Microsatellite repeat loci can provide informative markers for genetic linkage. Currently, the human chromosome 2 genetic linkage map has very few highly polymorphic markers. Being such a large chromosome, it will require a large number of informative markers for the dense coverage desired to allow disease genes to be mapped quickly and accurately. Dinucleotide repeat loci from two anonymous chromosome 2 genomic DNA clones were sequenced so that oligonucleotide primers could be designed for amplifying each locus using the polymerase chain reaction (PCR). Five sets of PCR primers were also generated from nucleotide sequences in the GenBank Database of chromosome 2 genes containing dinucleotide repeats. In addition, one PCR primer pair was made that amplifies a restriction fragment length polymorphism on the TNP1 gene (Hoth and Engel, 1991). These markers were placed on the CEPH genetic linkage map by screening the CEPH reference DNA panel with each primer set, combining these data with those of other markers previously placed on the map, and analyzing the combined data set using CRI-MAP and LINKAGE. The microsatellite loci are highly informative markers and the TNP1 locus, as expected, is only moderately informative. A map was constructed with 38 ordered loci (odds ⩾ 1000:1) spanning 296 cM (male) and 476 cM (female) of chromosome 2 compared with 306 cM (male) and 529 cM (female) for a previous map of 20 markers.

Journal Article Dinucleotide repeat polymorphisms at the D2S108 and D2S109 loci Get access S. Todd, S. Todd * Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio7703 Floyd Curl Drive, San Antonio, TX 78284, USA *To whom correspondence should be addressed Search for other works by this author on: Oxford Academic PubMed Google Scholar S. L. Naylor S. L. Naylor Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio7703 Floyd Curl Drive, San Antonio, TX 78284, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Human Molecular Genetics, Volume 2, Issue 4, April 1993, Page 490, https://doi.org/10.1093/hmg/2.4.490-a Published: 01 April 1993

Dinucleotide repeat polymorphism in the human interleukin 1, alpha gene (IL1A) S. Todd, S. Todd Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio7703 Floyd Curl Drive, San Antonio, TX 78284, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar S.L. Naylor S.L. Naylor Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio7703 Floyd Curl Drive, San Antonio, TX 78284, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Nucleic Acids Research, Volume 19, Issue 13, 11 July 1991, Page 3756, https://doi.org/10.1093/nar/19.13.3756 Published: 11 July 1991

Rapid analysis of somatic cell hybrids can be facilitated by using the polymerase chain reaction (PCR) to assay for genes assigned to specific human chromosomes. We describe PCR primer pairs for genes on the short and long arms of the 22 autosomes and the X chromosome. Some of the primers were designed from the 3′ untranslated region of cDNA sequences, whereas others were derived from genomic sequence. Each primer set was tested for its specificity and mapped to a chromosome by screening a somatic cell hybrid panel. Two of the primer pairs (APOC2 and G6PD) detect CA dinucleotide repeat polymorphisms.

Journal Article Dinucleotide repeat polymorphism in the human tubulin alpha 1 (testis specific) gene (TUBA1) Get access S. Todd, S. Todd Department of Cellular and Structural Biology The University of Texas Health Science Center at San Antonio7703 Floyd Curl Drive, San Antonio, TX 78284, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar S.L. Naylor S.L. Naylor Department of Cellular and Structural Biology The University of Texas Health Science Center at San Antonio7703 Floyd Curl Drive, San Antonio, TX 78284, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Nucleic Acids Research, Volume 19, Issue 13, 11 July 1991, Page 3755, https://doi.org/10.1093/nar/19.13.3755 Published: 11 July 1991

An (AC)n repeat sequence is located at position 7,695 of the human interleukin 1 alpha (ILIA) gene on chromosome 2qI2-q21 (1).PCR primers have been designed (IL1AAC1 5'GCCTAGTGAGTGTGGAAGACATTG3 ',

A cDNA clone of the argininosuccinate lyase gene (ASL) was isolated from an adult human liver library by probing with synthetic oligonucleotide probes. This clone and a yeast genomic DNA fragment containing the ASL gene were sequenced using the M13-dideoxynucleotide method. Comparison of the yeast and human clones at the nucleotide and putative amino acid sequence levels indicated identities of 50 and 54%, respectively. The most conserved region of the yeast gene was used to detect human clones in the liver cDNA library to test phylogenetic screening capabilities of conserved genes. ASL was mapped to human chromosome 7pter----q22 using human-mouse somatic cell hybrid DNA and further mapped by in situ hybridization to chromosome 7cen----q11.2 on human metaphase chromosomes. The probe also detected a sequence on chromosome 22. Somatic cell hybrid DNA digested with PvuII revealed a mouse polymorphism between Balb/c and C3H mice in the ASL gene.

Thyrotropin (TSH) is composed of two subunits: α and β. Previously, we have mapped the TSHα gene to human chromosome 6 and mouse chromosome 4. In this study we have located the human TSHβ gene on chromosome 1 and the mouse TSHβ gene to chromosome 3. These data suggest that the TSHβ gene lies in a conserved linkage group with the genes for amylase 1 and 2, nerve growth factor, and the protooncogene Nras.

Insulin, parathyroid hormone, and calcitonin are polypeptide hormones that regulate important physiological processes in target tissues. Rat genes encoding each hormone were chromosomally assigned to rat chromosome 1. Both rats and mice have two insulin genes (I and II). However, in contrast to mice in which insulin I and II are asyntenic, rat insulin I and II were both localized to chromosome 1. This study identifies a conserved syntenic group on rat chromosome 1, and implies that mouse insulin I and II genes were chromosomally separated after rats and mice diverged 20–35 million years ago.