62, and 78 years old; Supplementary Materials and Methods). Quantitative reverse transcriptase–PCR (RT-qPCR) analysis revealed a prominent increase in miR-21 expression in both mouse and human aged skin (Figure 1a and b). In contrast to miR-21, the level of miRNA-199a, which is not detectable in the epidermis of either mouse or human skin, was used as a control for this study (Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C.J. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (628) Google Scholar, Yi et al., 2006Yi R. O'Carroll D. Pasolli H.A. Zhang Z. Dietrich F.S. Tarakhovsky A. et al.Morphogenesis in skin is governed by discrete sets of differentially expressed microRNAs.Nat Genet. 2006; 38: 356-362Crossref PubMed Scopus (452) Google Scholar) and was not altered during the aging process in human skin (Figure 1b). Using in situ hybridization, we confirmed increased miR-21 expression in the epidermis and dermis of aged mouse and human skin (Figure 1c and d). Our data are consistent with published reports showing the elevation of miR-21 in age-associated cardiovascular diseases in human patients (Olivieri et al., 2012Olivieri F. Spazzafumo L. Santini G. Lazzarini R. Albertini M.C. Rippo M.R. et al.Age-related differences in the expression of circulating microRNAs: miR-21 as a new circulating marker of inflammaging.Mech Ageing Dev. 2012; 133: 675-685Crossref PubMed Scopus (183) Google Scholar) and in kidneys of aged mice (Sataranatarajan et al., 2012Sataranatarajan K. Feliers D. Mariappan M.M. Lee H.J. Lee M.J. Day R.T. et al.Molecular events in matrix protein metabolism in the aging kidney.Aging Cell. 2012; 11: 1065-1073Crossref PubMed Scopus (34) Google Scholar).Figure 1MiR-21 is elevated in aging skin and targets SATB1 in keratinocytes. (a, b) RT-qPCR analysis of miR-21 expression in young vs aged mice (8-week-old vs. 2-year-old) and human female donor skins (F48, F60–62, F78); miR-21 expression is upregulated in aged mouse and human epidermis. Data are presented as mean ± SEM values from three (mouse) or two (human) independent samples and three independent experiments each. (c, d) Representative photomicrographs of in situ hybridization for miR-21; miR-21 expression is elevated in the epidermis (arrowheads) and dermis of aged mouse and human skins. Data are presented from three (mouse) and two (human) independent samples. (e) RT-qPCR analysis of differentiation-related genes in young versus aged mice; a decrease in expression is observed for all genes analyzed. Data are presented as mean ± SEM values from three independent samples and experiments. (f) RT-qPCR analysis in young versus aged human skin; a decrease in expression is observed for all differentiation-associated genes analyzed. Data are presented as mean ± SEM values from two independent samples and three independent experiments. (g, h) Transfection with pro-miR-21 mimic in primary mouse and human keratinocytes causes a significant decrease in the expression of Krt1 and Ivl (mouse) and KRT1, KRT10, KRT14, and IVL (human). Data is presented as mean ± SEM values from three independent experiments. (i) Venn diagram of predicted miR-21 gene targets. A table showing the top ten miR-21 target genes listed as the most conserved between human and mouse genomes, including SATB1. (j) Significant reduction in luciferase activity in HaCaT cells cotransfected with pro-miR-21 mimic and the SATB1-3′ UTR (wt-3′UTR) construct encompassing the putative miR-21 target site. No changes in luciferase activity were detected when the miRNA binding site was mutated (mut-3′UTR). Bold letters represent miR-21 seed region. Underlined letters represent predicted binding sites within SATB1-3'UTR. Each sample was normalized to Renilla luciferase activity. Data is presented as mean ± SEM values from three independent experiments. (k–n) RT-qPCR and western blot analysis; SATB1 mRNA and protein levels are significantly decreased and increased after transfection with pro-miR-21 or anti-miR-21, respectively, in both primary mouse and human keratinocytes. Data are presented as mean ± SEM values from three independent experiments. Western blot data shown are from a single representative experiment out of three repeats. *P < 0.05, **P < 0.01, ***P < 0.001; Student's t-test. The broken lines demarcate the epidermal–dermal border. miR-199a, microRNA-199a; miR-21, microRNA-21; mut, mutated; RT-qPCR, quantitative reverse transcriptase–PCR; SEM, standard error of the mean; UTR, untranslated region; wt, wild type. Bar = 50μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Human skin aging is associated with a decrease in the expression of keratinocyte differentiation-associated markers (Engelke et al., 1997Engelke M. Jensen J.M. Ekanayake-Mudiyanselage S. Proksch E. Effects of xerosis and ageing on epidermal proliferation and differentiation.Br J Dermatol. 1997; 137: 219-225Crossref PubMed Scopus (123) Google Scholar). Indeed, a significant reduction in the expression of keratinocyte differentiation-related genes was observed in aged mouse (P < 0.05) and human skin (Figure 1e and f). Forced expression of miR-21 in both primary mouse and human keratinocytes transfected with pro-miR-21 mimic resulted in significant reduction in Krt1 and Ivl (P < 0.05, mouse) and KRT1 (P < 0.01), KRT10, KRT14, and IVL expressions (P < 0.05, human) (Figure 1g and h). This suggests that miR-21 potentially can contribute to skin aging by downregulating keratinocyte differentiation-related genes, possibly leading to cellular senescence (Dellago et al., 2013Dellago H. Preschitz-Kammerhofer B. Terlecki-Zaniewicz L. Schreiner C. Fortschegger K. Chang M.W.F. et al.High levels of oncomiR-21 contribute to the senescence-induced growth arrest in normal human cells and its knock-down increases the replicative lifespan.Aging Cell. 2013; 12: 446-458Crossref PubMed Scopus (88) Google Scholar) and contributing to increased susceptibility to age-related pathological conditions. To identify potential putative miR-21 targets, we performed bioinformatics analysis as done previously (Ahmed et al., 2014Ahmed M.I. Alam M. Emelianov V.U. Poterlowicz K. Patel A. Sharov A.A. et al.MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway.J Cell Biol. 2014; 207: 549-567Crossref PubMed Scopus (49) Google Scholar). By interrogating predicted miR-21 targets from three different databases, we identified 35 potential genes whose expression may be regulated by miR-21. Ten of these genes, including Satb1, have highly conserved miR-21 target sequences between human and mouse genomes (Figure 1i). SATB1 is a nuclear protein operating as a genome organizer, which originally was identified as an essential mediator of normal T-cell development regulating the large-scale chromatin remodeling and enhancer–promoter interactions in several lineage-specific gene loci (Cai et al., 2003Cai S. Han H.J. Kohwi-Shigematsu T. Tissue-specific nuclear architecture and gene expression regulated by SATB1.Nat Genet. 2003; 34: 42-51Crossref PubMed Scopus (345) Google Scholar). In the skin, SATB1 is essential for higher-order chromatin folding and transcriptional regulation of the epidermal differentiation complex locus in keratinocytes (Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar). Interestingly, genetic ablation of Satb1 in mouse skin causes thinning of the epidermis accompanied by downregulation in the expression of terminal differentiation-associated genes (Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar). We confirmed the direct regulation of Satb1 by miR-21 using a luciferase reporter assay. Cotransfection of HaCaT cells with pro-miR-21 mimic and the Satb1 3′ untranslated region reporter construct caused a significant reduction in luciferase activity (P < 0.001) compared with their corresponding controls, whereas this effect was not detected when miR-21 binding sites in the Satb1 3′ untranslated region were mutated (Figure 1j). This is consistent with published data showing miR-21 targeting of SATB1 in rectal cancer cells (Lopes-Ramos et al., 2014Lopes-Ramos C.M. Habr-Gama A. Quevedo Bde S. Felício N.M. Bettoni F. Koyama F.C. et al.Overexpression of miR-21-5p as a predictive marker for complete tumor regression to neoadjuvant chemoradiotherapy in rectal cancer patients.BMC Med Genomics. 2014; 7: 68Crossref PubMed Scopus (65) Google Scholar). The functional interactions of miR-21 and SATB1 in keratinocytes were evaluated by transfecting primary human and mouse epidermal keratinocytes with pro-miR-21 mimic and anti-miR-21, which resulted in the decreased and increased expression of SATB1 mRNA and protein, respectively, as determined by RT-qPCR and western blot (Figure 1k–n, Supplementary Materials and Methods). Additionally, reduced Satb1 expression was confirmed by RT-qPCR and immunofluorescent analysis in both mouse and human aged epidermis (Figure 2a–d). To further explore the plausible functional link between miR-21 and SATB1 in skin aging, we overexpressed SATB1 and miR-21 in keratinocytes using SATB1-expressing lentiviral particles or pro-miR-21 mimic. We confirmed the increased expression of Satb1 (SATB1 Leti + miR-Control) or miR-21 (Control Leti + pro-miR-21) in primary mouse epidermal keratinocytes as determined by RT-qPCR (Figure 2e and f, Supplementary Materials and Methods). However, coexpression of both SATB1 and miR-21 (SATB1 Leti + pro-miR-21) significantly reduced SATB1 expression (Figure 2e). RT-qPCR analysis also revealed that Satb1 induces expression of differentiation-associated genes, supporting its role as a promoter of terminal keratinocyte differentiation (Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar). Forced expression of miR-21 abolished SATB1-induced upregulation of Krt1, Krt10, and Krt17 (Figure 2g). Therefore, our data suggest that miR-21 contributes to the age-associated alterations in gene expression, at least in part, by targeting Satb1. The downregulation of SATB1 in human keratinocytes by miRNA-191 has been shown to establish epigenetic modifications leading to senescence (Lena et al., 2012Lena A.M. Mancini M. Rivetti di Val Cervo P. Saintigny G. Mahé C. Melino G. et al.MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation.Biochem Biophys Res Commun. 2012; 423: 509-514Crossref PubMed Scopus (49) Google Scholar). SATB1 has also been associated with increased lifespan, whereas a reduction in its expression was seen with age and in age-related pathologies, such as diabetes in mice, demonstrating the general involvement of SATB1 in counteracting the senescence and/or aging pathways (Zhang et al., 2009Zhang M. Poplawski M. Yen K. Cheng H. Bloss E. Zhu X. et al.Role of CBP and SATB-1 in aging, dietary restriction, and insulin-like signaling.PLOS Biol. 2009; 7: e1000245Crossref PubMed Scopus (79) Google Scholar). An increasing number of studies have identified miR-21 as a senescence, inflammation, and cancer-associated miRNA (Olivieri et al., 2013Olivieri F. Rippo M.R. Procopio A.D. Fazioli F. Circulating inflamma-miRs in aging and age-related diseases.Front Genet. 2013; 4: 121Crossref PubMed Scopus (145) Google Scholar). Therefore, our data suggest that the negative regulation of SATB1 by miR-21 in keratinocytes may be an important age-phase–specific regulation leading to senescence and promoting disease states in skin. Taken together, we demonstrate that (i) miR-21 expression is increased in human and mouse aging skin; (ii) SATB1 expression is inversely correlated with miR-21 in young and aged skin; and (iii) Satb1 serves as a genuine direct target of miR-21 in keratinocytes. Thus, by regulating SATB1 in epidermal keratinocytes, miR-21 may contribute to the higher-order chromatin remodeling and establishment of enhancer–promoter networks involved in epidermal differentiation, as well as increase susceptibility to age-related pathological conditions, such as tumorigenesis. These data provide a platform for the establishment of novel approaches for pharmacological manipulation of skin aging via modulation of the miR-21 activity in keratinocytes. Mohammed I. Ahmed: http://orcid.org/0000-0002-9051-7681 Maximilian E. Pickup: http://orcid.org/0000-0002-6006-2540 Alexander G. Rimmer: http://orcid.org/0000-0002-3038-9948 Majid Alam: http://orcid.org/0000-0002-5783-6605 Andrei N. Mardaryev: http://orcid.org/0000-0002-7826-5506 Krzysztof Poterlowicz: http://orcid.org/0000-0001-6173-5674 Natalia V. Botchkareva: http://orcid.org/0000-0002-5202-6822 Vladimir A. Botchkarev: http://orcid.org/0000-0002-9119-0895 The authors state no conflict of interest. This work was supported by funding from Nottingham Trent University, United Kingdom, UoA03 QR and Capital Funds (MIA), as well as by the grant from Amway, USA to VAB and NVB. Conceptualization: MIA, NVB, VAB; Data Curation: MIA, AGR, KP, MAA, MEP, ANM, NVB, VAB; Formal Analysis: MIA, AGR, KP, MAA, MEP, ANM, NVB, VAB; Funding Acquisition: MIA, VAB, NVB; Investigation: MIA, AGR, KP, MAA, MEP, ANM, NVB, VAB; Supervision: MIA, NVB, VAB; Writing - Original Draft Preparation: MIA, NVB, VAB. Animal studies were performed in accordance with protocols approved by the UK Home Office Project License. C57Bl/6 mice were purchased from Charles River Laboratories. Skin samples were collected at 8 weeks (young sample) and 2 years old (aged samples) and snap frozen in liquid nitrogen for histological and RNA analysis. Human skin was obtained from healthy donors (42–78 years old) undergoing face-lift and abdominoplasty surgery. Donor age and sites of tissue biopsies can be seen in Supplementary Table S1. Tissue was obtained with full written consent adhering to the Declaration of Helsinki principles, following ethical and institutional approval under human tissue act guidelines. Quantitative reverse transcriptase–PCR total RNA was isolated using the miRNeasy Kit (Qiagen, Hilden, Germany). For detection of the mature form of microRNA-21 (miR-21) TaqMan, quantitative reverse transcriptase–PCR was performed using TaqMan Real Time PCR Assay (Applied Biosystems, Foster City, CA) under the following cycling conditions: 95 °C for 10 minutes, followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 60 seconds. Differences between samples and controls were calculated based on the Ct (ΔΔCt) method and normalized to the U6 values. Data from triplicates were pooled, mean ± standard error of the mean was calculated, and statistical analysis was performed using unpaired Student's t-test. For detection of Satb1 and epidermal differentiation genes, 1 μg of total RNA was converted into cDNA using the qPCRBIO cDNA Synthesis Kit system (PCR Biosystems, London, United Kingdom). Gene expression was performed on QuantStudio5 Real Time PCR System (Life Technologies, Carlsbad, CA) using qPCRBIO SyGreen mix (PCR Biosystems). PCR primers were designed with Beacon Designer software (PREMIER Biosoft International, Palo Alto, CA; Supplementary Table S2). Amplification was performed at the following conditions: 95 °C for 5 minutes, followed by 40 cycles of denaturation (95 °C for 15 seconds), annealing (30 seconds at temperature experimentally determined for each primer pairs), and elongation (72 °C for 15 seconds). Differences between samples and controls were calculated based on the Ct (ΔΔCt) method and normalized to mouse (Actb) or human ACTB (actin). Data from triplicates were pooled, mean ± standard error of the mean was calculated, and statistical analysis was performed using unpaired Student's t-test. Skin cryosections (10 μm) were fixed in 4% paraformaldehyde for 10 minutes at room temperature. Tissues sections were acetylated in triethanolamine buffer (4.5 mM triethanolamine, 6 M NCl, and 3 mM acetic anhydride) for 10 minutes and permeabilized (1% Triton X-100/1x diethyl pyrocarbonate–treated phosphate buffered saline) for 30 minutes; slides were hybridized with 2.5 pmol double DIG-labelled miR-21 (Exiqon, Copenhagen, Denmark) and diluted in hybridization buffer (50% formamide DI, 2x saline sodium citrate, 1% dextran sulfate, and 0.4 mg/ml transfer RNA) for 16–18 hours at 60 °C overnight. Slides subsequently were washed in 2x saline sodium citrate (10 minutes, 4 times, 65 °C), 0.1x saline sodium citrate (60 minutes, 65 °C), and 0.2x saline sodium citrate (10 minutes, room temperature). Immunodetection of miR-21 was performed with sheep alkaline phosphatase–conjugated anti-DIG antibody (1:2500, Life Technologies) followed by a staining reaction with BM Purple solution (Life Technologies). Skin cryosections (10 μm) were fixed in 4% paraformaldehyde for 10 minutes at room temperature and were stained overnight with rabbit Satb1 (Abcam, Cambridge, United Kingdom; 1:200, ab49061), followed by application of corresponding donkey anti-rabbit Alexa-555 antibody (Life Technologies, 1:200) for 45 minutes at room temperature. Incubation steps were interspersed by washes with phosphate buffered saline. Sections were counter stained with DAPI. Primary human epidermal keratinocytes were isolated as previously described (Aunin et al., 2017Aunin E. Broadley D. Ahmed M.I. Mardaryev A.N. Botchkareva N.V. Exploring a Role for Regulatory miRNAs in Wound Healing during Ageing: involvement of miR-200c in wound repair.Sci Rep. 2017; 7: 3257Crossref PubMed Scopus (33) Google Scholar) and grown in keratinocyte media 2 (PromoCell, Heidelberg, Germany), containing 0.06 mM CaCl2, epidermal growth factor (0.125 ng/ml), and bovine pituitary extract (40 μg/ml). Primary mouse epidermal keratinocytes were prepared from newborn mice at postnatal days 2–3, as described previously (Ahmed et al., 2014Ahmed M.I. Alam M. Emelianov V.U. Poterlowicz K. Patel A. Sharov A.A. et al.MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway.J Cell Biol. 2014; 207: 549-567Crossref PubMed Scopus (49) Google Scholar). Primary mouse epidermal keratinocytes were grown in EMEM calcium-free medium (Lonza, Basel, Switzerland) supplemented with 0.05 mM calcium, at 33 °C, 8% CO2 (Scientific Laboratory Suppliers, Nottingham, United Kingdom) until 60–70% confluent. Human and mouse keratinocytes were transfected with 200 nM of pro-miR-21 mimic, anti-miR-21, and corresponding miR-controls (Dharmacon, Lafayette, CO) using Lipofectamine RNAiMAX (Life Technologies) as published previously (Ahmed et al., 2011Ahmed M.I. Mardaryev A.N. Lewis C.J. Sharov A.A. Botchkareva N.V. MicroRNA-21 is an important downstream component of BMP signalling in epidermal keratinocytes.J Cell Sci. 2011; 124: 3399-3404Crossref PubMed Scopus (59) Google Scholar). Cells were harvested 24 hours (pro-miR-21) and 48 hours (anti-miR-21) after transfection and used for further analyses. Proteins were extracted from cultured cells using RIPA lysis buffer (50 mm Tris-HCl, 1% NP-40, 0.25% sodium deoxycholate, 150 mm NaCl, and 1 mm EDTA; pH 7.4) and cOmplete ULTRA Protease Inhibitor Cocktail (Sigma-Aldrich, St. Louis, MO), as described previously (Ahmed et al., 2014Ahmed M.I. Alam M. Emelianov V.U. Poterlowicz K. Patel A. Sharov A.A. et al.MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway.J Cell Biol. 2014; 207: 549-567Crossref PubMed Scopus (49) Google Scholar). In brief, 10–20 micrograms of protein were processed for western blot analysis, followed by membrane incubation with primary antibody against SATB1 (Abcam; ab49061, 1:1,000), glucose-6-phosphate dehydrogenase (Abcam; ab8245, 1:10,000), or tubulin (Abcam; ab7291, 1:20,000) overnight at 4 °C. Horseradish peroxidase–tagged IgG antibodies were used as secondary antibodies (Thermo Fisher Scientific, Waltham, MA; 1:5,000). Antibody binding was visualized with an enhanced chemiluminescence's system (SuperSignal West Pico Kit, Thermo Fisher Scientific) and autoradiographed with X-ray film (CL-Xposure Film, Thermo Fisher Scientific) or iBright Gel-Doc Imager (Thermo Fisher Scientific). Possible miR-21 target genes were estimated as a consensus from the following three different prediction algorithms: TargetScan (http://www.targetscan.org/) predicts biological targets of microRNAs by searching for the presence of conserved sites that match the seed region of each microRNA, miRanda (http://microrna.sanger.ac.uk) uses an algorithm to predict microRNA–mRNA pairs, and PicTar (http://genie.weizmann.ac.il/pubs/mir07/mir07_data.html) confirms candidates predicted by the other two algorithms. HaCaT cells were grown in DMEM (Life Technologies) supplemented with heat-inactivated 10% fetal bovine serum in an atmosphere of 5% CO2 at 37 °C, until 60–70% confluent as described previously (Ahmed et al., 2014). 3′ UTR fragments of Satb1 containing miR-21 putative target sites were amplified from mouse genomic DNA using forward and reverse primers containing XhoI and NotI restriction sequences, respectively. For 3′ UTR of Satb1 fragment, 5′- CTCCTGCAGCATCATGTCAT -3′ and 5′- ACCACTCCTAATCAGCACATTTC -3′ forward and reverse primers, respectively, were used. Site-directed mutagenesis was performed using a QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA) to mutate the Satb1 binding site according to the manufacturer's instructions. For the dual luciferase assay, these constructs (200 ng) were cotransfected with 200 nM pro-miR-21 mimic or negative control mimic (Life Technologies) into HaCaT cells using 0.5 μl Lipofectamine 2000 (Life Technologies) in 96-well plates. At 24 hours after transfection, the relative luciferase activities were determined using Dual-Glo Luciferase Assay System (Promega, Madison, WI). The assay was performed in triplicate for three independent trials. For production of control and Satb1-expressing lentiviruses, HEK293T cells were cotransfected with control plasmid (Genecopoeia, Rockville, MD) and pEZ-Lv215-Satb1-eGFP (Genecopoeia, LPP-Mm19720-Lv215) and helper plasmids (pTAT, pREV, pHagp2[GAG/Pol], and pVSV-G) using Lenti-Pac HIV Expression Packaging Kit (Genecopoeia, HPK-LvTR) as per the manufacturer's protocol. Cell culture medium containing viruses was collected 24 hours, 48 hours, and 72 hours after transfection, followed by precipitation of the viral particles using PEG-it Virus Precipitation Solution (System Biosciences) as per the manufacturer's protocol. Primary mouse epidermal keratinocytes were infected with Satb1 and corresponding control lentiviral particles in combination with 10 μg/ml polybrene (Sigma-Aldrich) for 48 hours. To examine the regulatory effects of miR-21 on Satb1-induced gene expression, keratinocytes were transfected with 200 nM synthetic pro-miR-21 mimic or microRNA negative controls for 4 hours (post–48-hour lentiviral treatments). All experiment groups were collected for quantitative reverse transcriptase–PCR analysis 24 hours after pro-miR-21 mimic treatment. Download .xlsx (.01 MB) Help with xlsx files Supplementary Tables 1 and 2

While the effect of ultraviolet radiation (UVR) on human skin has been extensively studied, very little is known on how UVR impacts on the hair follicle (HF). We investigated how surface irradiation of human scalp skin ex vivo with solar spectrum UVR impacts on HF biology, and whether any detrimental effects can be mitigated by a widely used cosmetic and dietary ingredient, caffeine. Besides replicating the well-recognized skin cytotoxicity and epidermal damage, transepidermal low (10J/cm2UVA+20mJ/cm2UVB) or high (50J/cm2UVA+50mJ/cm2UVB) UVR treatment also induced substantial cytotoxicity and oxidative DNA damage in human scalp HFs. UVR also decreased proliferation and promoted apoptosis of HF keratinocytes, stimulated catagen development, regulated the expression of HF growth factors, and induced perifollicular mast cell degranulation. UVR-mediated HF damage was more severe after high-dose UVR and reached deeper HF compartments. Topical 0.1% caffeine itself did not induce skin or HF cytotoxicity, stimulated IGF-1 protein expression in the proximal ORS, but it also promoted keratinocyte apoptosis in selected HF compartments under these ex vivo conditions. Importantly, caffeine provided protection towards UVR (40J/cm2UVA+40mJ/cm2UVB)-induced HF cytotoxicity, HF keratinocyte apoptosis, and intrafollicular increase of TGFβ2 expression. Our study presents a simple, instructive, and clinically relevant ex vivo assay for the transepidermal solar UV irradiation of human scalp skin and provides the first evidence that transepidermal UVR profoundly negatively affects important human HF functions. These can be mitigated by topical caffeine, which deserves clinical exploration as a candidate HF photoprotectant.

This review has the following objectives: Firstly, it provides an explanation of the evolution of laser/intense pulsed light (IPL) hair reduction modalities from high fluence professional devices to low fluence home‐use appliances. Secondly, it summarises published literature reviews on home‐use devices (HUDs) as evidence of their growing credibility. Thirdly, it proposes mechanistic differences in light delivery regimes and the resulting divergences in mode of action.