The heterogeneous nature of human breast cancer (HBC) can still lead to therapy inefficacy and high lethality, and new therapeutics as well as new spontaneous animal models are needed to benefit translational HBC research. Dogs are primarily investigated since they spontaneously develop tumors that share many features with human cancers. In recent years, different natural phytochemicals including berberine, a plant alkaloid, have been reported to have antiproliferative activity in vitro in human cancers and rodent animal models. In this study, we report the antiproliferative activity and mechanism of action of berberine, its active metabolite berberrubine, and eight analogs, on a canine mammary carcinoma cell line and in transgenic zebrafish models. We demonstrate both in vitro and in vivo the significant effects of specific analogs on cell viability via the induction of apoptosis, also identifying their role in inhibiting the Wnt/β-catenin pathway and activating the Hippo signals with a downstream reduction in CTGF expression. In particular, the berberine analogs NAX035 and NAX057 show the highest therapeutic efficacy, deserving further analyses to elucidate their mechanism of action more in detail, and in vivo studies on spontaneous neoplastic diseases are needed, aiming at improving veterinary treatments of cancer as well as translational cancer research.

The interaction between the series of berberine derivatives 1–5 (NAX071, NAX120, NAX075, NAX077 and NAX079) and human telomeric G-quadruplexes (G4), which are able to inhibit the Telomerase enzyme’s activity in malignant cells, was investigated. The derivatives bear a pyridine moiety connected by a hydrocarbon linker of varying length (n = 1–5, with n number of aliphatic carbon atoms) to the C13 position of the parent berberine. As for the G4s, both bimolecular 5′-TAGGGTTAGGGT-3′ (Tel12) and monomolecular 5′-TAGGGTTAGGGTTAGGGTTAGGG-3′ (Tel23) DNA oligonucleotides were considered. Spectrophotometric titrations, melting tests, X-ray diffraction solid state analysis and in silico molecular dynamics (MD) simulations were used to describe the different systems. The results were compared in search of structure–activity relationships. The analysis pointed out the formation of 1:1 complexes between Tel12 and all ligands, whereas both 1:1 and 2:1 ligand/G4 stoichiometries were found for the adduct formed by NAX071 (n = 1). Tel12, with tetrads free from the hindrance by the loop, showed a higher affinity. The details of the different binding geometries were discussed, highlighting the importance of H-bonds given by the berberine benzodioxole group and a correlation between the strength of binding and the hydrocarbon linker length. Theoretical (MD) and experimental (X-ray) structural studies evidence the possibility for the berberine core to interact with one or both G4 strands, depending on the constraints given by the linker length, thus affecting the G4 stabilization effect.

Pancreatic ductal adenocarcinoma (PDAC) is the most common form of pancreatic cancer. In ~75% of PDAC, the tumor suppressor TP53 gene is mutated. Novel approaches to treat cancer involve compounds called mutant TP53 reactivators. They interact with mutant TP53 proteins and restore some of their growth suppressive properties, but they may also interact with other proteins, e.g., TP63 and TP73. We examined the ability of the TP53 reactivator APR-246 to interact with eleven modified berberine compounds (NAX compounds) in the presence and absence of WT-TP53 in two PDAC cell lines: the MIA-PaCa-2, which has gain of function (GOF) TP53 mutations on both alleles, and PANC-28, which lacks expression of the WT TP53 protein. Our results indicate the TP53 reactivator-induced increase in therapeutic potential of many modified berberines.

Approaches to improve pancreatic cancer therapy are essential as this disease has a very bleak outcome. Approximately 80% of pancreatic cancers are pancreatic ductal adenocarcinomas (PDAC). A key regulatory gene frequently mutated (∼75%) in PDAC is the TP53 tumor suppressor gene which controls the transcription of multiple genes involved in cell cycle progression, apoptosis, cancer progression and other growth regulatory processes. The mouse double minute 2 homolog (MDM2) gene product is a nuclear-localized E3 ubiquitin ligase and negatively regulates the TP53 protein which results in its proteasomal degradation. Various MDM2 inhibitors have been isolated and examined in clinical trials, especially in patients with hematological malignancies. Nutlin-3a is one of the first MDM2 inhibitors isolated. Berberine (BBR) is a natural product found in many fruits and berries and used in traditional medicine for centuries. It has many biological effects, and some are anti-proliferative in nature. BBR may activate the expression of TP53 and inhibit cell cycle progression as well as other events important in cell growth. To understand more about the potential of compounds like BBR and chemical modified BBRs (NAX compounds) to sensitize PDAC cells to MDM2 inhibitors, we introduced either WT-TP53 or the pLXSN empty vector control into two PDAC cell lines, one lacking expression of TP53 (PANC-28) and one with gain-of-function mutant TP53 on both alleles (MIA-PaCa-2). Our results indicate that nutlin-3a was able to increase the sensitivity to BBR and certain NAX compounds. The effects of nutlin-3a were usually more substantial in those cells containing an introduced WT TP53 gene. These results highlight the importance of knowledge of the type of TP53 mutation that is present in cancer patients before the administration of drugs which function by stabilization of the TP53 protein.

Following the publication of the above article, the authors have requested a change in the authorship on the paper, and the revised list of authors is presented above; essentially, the ninth intended author, Giuseppe Salvo (G.S.), was inadverently omitted from the author list. G.S. contributed towards the T design and the preparation of the tagged ScFv. Therefore, the revised authors' names and affiliations, as they should have been presented in the original version of this paper, are as follows: Elisa Tremante1, Leonardo Sibilio2,7, Fabio Centola2,8, Nadine Knutti3,9, Gerd Holzapfel4, Isabella Manni5, Matteo Allegretti1, Paolo Lombardi6, Giuseppe Salvo2,10, Loredana Cecchetelli2, Karlheinz Friedrich3, Joachim BertraM4 and Patrizio Giacomini1. 1Oncogenomics and Epigenetics, IRCCS Regina Elena National Cancer Institute, Rome; 2Ibi Lorenzini, Aprilia, Italy; 3University Hospital Jena, Institute of Biochemistry II, Jena; 4IBA GmbH, Göttingen, Germany; 5SAFU, IRCCS Regina Elena National Cancer Institute, Rome; 6NaxosPharma, Novate Milanese, Milan, Italy. Correspondence to: Dr Patrizio Giacomini. Oncogenomics and Epigenetics, IRCCS Regina Elena National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy. E‑mail: patrizio.giacomini@ifo.gov.it. Present address: 7Menarini Biotech, Pomezia, Rome, Italy. Present address: 8Merck Serono Spa, Global Analytical Department, Guidonia Montecelio, Rome, Italy. Present address: 9University Hospital Jena Institute for Clinical Chemistry and Laboratory Diagnostics, Jena, Germany. Present address: 10External Quality Assurance (ExM), MSD Italia S.r.l., Via Vitorchiano 151, 00189 Rome.Italy. Furthermore, the Authors' contributions section should be amended to read as follows: Authors' contributions: ET and MA tested the TOOLBOX concept and performed the flow cytometry experiments. LS, FC, GS and LC designed and prepared the tagged ScFv. NK and KF designed and prepared the GFP promoter‑reporter construct. GH and JB designed and manufactured Strep‑Tactins. ET and IM performed animal studies. PL designed and manufactured NAX and NAXT compounds. PG conceptualized TOOLBOX and wrote the manuscript with the contribution of all authors. All authors have approved the final version of the manuscript. All the authors agree with the inclusion of Giuseppe Salvo as an author on this paper, and are grateful to the Editor for allowing them the opportunity to publish this Corrigendum. Furthermore, they apologize to the readership of the Journal for any inconvenience caused. [the original article was published in Oncology Reports 45: 77, 2021; DOI: 10.3892/or.2021.8028].

Herein, we describe TOOLBOX, a 3‑step modular nano‑assembly targeting system that permits the combinatorial exchange of antibody specificities and toxic payloads, introducing modularity in antibody‑drug conjugate (ADC) manufacturing. TOOLBOX integrates 3 building blocks: i) a recombinant antibody fragment (that in the selected setting targets the proto‑oncogene ERBB2) genetically fused to an 8 amino acid Strep‑Tag®; ii) a multivalent protein adapter, called Strep‑Tactin®; iii) two anticancer agents, e.g. DNA nanobinders and the maytansinoid DM1, both carrying a chemically attached Strep‑Tag that reversibly turns them into inactive prodrugs. Stoichiometrically optimized complexes of Strep‑Tagged antibody fragments and drugs, bridged by Strep‑Tactin, were specifically uptaken by breast cancer cells expressing ERBB2, and this unexpectedly resulted in conditional prodrug reactivation. A promoter‑reporter system showed that TOOLBOX inhibited downstream ERBB2 signaling not only in ERBB2‑overexpressing/‑amplified SK‑BR‑3 cells grown in vitro, but also in ERBB2‑low/non‑amplified BRC230 triple‑negative breast carcinoma cells xenotransplanted in nude mice. Thus, TOOLBOX is a modular ADC‑like nano‑assembly platform for precision oncology.

The natural isoquinoline alkaloid Berberine (BBR) has been shown to possess several therapeutic effects, including anticancer activity. Different BBR derivatives have been designed and synthesized in order to obtain new compounds with enhanced anticancer efficacy. We previously showed that intraperitoneal (IP) administration of the BBR-derived NAX014 compound was able to counteract HER-2 overexpressing mammary tumors onset and progression in transgenic mice. However, the IP administration was found to induce organ toxicity at doses higher than 2.5 mg/Kg. In this study, we evaluated the effect of intragastric (IG) administration of 20 mg/kg of NAX014 on both safety and anticancer efficacy in HER-2/neu transgenic mice. Furthermore, cancer cell dissemination and migration, tumor cell senescence and immunological changes were examined. Our results demonstrated that IG NAX014 administration delayed the onset of mammary tumors with no negative effects on health and survival. NAX014 reduced HER-2 overexpressing BC cells migration in vitro and the frequency of lung metastasis in HER-2/neu transgenic mice. A statistically significant increase of senescence-associated p16 expression was observed in tumors from NAX014-treated mice, and the induction of cell senescence was observed in HER-2 overexpressing BC cells after in vitro treatment with NAX014. Although NAX014 did not modulate the presence of tumor-infiltrating lymphocytes, the level of circulating TNF-α and VEGF was found to be reduced in NAX014-treated mice. The overall results address the NAX014 compound as potential tool for therapeutic strategies against HER-2 overexpressing breast cancer.

Gram-negative sepsis ranks as the leading cause of death in intensive care units. Despite the development of new antibiotics, mortality from gram-negative sepsis remains high. The present study aims to investigate the in vivo effects of berberine (BBR) administration on septic death induced by intraperitoneal Escherichia coli injection. The results showed that (i) single 5 mg/kg dose of BBR increases the survival of septic mice, (ii) BBR administration improves the antimicrobial efficacy of antibiotic drug, (iii) BBR pre-treatment prevents improvements of BBR therapy without affecting the pro-survival effects of antibiotic drug. The effects of BBR administration were associated with immunological alterations represented by changes in CD4+ and CD8+ lymphocytes population and IL-6 and TNF-α production. This study highlighted the benefits of berberine administration as antibiotic adjuvant in E. coli sepsis. Furthermore, information about berberine-induced immunological perturbations and their influence on host response to infection and therapy has been shown.

[This corrects the article DOI: 10.1021/acsmedchemlett.9b00516.].

Background: Accumulation of misfolded proteins is a common hallmark of several neurodegenerative disorders (NDs) which results from a failure or an impairment of the protein quality control (PQC) system. The PQC system is composed by chaperones and the degradative systems (proteasome and autophagy). Mutant proteins that misfold are potentially neurotoxic, thus strategies aimed at preventing their aggregation or at enhancing their clearance are emerging as interesting therapeutic targets for NDs. Methods: We tested the natural alkaloid berberine (BBR) and some derivatives for their capability to enhance misfolded protein clearance in cell models of NDs, evaluating which degradative pathway mediates their action. Results: We found that both BBR and its semisynthetic derivatives promote degradation of mutant androgen receptor (ARpolyQ) causative of spinal and bulbar muscular atrophy, acting mainly via proteasome and preventing ARpolyQ aggregation. Overlapping effects were observed on other misfolded proteins causative of amyotrophic lateral sclerosis, frontotemporal-lobar degeneration or Huntington disease, but with selective and specific action against each different mutant protein. Conclusions: BBR and its analogues induce the clearance of misfolded proteins responsible for NDs, representing potential therapeutic tools to counteract these fatal disorders.

Telomerase is an enzyme deputed to the maintenance of eukaryotic chromosomes; however, its overexpression is a recognized hallmark of many cancer forms. A viable route for the inhibition of telomerase in malignant cells is the stabilization of G-quadruplex structures (G4) at the 3' overhang of telomeres. Berberine has shown in this regard valuable G4 binding properties together with a significant anticancer activity and telomerase inhibition effects. Here, we focused on a berberine derivative featuring a pyridine containing side group at the 13th position. Such modification actually improves the binding toward telomeric G-quadruplexes and establishes a degree of selectivity in the interaction with different sequences. Moreover, the X-ray crystal structure obtained for the complex formed by the ligand and a bimolecular human telomeric quadruplex affords a better understanding of the 13-berberine derivatives behavior with telomeric G4 and allows to draw useful insights for the future design of derivatives with remarkable anticancer properties.

Mutations at the TP53 gene are readily detected (approximately 50–75%) in pancreatic ductal adenocarcinoma (PDAC) patients. TP53 was previously thought to be a difficult target as it is often mutated, deleted or inactivated on both chromosomes in certain cancers. In the following study, the effects of restoration of wild-type (WT) TP53 activity on the sensitivities of MIA-PaCa-2 pancreatic cancer cells to the MDM2 inhibitor nutlin-3a in combination with chemotherapy, targeted therapy, as well as, nutraceuticals were examined. Upon introduction of the WT-TP53 gene into MIA-PaCa-2 cells, which contain a TP53 gain of function (GOF) mutation, the sensitivity to the MDM2 inhibitor increased. However, effects of nutlin-3a were also observed in MIA-PaCa-2 cells lacking WT-TP53, as upon co-treatment with nutlin-3a, the sensitivity to certain inhibitors, chemotherapeutic drugs and nutraceuticals increased. Interestingly, co-treatment with nutlin-3a and certain chemotherapeutic drug such as irinotecan and oxaliplatin resulted in antagonistic effects in cells both lacking and containing WT-TP53 activity. These studies indicate the sensitizing abilities that WT-TP53 activity can have in PDAC cells which normally lack WT-TP53, as well as, the effects that the MDM2 inhibitor nutlin-3a can have in both cells containing and lacking WT-TP53 to various therapeutic agents.

An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

Binding of low molecular weight ligands to G-quadruplex nucleic acid structures is known to inhibit telomere extension and prevent abnormal growth of cells leading to cancer. Such specialized DNA conformations have emerged as important targets for drug design and development. In this manuscript we present a detailed calorimetric investigation on the interaction of berberrubine (BBR) and its two synthetic analogues with telomeric G-quadruplex DNA using calorimetry techniques and thermal melting study. A stronger binding of the analogues in comparison with BBR was observed in the experiments. The 13-phenylalkyl derivative of berberrubine (BBR2) (K = 1.38 × 105 M−1) showed higher affinity than the 13-diphenylalkyl derivative of berberrubine (BBR1) (K = 9.70 × 104 M−1). Isothermal titration calorimetry study revealed an exothermic binding that was favoured by both enthalpy and entropy changes in BBR in contrast to the analogues where the binding was mostly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. The negative standard molar heat capacity values in conjunction with enthalpy–entropy compensation (EEC) confirmed the presence of dominant multiple weak non-covalent interactions in their binding. Differential scanning calorimetry and optical melting study further revealed that BBR and its analogues stabilized quadruplex structure against thermal denaturation. The overall affinity pattern of the alkaloids towards telomeric G-quadruplex structures followed as BBR2 > BBR1 > BBR.

Pancreatic ductal adenocarcinoma (PDAC) is an aggressive, highly metastatic malignancy and accounts for 85% of pancreatic cancers. PDAC patients have poor prognosis with a five-year survival of only 5–10%. Mutations at the TP53 gene are readily detected in pancreatic tumors isolated from PDAC patients. We have investigated the effects of restoration of wild-type (WT) TP53 activity on the sensitivity of pancreatic cancer cells to: chemotherapy, targeted therapy, as well as, nutraceuticals. Upon introduction of the WT-TP53 gene into the MIA-PaCa-2 pancreatic cancer cell line, the sensitivity to drugs used to treat pancreatic cancer cells such as: gemcitabine, fluorouracil (5FU), cisplatin, irinotecan, oxaliplatin, and paclitaxel increased significantly. Likewise, the sensitivity to drugs used to treat other cancers such as: doxorubicin, mitoxantrone, and 4 hydroxy tamoxifen (4HT) also increased upon introduction of WT-TP53 into MIA-PaCa-2 cells. Furthermore, the sensitivity to certain inhibitors which target: PI3K/mTORC1, PDK1, SRC, GSK-3, and biochemical processes such as proteasomal degradation and the nutraceutical berberine as increased upon introduction of WT-TP53. Furthermore, in some cases, cells with WT-TP53 were more sensitive to the combination of drugs and suboptimal doses of the MDM2 inhibitor nutlin-3a. However, TP53-independent effects of nutlin-3a were observed upon treatment with either a proteasomal or a PI3K/mTOR inhibitor. These studies indicate the sensitizing effects that WT-TP53 can have in PDAC cells which normally lack WT-TP53 to various therapeutic agents and suggest approaches to improve PDAC therapy.

Tetrahydroberberine (THB), otherwise known as canadine, is a natural alkaloid showing significant pharmacological properties and antioxidant protection against oxidative damage. Herein, we synthetized structurally complex THB analogues, namely pyrrolino-tetrahydroberberines (PTHBs) 4a-g, containing the pyrrolino[2,3-b]pyridine system, by means of the reactions of 1,2-diaza-1,3-dienes and 7,8-dihydroberberine. Aim of the study was to explore the in vitro antioxidant properties of PTHBs in comparison to THB thus to identify the most effective against free radical-induced oxidative injury, by using three different antioxidant tests: the ORAC method, the DNA nicking assay, and the DCFH-DA cellular assay. As a result, PTHB 4d emerged among the other THB analogues by exhibiting the best antioxidant properties. First, it was the only compound having an ORAC value completely comparable to that of THB, indicating the same ability to neutralize peroxyl radicals. Secondly, 4d showed an even better antioxidant capacity than THB in protecting DNA against ferrous ion-induced strand breaks. These observations were also confirmed in NCTC-2544 human keratinocytes exposed to hydrogen peroxide. Indeed, 4d protected cells against oxidation more efficiently than THB both in the short (1 and 3 h) and long (24 h) period of incubation, possibly suggesting increased cell membrane permeability and/or intracellular stability of 4d as compared to THB.

Pancreatic ductal adenocarcinoma (PDAC) is an aggressive, highly metastatic malignancy and accounts for 85% of pancreatic cancers. PDAC patients have poor prognosis with a five-year survival of only 5–10% after diagnosis and treatment. Pancreatic cancer has been associated with type II diabetes as the frequency of recently diagnosed diabetics that develop pancreatic cancer within a 10-year period of initial diagnosis of diabetes in increased in comparison to non-diabetic patients. Metformin is a very frequently prescribed drug used to treat type II diabetes. Metformin acts in part by stimulating AMP-kinase (AMPK) and results in the suppression of mTORC1 activity and the induction of autophagy. In the following studies, we have examined the effects of metformin in the presence of various chemotherapeutic drugs, signal transduction inhibitors and natural products on the growth of three different PDAC lines. Metformin, by itself, was not effective at suppressing growth of the pancreatic cancer cell lines at concentration less than 1000 nM, however, in certain PDAC lines, a suboptimal dose of metformin (250 nM) potentiated the effects of various chemotherapeutic drugs used to treat pancreatic cancer (e.g., gemcitabine, cisplatin, 5-fluorouracil) and other cancer types (e.g., doxorubicin, docetaxel). Furthermore, metformin could increase anti-proliferative effects of mTORC1 and PI3K/mTOR inhibitors as well as natural products such as berberine and the anti-malarial drug chloroquine in certain PDAC lines. Thus, metformin can enhance the effects of certain drugs and signal transduction inhibitors which are used to treat pancreatic and various other cancers.

Over the past fifty years, society has become aware of the importance of a healthy diet in terms of human fitness and longevity. More recently, the concept of the beneficial effects of certain components of our diet and other compounds, that are consumed often by different cultures in various parts of the world, has become apparent. These "healthy" components of our diet are often referred to as nutraceuticals and they can prevent/suppress: aging, bacterial, fungal and viral infections, diabetes, inflammation, metabolic disorders and cardiovascular diseases and have other health-enhancing effects. Moreover, they are now often being investigated because of their anti-cancer properties/potentials. Understanding the effects of various natural products on cancer cells may enhance their usage as anti-proliferative agents which may be beneficial for many health problems. In this manuscript, we discuss and demonstrate how certain nutraceuticals may enhance other anti-cancer drugs to suppress proliferation of cancer cells.

Breast cancer (BC) is the most common malignancy and the most common cause of cancer death in elderly women. We recently demonstrated that innovative compounds structurally related to and semisynthetically derived from the plant alkaloid berberine represent a promising unexplored resource for novel therapeutic tools in BC therapy. In this study, we analyzed the effectiveness of new 13-dichlorophenylalkyl berberine semisynthetic derivatives (NAX060, NAX103, NAX111, and NAX114) on the viability of BC cell lines. Our results demonstrated that the new compounds effectively inhibited the growth of a variety of human BC cell lines. In particular, the viability of HER-2 overexpressing SK-BR-3 cells was significantly reduced by the treatment with NAX060, the most active compound, in a dose and time-dependent manner. In the same tumor cell line, NAX060 induced a strong increase in sub-G1 population while G0/G1 and G2/M phase cells remarkably decreased. NAX060 withdrawal after 72 h of treatment resulted in an irreversible cell proliferation arrest and increasing cell death. Real-time PCR analyses showed that NAX060 induced the expression of some cell-cycle checkpoint molecules involved in cell senescence such as p21WAF1, p27, p16INK4a, and PAI-1. Furthermore, the HER-2 protein expression and phosphorylation, as well as the level of heparanase expression, were remarkably reduced on SK-BR-3 cells. NAX060 was effective also on HER-2 negative tumor cells, and, in particular, on human triple-negative MDA-MB-231 cells. These data suggest a potential therapeutic effect of NAX060 compound in the management of BC malignancies. Interestingly, NAX060 may represent a new useful tool also in triple-negative BC. © 2018 BioFactors, 44(5):443-452, 2018.

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M-1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M-1, and that of BER was (0.98 ± 0.03) × 105 M-1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.