The nematode parasite Angiostrongylus vasorum is an increasingly important cause of respiratory and other diseases in dogs. Geographical spread from previously limited endemic foci has occurred rapidly. This paper investigates parasite epidemiology around the location of the first reported case in Scotland in 2009: by detection of A vasorum-specific DNA in gastropod intermediate hosts, and in dogs circulating DNA and specific antibodies, and first stage larvae in faeces. Overall prevalence in gastropods was 6.7 per cent (16/240), with parasite DNA found in slugs in the Arion ater and Arion hortensis species aggregates and the snail Helix aspersa (syn. Cornu aspersum). Of 60 dogs presenting with clinical signs compatible with angiostrongylosis, none tested positive using PCR on peripheral blood or Baermann test on faeces, and none of 35 tested for circulating anti-A vasorum antibodies were positive. PCR prevalence in gastropods was highest (11 per cent) in the park frequented by the canine angiostrongylosis index case. Molecular survey for infection in gastropods is a potentially informative and efficient method for characterising the distribution of A vasorum and therefore local risk of canine infection. However, there appears to be a complex relationship between prevalence in gastropods and emergence of canine clinical disease, which requires further work to advance understanding of parasite transmission and geographical disease spread.

Angiostrongylus vasorum is an emerging parasite that is currently distributed through Western Europe and parts of South America. An isolated population is also present in Newfoundland, Canada. This presents a risk of onward spread into North America, but its origin is unknown. To ascertain the phylogeographic relationships and genetic diversity of A. vasorum within the western Palaearctic and eastern Nearctic ecozones, a total of 143 adult and larval nematode specimens were collected from foxes (Vulpes vulpes) and dogs (Canis lupus familiaris) in Canada, Denmark, France, Germany, Ireland, the Netherlands, Portugal and the United Kingdom, and a coyote (Canis latrans) in Canada. DNA was extracted and the second internal transcribed spacer and two mitochondrial loci were amplified and sequenced. Multiple haplotypes (n = 35) based on combined mitochondrial sequences (1078 bp) of the partial cytochrome oxidase subunit I (COI), large subunit ribosomal RNA (rrnL) and the complete nicotinamide adenine dinucleotide dehydrogenase 3 (NADH3) sequences, were observed throughout the Palaearctic countries sampled; however, only a single haplotype was observed for the Canadian A. vasorum population. The likely origin of A. vasorum in Newfoundland is therefore inferred to be within the western Palaearctic. There was no evidence of genetic segregation of parasites in dogs, foxes and coyotes, supporting the hypothesis that transmission occurs between wild and domestic canids. The transmission dynamics and population structure of this nematode are further discussed.

Bartonella henselae (Rhizobiales: Bartonellacae), the agent of cat-scratch disease, is an emerging bacterial pathogen which can be transmitted via infective faecal material of Ctenocephalides felis Bouché (Siphonaptera: Pulicidae). Worldwide, B. henselae has been identified in 1-53% of felines and 2.9-17.4% of fleas. Although culture is the routine method for detection, the procedure is time-consuming and is rarely used for isolation directly from flea vectors. The current study reports the development of a quantitative real-time polymerase chain reaction (qPCR) to detect and quantify B. henselae organisms from vector samples. The qPCR is specific and detects as few as 2.5 genome copies. To enable direct quantification of Bartonella organisms in different vector samples, we developed a qPCR to detect C. felis DNA that also acts as an extraction control. Combining both PCRs into a multiplex format validates B. henselae results when sampling flea populations, although there is a reduction in sensitivity. This reduction might be counteracted by a different combination of probe fluorophores.

Infection with the nematode Angiostrongylus vasorum is an emerging cause of canine disease in Europe and part of North America, yet published data on its epidemiology in endemic areas are lacking. This study tested faecal samples from 897 dogs attending veterinary practices in the southern part of Great Britain, a long standing endemic focus. Among 790 dogs presenting with respiratory or other signs broadly suggestive of angiostrongylosis, 16% tested positive on a single Baermann's examination, compared with 2% of healthy dogs in the same catchment areas. Risk factors for positive tests included age (higher risk in younger dogs), season (more cases earlier in the calendar year), and worming history (lower risk if given milbemycin oxime in the past 12 weeks). Sex, neutering status and breed were not significant in terms of risk of testing positive. The most common clinical signs in infected dogs were respiratory, along with non-specific signs such as lethargy and exercise intolerance, while bleeding, neurological and gastrointestinal signs were also recorded. Around half the dogs sampled that showed signs of extra-pulmonary disease also had respiratory signs. Direct faecal smears and Baermann's tests read after one hour detected 56% and 83% of diagnosed cases respectively. The data confirm that A. vasorum is commonly associated with disease in endemic areas, which manifests with a broad range of signs at primary care level. Information on risk factors is useful in diagnosis and control, and forms a basis for further epidemiological investigation.

Polymerase chain reaction (PCR) analysis is regularly used to detect pathogens within arthropod vectors, but has also been applied to investigate vector DNA. This study details a novel highly sensitive quantitative PCR (qPCR) which detects and quantifies DNA from Ixodes ricinus, the European vector of Anaplasma phagocytophilum. By pairing this with a qPCR to detect A. phagocytophilum, valid comparisons of pathogen load can be made between different sized tick-tissue samples. These qPCRs were validated in I. ricinus that were fed A. phagocytophilum-infected blood using an artificial membrane feeder. Pathogens were detected in the tick haemolymph within 36h, indicating that successful infection had taken place. This study illustrates the application of vector-targeted qPCRs to confirm and validate pathogen load in samples as part of investigations of vector-pathogen interactions.

The parasitic nematode Angiostrongylus vasorum is an emerging challenge for companion animal and wildlife health, with reported increases in both distribution and incidence in Europe. To facilitate improved detection of this parasite, a SYBR green real-time polymerase chain reaction (PCR) was developed to amplify a region of the second internal transcribed spacer (ITS-2) of A. vasorum from both definitive and intermediate host samples. The PCR assay was capable of detecting a single of plasmid DNA containing the entire ITS-2 region, a single first stage larva (L1) in 200μl canine EDTA blood, a single L1 in 200mg of canine faeces and a single L3 in 10mg of Biomphalaria glabrata tissue. The assay exhibited a high level of specificity to A. vasorum and whilst it potentially amplifies DNA of other Angiostrongylus species, it did not amplify DNA from a range of other common canine parasitic nematodes. Field evaluation of the PCR assay was conducted by screening canine EDTA blood and faecal samples from suspected cases of A. vasorum infection and compared with Baermann's detection, and also by screening a range of gastropod species from an endemic area. Real-time quantitative PCR offers a more efficient means of detecting A. vasorum infection with a lower limit of detection than traditional diagnostic tests, and it therefore has important clinical and epidemiological applications.

Bartonella henselae and Bartonella clarridgeiae are known to infect domestic cats. Transmission of the organisms is associated with the inoculation of wounds with infected cat flea ( Ctenocephalides felis ) faeces ([Breitschwerdt and Kordick 2000][1]). Naturally infected cats usually show no

SUMMARYAngiostrongylus vasorumis a nematode parasite of sylvan and domestic species of the family Canidae. It has a broad but patchy distribution worldwide, and there is evidence for geographical spread and increasing incidence of infection in recent years. While historicallyAngiostrongylus-like nematodes identified in dogs and foxes have been described asA. vasorumin Europe andAngiocaulus raillietiin South America, more recent taxonomic revision has amalgamated these into a single species,A. vasorum. Here we report, for the first time, the molecular characterization of isolates ofA. vasorumfrom Germany, Portugal, Denmark and the United Kingdom on the basis of the mitochondrial COI gene and the second ribosomal internal transcribed spacer. When compared with isolates from Brazil, sequence analysis revealed 2 distinct genotypes. Estimated rates of evolution based on COI sequences for both nematode and host are consistent with the hypothesis that the presence ofA. vasorumin South America is a result of an ancient evolutionary event.Angiostrongylus vasorumin South America potentially represents a separate species to that observed in Europe.

In 2003, we carried out a field survey in order to investigate the significance of sub-clinical tickborne bacterial infections in African dogs from the Ivory Coast (n = 137) and Gabon (n = 255). So far, only limited data on this topic are available in Africa when compared with the USA and Europe, and in most of the cases, serological techniques have been applied [1Davoust B Bourry O Gomez J et al.Surveys on seroprevalence of canine monocytic ehrlichiosis among dogs living in the Ivory Coast and Gabon and evaluation of a quick commercial test kit dot-ELISA.Ann N Y Acad Sci. 2006; 1078: 464-469Crossref PubMed Scopus (11) Google Scholar]. In this study, we used PCR amplification and DNA sequencing to screen different tick-borne bacterial pathogens in the blood of dogs. The dogs from the Ivory Coast were resident in the capital Abidjan and were used for surveillance purposes by protection companies. They were kept in 16 different kennels and received regular medical prophylaxis including vaccinations and external anti-parasitic treatments. Dogs from Gabon were recruited in 15 small villages in the area of Ogooué-Ivindo, situated in the northeastern part of the country. They were nonkennelled companion animals and received no specific medical prevention. All the dogs appeared healthy at the time of the examination. All Gabonese dogs were infested by fleas and some of them by Haemaphysalis leachi ticks, while no ectoparasites were found in dogs from the Ivory Coast. Blood was collected in EDTA-anticoagulated tubes kept deep-frozen at –20°C until further processing. In the laboratory, DNA extraction was carried out using QIAamp DNA Mini Kits (Qiagen Ltd, Crawley, UK) according to the manufacturer's recommendations. Briefly, blood samples were digested for 10 min with a mixture of proteinase K and detergents at 56°C to liberate host and pathogen DNA. DNA was extracted from 200 μL of blood and purified DNA was eluted in 100 μL of low ionic strength buffer, pH 8.0. DNA from individual dogs was screened by PCR, using specific primers, for the presence of Ehrlichia and Anaplasma species (Ivory Coast), and Ehrlichia and Anaplasma species, Mycoplasma spp. and Rickettsia spp. (Gabon). PCR assays amplified a 350 base pair fragment of the 16S rRNA gene for Ehrlichia/Anaplasma species (primer sequences: ggtaccyacagaagaagtcc and tagcactcatcgtttacagc), 16S rRNA gene for Mycoplasma spp. (primer sequences: atacggcccatattcctacg and tgctccaccacttgttca) and ompB gene for Rickettsia spp. (primer sequences: gacaattaatatcggtgacgg and tgcatcagcattaccgcttgc). Sequencing was required to further characterise positive results for Ehrlichia/Anaplasma PCR and limited sequencing was performed for Mycoplasma spp. Overall, 10/392 (2.6%) of the tested dogs were positive for E. canis and 5/392 (1.3%) for A. platys (Table 1). The majority of them was from the Ivory Coast; 10 were positive for E. canis and two for A. platys. In Gabon, only three dogs were positive for A. platys and none was positive for E. canis. In this latter country, a high proportion of dogs (114/255, 44.7%) was positive for Mycoplasma spp. Sequencing of 10 Mycoplasma positive samples revealed four Mycoplasma haemocanis, one Mycoplasma haemofelis, and five samples of a novel Mycoplasma. No sample was positive for Rickettsia spp. The three Gabonese dogs positive for A. platys were co-infected with Mycoplasma spp. No E. canis and A. platys co-infections were present in the Ivory Coast dogs.TABLE 1Molecular detection of bacterial tick-transmitted pathogens in dogs of western AfricaEhrlichia canisAnaplasma platysMycoplasma spp.Rickettsia spp.Ivory Coast Abidjan n = 13710/137 7.3%2/137 1.5%Not-detectedNot-detectedGabon Ogooué-Ivindo area n = 2550 0%3/255 1.2%114/255 44.7%0 0%Total n = 39210/392 2.6%5/392 1.3%114/255 44.7%0 0% Open table in a new tab Ehrlichia canis is responsible for canine monocytic ehrlichiosis, a widespread infectious disease in the distribution area of its vector Rhipicephalus sanguineus, the brown dog tick. Interestingly, in a previous seroprevalence survey of E. canis infection in the same population of dogs [1Davoust B Bourry O Gomez J et al.Surveys on seroprevalence of canine monocytic ehrlichiosis among dogs living in the Ivory Coast and Gabon and evaluation of a quick commercial test kit dot-ELISA.Ann N Y Acad Sci. 2006; 1078: 464-469Crossref PubMed Scopus (11) Google Scholar], 67.8% of dogs in the Ivory Coast were positive and only 3.1% in Gabon, while our molecular study found 7.3% and 0%, respectively. Moreover, the average titres of positive samples from the Ivory Coast dogs were much higher than those from the Gabonese dogs. The absence of E. canis DNA among 255 dogs in Gabon is consistent with the low prevalence of its vector, R. sanguineus. Rhipicephalus sanguineus is also considered as being the main vector of A. platys, the cause of canine infectious cyclic thrombocytopenia, although naturally infected dogs do not necessarily exhibit clinical signs [2Sanogo YO Davoust B Inokuma H et al.First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa.Onderstepoort J Vet Res. 2003; 70: 205-212PubMed Google Scholar]. Anaplasma platys has already been isolated from a dog in the Democratic Republic of the Congo [2Sanogo YO Davoust B Inokuma H et al.First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa.Onderstepoort J Vet Res. 2003; 70: 205-212PubMed Google Scholar]. The presence of A. platys in the Gabon dog population despite the apparently low exposure to Rhipicephalus ticks requires further investigation. However, our study suggests that specific testing for A. platys is recommended when a clinical suspicion of E. canis infection is not confirmed. Mycoplasma haemocanis is responsible for anaemia in dogs but clinical signs mainly appear in those that are immuno-compromised or splenectomised [3Chalker VJ Canine mycoplasmas.Res Vet Sci. 2005; 79: 1-8Crossref PubMed Scopus (56) Google Scholar, 4Wengi N Willi B Boretti FS et al.Real-time PCR-based prevalence study, infection follow-up and molecular characterization of canine hemotropic mycoplasmas.Vet Microbiol. 2008; 126: 132-141Crossref PubMed Scopus (61) Google Scholar]. The prevalence of Mycoplasma infection in the Gabonese dogs of this study is high and this may be explained by persistent infection, which has been previously reported in dogs [4Wengi N Willi B Boretti FS et al.Real-time PCR-based prevalence study, infection follow-up and molecular characterization of canine hemotropic mycoplasmas.Vet Microbiol. 2008; 126: 132-141Crossref PubMed Scopus (61) Google Scholar]. Transmission by R. sanguineus is suspected [3Chalker VJ Canine mycoplasmas.Res Vet Sci. 2005; 79: 1-8Crossref PubMed Scopus (56) Google Scholar] but this does not correlate with the high prevalence of Mycoplasma infection in an environment of low R. sanguineus exposure. The dogs sampled in Gabon were parasited by fleas and Haemaphysalis leachi ticks, and the role of these arthropods in the transmission of Mycoplasma spp. should be further investigated. The finding of novel haemoplasma species, including one with high similarity to M. haemofelis, in this dog population, requires further investigation in light of the new canine haemoplasma species being recognised elsewhere [5Sykes JE Ball LM Bailiff NL et al.‘Candidatus Mycoplasma haematoparvum’, a novel small haemotropic mycoplasma from a dog.Int J Syst Evol Microbiol. 2005; 55: 27-30Crossref PubMed Scopus (55) Google Scholar]. The high level of Mycoplasma infection in Gabon could be responsible for an increased morbidity and mortality, when combined with stress or in the case of co-infection with other arthropod-transmitted infections. In our study, the three dogs positive for A. platys were also infected by Mycoplasma spp. Overall, the high prevalence of sub-clinical canine tick-borne bacterial infections from these two African countries indicates the circulation of these agents, more particularly Mycoplasma spp.; however, the transmission biology may differ from those described previously. The authors thank Dr Philippe Parola for his excellent cooperation. This research was supported in part by Merial SAS.

Veterinary RecordVolume 163, Issue 8 p. 253-254 Letter Canine leishmaniosis in the UK S. E. Shaw, S. E. Shaw Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this authorD. A. Langton, D. A. Langton Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this authorT. J. Hillman, T. J. Hillman Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this author S. E. Shaw, S. E. Shaw Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this authorD. A. Langton, D. A. Langton Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this authorT. J. Hillman, T. J. Hillman Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this author First published: 23 August 2008 https://doi.org/10.1136/vr.163.8.253-dRead the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat No abstract is available for this article. Volume163, Issue8August 2008Pages 253-254 RelatedInformation

Veterinary RecordVolume 163, Issue 9 p. 283-283 Letter Unusual case of canine leishmaniosis in the UK S. E. Shaw, S. E. Shaw Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this authorT. Hillman, T. Hillman Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this authorJ. Wray, J. Wray Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this author S. E. Shaw, S. E. Shaw Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this authorT. Hillman, T. Hillman Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this authorJ. Wray, J. Wray Department of Clinical Veterinary Science, University of Bristol, Langford House, Langford, North Somerset, BS40 5DUSearch for more papers by this author First published: 30 August 2008 https://doi.org/10.1136/vr.163.9.283Citations: 4Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onEmailFacebookTwitterLinkedInRedditWechat No abstract is available for this article. References Duprey Z. H. Steurer F. J. Rooney J. A. Kirchhoff L. V. Jackson J. E. Rowten E. D. Schantz P. M. (2006)Canine visceral leishmaniasis, United States and Canada, 2000-2003. Emerging Infectious Diseases 12, 440–446 Fernández-Bellon H. Solano-Gallego L. Rodríguéz-Cortés A. Ferrer L. Gallego M. Alberola J. Ramis A. (2008)Little evidence of seasonal variation of natural infection by Leishmania infantum in dogs in Spain. Veterinary Parasitology 155, 32–36 Foglia Manzillo V. Oliva G. Pagano A. Manna L. Maroli M. Gradoni L. (2006)Deltamethrin-impregnated collars for the control of canine leishmaniasis: evaluation of the protective effect and influence on the clinical outcome of Leishmania infection in kennelled stray dogs. Veterinary Parasitology 142, 142–145 Rossi E. Bongiorno G. Ciolli E. Di Muccio T. Scalone A. Gramiccia M. Gradoni L. Maroli M. (2008)Seasonal phenology, host-blood feeding preferences and natural Leishmania infection of Phlebotomus perniciosus (Diptera, Psychodidae) in a high-endemic focus of canine leishmaniasis in Rome province, Italy. Acta Tropica 105, 158–165 Citing Literature Volume163, Issue9August 2008Pages 283-283 ReferencesRelatedInformation

Veterinary RecordVolume 159, Issue 6 p. 179-180 Short Communication Fatal babesiosis in an untravelled British dog L. P. Holm BVM&S, MRCVS, L. P. Holm BVM&S, MRCVS Peter Edgar's Veterinary Surgery, Ashford, Kent, TN24 0NRSearch for more papers by this authorM. G. Kerr BVMS, BSc, PhD, CBiol, FIBiol, MRCVS, M. G. Kerr BVMS, BSc, PhD, CBiol, FIBiol, MRCVS Vetlab Services, 4 Oakhurst Business Park, Horsham, RH13 9RTSearch for more papers by this authorA. J. Trees BVM&S, PhD, DipEVPC, MRCVS, A. J. Trees BVM&S, PhD, DipEVPC, MRCVS Liverpool School of Tropical Medicine and Faculty of Veterinary Science, Liverpool, L3 5QASearch for more papers by this authorJ. W. McGarry BSc, MSc, PhD, J. W. McGarry BSc, MSc, PhD Liverpool School of Tropical Medicine and Faculty of Veterinary Science, Liverpool, L3 5QASearch for more papers by this authorE. R. Munro BVetMed, MRCVS, E. R. Munro BVetMed, MRCVS Peter Edgar's Veterinary Surgery, Ashford, Kent, TN24 0NRSearch for more papers by this authorS. E. Shaw BVSc, MSc, DipACVIM, DipECVIM, FACVSc, MRCVS, S. E. Shaw BVSc, MSc, DipACVIM, DipECVIM, FACVSc, MRCVS School of Veterinary Clinical Science, University of Bristol, Bristol, BS40 5DUSearch for more papers by this author L. P. Holm BVM&S, MRCVS, L. P. Holm BVM&S, MRCVS Peter Edgar's Veterinary Surgery, Ashford, Kent, TN24 0NRSearch for more papers by this authorM. G. Kerr BVMS, BSc, PhD, CBiol, FIBiol, MRCVS, M. G. Kerr BVMS, BSc, PhD, CBiol, FIBiol, MRCVS Vetlab Services, 4 Oakhurst Business Park, Horsham, RH13 9RTSearch for more papers by this authorA. J. Trees BVM&S, PhD, DipEVPC, MRCVS, A. J. Trees BVM&S, PhD, DipEVPC, MRCVS Liverpool School of Tropical Medicine and Faculty of Veterinary Science, Liverpool, L3 5QASearch for more papers by this authorJ. W. McGarry BSc, MSc, PhD, J. W. McGarry BSc, MSc, PhD Liverpool School of Tropical Medicine and Faculty of Veterinary Science, Liverpool, L3 5QASearch for more papers by this authorE. R. Munro BVetMed, MRCVS, E. R. Munro BVetMed, MRCVS Peter Edgar's Veterinary Surgery, Ashford, Kent, TN24 0NRSearch for more papers by this authorS. E. Shaw BVSc, MSc, DipACVIM, DipECVIM, FACVSc, MRCVS, S. E. Shaw BVSc, MSc, DipACVIM, DipECVIM, FACVSc, MRCVS School of Veterinary Clinical Science, University of Bristol, Bristol, BS40 5DUSearch for more papers by this author First published: 05 August 2006 https://doi.org/10.1136/vr.159.6.179Citations: 38AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onEmailFacebookTwitterLinkedInRedditWechat No abstract is available for this article.Citing Literature Volume159, Issue6August 2006Pages 179-180 RelatedInformation

In human atopic disease a beneficial response to immunotherapy may be associated with humeral changes in serum IgE and subclass IgG. The aim of this study was to investigate the humeral response to allergen‐specific immunotherapy (ASIT) in dogs with atopic dermatitis. Twelve dogs with clinical signs consistent with atopic dermatitis and positive intradermal test reactions to house dust mite antigens (Greer Laboratories, Lenoir NC, USA) were studied. The clinical response to ASIT (Greer) was evaluated when blood samples were collected at 0, 2 and 4 weeks; and at 3, 6 and 12 months after starting ASIT. The ASIT was administered for a minimum of 9 months. The serum concentration of total and subclass IgG antibodies was measured against Dermatophagoides farinae and Dermatophagoides pteronyssinus antigens (Greer) by ELISA using polyclonal and monoclonal antidog IgG reagents, respectively. Serum IgE was measured using a Fc‐epsilon R1 receptor alpha chain‐based ELISA. The data were analysed using a multilevel model in MLwiN software (Institute of Education, University of London, UK). Antibody concentrations of IgE and total IgG increased during the period of administration of ASIT and decreased after ASIT was stopped. There was no obvious pattern in subclass‐IgG concentrations during ASIT. Response to ASIT was excellent (four dogs), equivocal (three dogs) or poor (five dogs). During ASIT a poor or equivocal response was associated with a statistically significant increase in IgE to D. pteronyssinus antigen compared with the excellent responders. This relationship was present to a lesser extent with IgE to D. farinae and total IgG to both antigens. This study was supported, in part, by the RCVS Alison Alston Canine Award and by Heska Corporation.