Dear Editor, African spiny mouse,Acomys dimidiatus,is a mamma-lian model for regeneration studies because of its abil-ity to functionally regenerate several tissues.As limited regenerative abilities in mammals are viewed as an antitumor strategy,it is intriguing how Acomys balances regeneration and tumor suppression.

Mammalian genomes are organized by multi-level folding; yet how this organization contributes to cell-type-specific transcription remains unclear. SATB1 forms a nuclear substructure that resists high-salt extraction. SATB1 binds base-unpairing regions (BURs), genomic elements with high unwinding propensities. In mouse thymocytes, we found that SATB1 establishes a two-tiered chromatin organization: one through indirect binding to transcriptionally active DNase 1-accessible chromatin and another by direct binding to BURs in the DNase 1-inaccessible nuclear substructure. Recently published ChIP-seq datasets show SATB1 binding to accessible chromatin at enhancers and CTCF sites, but not to BURs. By employing urea ChIP-seq, which retains only directly bound protein:DNA complexes, we found that BURs, but not CTCF sites, are direct SATB1 binding targets genome-wide. BURs bound to the SATB1 nuclear substructure interact with accessible chromatin, crossing multiple topologically associated domains (TADs). SATB1 is required for these megabase-scale interactions linked to cell-type-specific gene expression. BURs are highly enriched within transcriptionally repressive lamina-associated domains (LADs). Besides these BURs, SATB1 anchors some BURs (18%) outside LADs near genes in otherwise accessible chromatin to the SATB1 nuclear substructure. Only a subset of total BURs is bound to SATB1, depending on cell type. Notably, despite the mutually exclusive SATB1-binding profiles uncovered by the two ChIP-seq methods, we found most peaks in both profiles are valid and require SATB1. Based on these and previous data, we propose that the SATB1 protein network forms a chromatin scaffold, providing an interface that connects accessible chromatin to a subnuclear architectural structure, thereby facilitating the three-dimensional organization linked to cell-type-specific gene expression.

Execution of lineage-specific differentiation programs requires tight coordination between many regulators including Ten-eleven translocation (TET) family enzymes, catalyzing 5-methylcytosine oxidation in DNA. Here, by using Keratin 14-Cre-driven ablation of Tet genes in skin epithelial cells, we demonstrate that ablation of Tet2/Tet3 results in marked alterations of hair shape and length followed by hair loss. We show that, through DNA demethylation, Tet2/Tet3 control chromatin accessibility and Dlx3 binding and promoter activity of the Krt25 and Krt28 genes regulating hair shape, as well as regulate interactions between the Krt28 gene promoter and distal enhancer. Moreover, Tet2/Tet3 also control three-dimensional chromatin topology in Keratin type I/II gene loci via DNA methylation-independent mechanisms. These data demonstrate the essential roles for Tet2/3 in establishment of lineage-specific gene expression program and control of Dlx3/Krt25/Krt28 axis in hair follicle epithelial cells and implicate modulation of DNA methylation as a novel approach for hair growth control.

ABSTRACT Enzymatic pockets such as those of histone deacetylases (HDACs) are among the most favored targets for drug development. However, enzymatic inhibitors often exhibit low selectivity and high toxicity due to targeting multiple enzyme paralogs, which are often involved in distinct multisubunit complexes. Here, we report the discovery and characterization of a non-enzymatic small molecule inhibitor of HDAC transcriptional repression functions with comparable anti-tumor activity to the enzymatic HDAC inhibitor Vorinostat, and anti-psychedelic activity of an HDAC2 knockout in vivo . We highlight that these phenotypes are achieved while modulating the expression of 20- and 80-fold fewer genes than enzymatic and genetic inhibition in the respective models. Thus, by achieving the same biological outcomes as established therapeutics while impacting a dramatically smaller number of genes, inhibitors of protein-protein interactions can offer important advantages in improving the selectivity of epigenetic modulators. GRAPHICAL ABSTRACT

Mammalian genomes are organized by multi-layered chromatin folding. Whether and how three-dimensional genome organization contributes to cell-type specific transcription remains unclear. Here we uncover genome architecture formed by specialized sequences, base-unpairing regions (BURs), bound to a nuclear architectural protein, SATB1. SATB1 regulates cell-type specific transcription that underlies changes in cellular phenotypes. We developed a modified ChIP-seq protocol that stringently purifies genomic DNA only with its directly-associated proteins and unmasked previously-hidden BURs as direct SATB1 targets genome-wide. These SATB1-bound BURs are mutually exclusive from CTCF binding sites, and SATB1 is dispensable for CTCF/cohesion-mediated topologically associated domains (TADs). Instead, BURs largely overlap with lamina associated domains (LADs), and the fraction of BURs tethered to the SATB1 protein network in the nuclear interior is cell type-dependent. Our results reveal TAD-independent chromatin folding mediated by BUR sequences which serve as genome architecture landmarks for direct targeting by cell type-specific gene regulator, SATB1. One-Sentence Summary Genome-wide chromatin folding by direct tethering of base-unpairing regions to SATB1 nuclear architecture is unveiled.

Histone deacetylases (HDACs) induce gene repression and modify the activity of nonhistone proteins. In a new article in the Journal of Investigative Dermatology, Zhu et al. (2021) demonstrate essential roles for HDAC1/2 in maintaining keratinocyte proliferation and survival in adult epidermis and basal cell carcinoma, thus providing a rationale for using HDAC inhibitors for the treatment of hyperproliferative and neoplastic skin disorders.

DNA methylation and subsequent oxidation of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC) catalyzed by the TET family enzymes are key epigenetic events regulating development, stem cell differentiation and cellular reprogramming in mammals, while genetic ablation of all three Tet genes is embryonic lethal. Here, we show that 5hmC level and Tet1/2/3 expression display dynamic changes in the developing hair follicles (HFs), as well as during the hair cycle. High level of 5hmC and high expression ofTet2 and Tet3 were seen in hair matrix keratinocytes (KCs) and hair shaft. To explore the role of Tet1/2/3 in the control of HF development and cycling, we used genetically engineered mice with Shh-Cre mediated ablation of all three Tet genes (Shh-Cre/ Tet1 fl/fl/Tet2 fl/fl/Tet3 fl/fl ) conditional triple knockout (TKO) model. Consistent with the expression pattern of Shh gene, Cre expression was seen in the HF placodes, as well as in a cluster of hair matrix KCs whose progenies form the hair shaft. Shh-Cre mediated Tet triple knockout resulted in a significant decrease in the hair shaft length in all bended hair types (auchen, zig-zag), as well as an increase in the number of straight (guard, awl) hairs compared to controls. These differences were accompanied by a marked decrease of Bmpr1a/1b in the differentiating hair shaft KCs from TKO mice, as well as by the decreased pSmad1 expression. Furthermore, hMeDIP-seq analyses of primary mouse KCs revealed 5hmC peaks at the Bmpr1b gene promoter, as well as at several enhancers located in close vicinity to the Bmpr1a/2 genes and depicted by H3K27ac/H3K4me1 ChIPseq analyses. These data demonstrate the role of Tet-mediated DNA hydroxymethylation controlling hair shaft-specific KC differentiation and hair shaft formation, as well as regulating transcription of Bmpr1a/1b/2 and activity of the enhancers adjacent to these genes in KCs.

Aging is a complex process characterized by progressive decline in physiological and biochemical performance of individual tissues and organs. In aged skin, reduced cell proliferation and functional decline of epithelial and mesenchymal cells underlie age-related changes, such as dry skin (xerosis), loss of elasticity, and functional senescence, leading to increased susceptibility to aging-associated conditions such as skin cancer and poor wound healing (Engelke et al., 1997Engelke M. Jensen J.M. Ekanayake-Mudiyanselage S. Proksch E. Effects of xerosis and ageing on epidermal proliferation and differentiation.Br J Dermatol. 1997; 137: 219-225Crossref PubMed Scopus (123) Google Scholar, Zhang et al., 2009Zhang M. Poplawski M. Yen K. Cheng H. Bloss E. Zhu X. et al.Role of CBP and SATB-1 in aging, dietary restriction, and insulin-like signaling.PLOS Biol. 2009; 7: e1000245Crossref PubMed Scopus (79) Google Scholar). MicroRNAs (miRNAs) are small noncoding RNAs involved in the post-transcriptional regulation of coding-gene expression. They provide an additional level of control for important cellular processes such as growth, differentiation, and remodeling of skin (Botchkareva, 2017Botchkareva N.V. The molecular revolution in cutaneous biology: noncoding RNAs: new molecular players in dermatology and cutaneous biology.J Invest Dermatol. 2017; 137: e105-e111Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). In addition, miRNAs can regulate the expression of important epigenetic regulators, including DNA methyltransferases, histone deacetylases, and polycomb group genes. Disruption of the miRNA-epigenetic regulatory network was shown to interfere with normal physiological cellular functions, leading to activation of disease processes (reviewed in [Sato et al., 2011Sato F. Tsuchiya S. Meltzer S.J. Shimizu K. MicroRNAs and epigenetics.FEBS Journal. 2011; 278: 1598-1609Crossref PubMed Scopus (480) Google Scholar]). By fine-tuning biological systems, miRNAs can contribute to healthy aging or development of age-related diseases, and may serve as useful diagnostic or prognostic biomarkers for age-related diseases (Olivieri et al., 2012Olivieri F. Spazzafumo L. Santini G. Lazzarini R. Albertini M.C. Rippo M.R. et al.Age-related differences in the expression of circulating microRNAs: miR-21 as a new circulating marker of inflammaging.Mech Ageing Dev. 2012; 133: 675-685Crossref PubMed Scopus (183) Google Scholar). MicroRNA-21 (miR-21) plays an important role in the development of a number of pathological skin conditions including psoriasis, tumorigenesis, and poor wound-healing (Ahmed et al., 2011Ahmed M.I. Mardaryev A.N. Lewis C.J. Sharov A.A. Botchkareva N.V. MicroRNA-21 is an important downstream component of BMP signalling in epidermal keratinocytes.J Cell Sci. 2011; 124: 3399-3404Crossref PubMed Scopus (59) Google Scholar, Meisgen et al., 2012Meisgen F. Xu N. Wei T. Janson P.C. Obad S. Broom O. et al.MiR-21 is up-regulated in psoriasis and suppresses T cell apoptosis.Exp Dermatol. 2012; 21: 312-314Crossref PubMed Scopus (127) Google Scholar, Yang et al., 2011Yang X. Wang J. Guo S.L. Fan K.J. Li J. Wang Y.L. et al.miR-21 promotes keratinocyte migration and re-epithelialization during wound healing.Int J Biol Sci. 2011; 7: 685-690Crossref PubMed Scopus (131) Google Scholar). However, the role of miR-21 in skin aging has not been investigated yet. Here, we identify miR-21 as a contributor to skin aging, at least in part, by negative regulation of the chromatin remodeler SATB1 in keratinocytes. The expression of miR-21 was examined in skin of young and aged mice (8-week-old vs 2-year-old) and human female donors (48, 60–62, and 78 years old; Supplementary Materials and Methods). Quantitative reverse transcriptase–PCR (RT-qPCR) analysis revealed a prominent increase in miR-21 expression in both mouse and human aged skin (Figure 1a and b). In contrast to miR-21, the level of miRNA-199a, which is not detectable in the epidermis of either mouse or human skin, was used as a control for this study (Sonkoly et al., 2007Sonkoly E. Wei T. Janson P.C.J. Sääf A. Lundeberg L. Tengvall-Linder M. et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?.PLOS ONE. 2007; 2: e610Crossref PubMed Scopus (628) Google Scholar, Yi et al., 2006Yi R. O'Carroll D. Pasolli H.A. Zhang Z. Dietrich F.S. Tarakhovsky A. et al.Morphogenesis in skin is governed by discrete sets of differentially expressed microRNAs.Nat Genet. 2006; 38: 356-362Crossref PubMed Scopus (452) Google Scholar) and was not altered during the aging process in human skin (Figure 1b). Using in situ hybridization, we confirmed increased miR-21 expression in the epidermis and dermis of aged mouse and human skin (Figure 1c and d). Our data are consistent with published reports showing the elevation of miR-21 in age-associated cardiovascular diseases in human patients (Olivieri et al., 2012Olivieri F. Spazzafumo L. Santini G. Lazzarini R. Albertini M.C. Rippo M.R. et al.Age-related differences in the expression of circulating microRNAs: miR-21 as a new circulating marker of inflammaging.Mech Ageing Dev. 2012; 133: 675-685Crossref PubMed Scopus (183) Google Scholar) and in kidneys of aged mice (Sataranatarajan et al., 2012Sataranatarajan K. Feliers D. Mariappan M.M. Lee H.J. Lee M.J. Day R.T. et al.Molecular events in matrix protein metabolism in the aging kidney.Aging Cell. 2012; 11: 1065-1073Crossref PubMed Scopus (34) Google Scholar).Figure 1MiR-21 is elevated in aging skin and targets SATB1 in keratinocytes. (a, b) RT-qPCR analysis of miR-21 expression in young vs aged mice (8-week-old vs. 2-year-old) and human female donor skins (F48, F60–62, F78); miR-21 expression is upregulated in aged mouse and human epidermis. Data are presented as mean ± SEM values from three (mouse) or two (human) independent samples and three independent experiments each. (c, d) Representative photomicrographs of in situ hybridization for miR-21; miR-21 expression is elevated in the epidermis (arrowheads) and dermis of aged mouse and human skins. Data are presented from three (mouse) and two (human) independent samples. (e) RT-qPCR analysis of differentiation-related genes in young versus aged mice; a decrease in expression is observed for all genes analyzed. Data are presented as mean ± SEM values from three independent samples and experiments. (f) RT-qPCR analysis in young versus aged human skin; a decrease in expression is observed for all differentiation-associated genes analyzed. Data are presented as mean ± SEM values from two independent samples and three independent experiments. (g, h) Transfection with pro-miR-21 mimic in primary mouse and human keratinocytes causes a significant decrease in the expression of Krt1 and Ivl (mouse) and KRT1, KRT10, KRT14, and IVL (human). Data is presented as mean ± SEM values from three independent experiments. (i) Venn diagram of predicted miR-21 gene targets. A table showing the top ten miR-21 target genes listed as the most conserved between human and mouse genomes, including SATB1. (j) Significant reduction in luciferase activity in HaCaT cells cotransfected with pro-miR-21 mimic and the SATB1-3′ UTR (wt-3′UTR) construct encompassing the putative miR-21 target site. No changes in luciferase activity were detected when the miRNA binding site was mutated (mut-3′UTR). Bold letters represent miR-21 seed region. Underlined letters represent predicted binding sites within SATB1-3'UTR. Each sample was normalized to Renilla luciferase activity. Data is presented as mean ± SEM values from three independent experiments. (k–n) RT-qPCR and western blot analysis; SATB1 mRNA and protein levels are significantly decreased and increased after transfection with pro-miR-21 or anti-miR-21, respectively, in both primary mouse and human keratinocytes. Data are presented as mean ± SEM values from three independent experiments. Western blot data shown are from a single representative experiment out of three repeats. *P < 0.05, **P < 0.01, ***P < 0.001; Student's t-test. The broken lines demarcate the epidermal–dermal border. miR-199a, microRNA-199a; miR-21, microRNA-21; mut, mutated; RT-qPCR, quantitative reverse transcriptase–PCR; SEM, standard error of the mean; UTR, untranslated region; wt, wild type. Bar = 50μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Human skin aging is associated with a decrease in the expression of keratinocyte differentiation-associated markers (Engelke et al., 1997Engelke M. Jensen J.M. Ekanayake-Mudiyanselage S. Proksch E. Effects of xerosis and ageing on epidermal proliferation and differentiation.Br J Dermatol. 1997; 137: 219-225Crossref PubMed Scopus (123) Google Scholar). Indeed, a significant reduction in the expression of keratinocyte differentiation-related genes was observed in aged mouse (P < 0.05) and human skin (Figure 1e and f). Forced expression of miR-21 in both primary mouse and human keratinocytes transfected with pro-miR-21 mimic resulted in significant reduction in Krt1 and Ivl (P < 0.05, mouse) and KRT1 (P < 0.01), KRT10, KRT14, and IVL expressions (P < 0.05, human) (Figure 1g and h). This suggests that miR-21 potentially can contribute to skin aging by downregulating keratinocyte differentiation-related genes, possibly leading to cellular senescence (Dellago et al., 2013Dellago H. Preschitz-Kammerhofer B. Terlecki-Zaniewicz L. Schreiner C. Fortschegger K. Chang M.W.F. et al.High levels of oncomiR-21 contribute to the senescence-induced growth arrest in normal human cells and its knock-down increases the replicative lifespan.Aging Cell. 2013; 12: 446-458Crossref PubMed Scopus (88) Google Scholar) and contributing to increased susceptibility to age-related pathological conditions. To identify potential putative miR-21 targets, we performed bioinformatics analysis as done previously (Ahmed et al., 2014Ahmed M.I. Alam M. Emelianov V.U. Poterlowicz K. Patel A. Sharov A.A. et al.MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway.J Cell Biol. 2014; 207: 549-567Crossref PubMed Scopus (49) Google Scholar). By interrogating predicted miR-21 targets from three different databases, we identified 35 potential genes whose expression may be regulated by miR-21. Ten of these genes, including Satb1, have highly conserved miR-21 target sequences between human and mouse genomes (Figure 1i). SATB1 is a nuclear protein operating as a genome organizer, which originally was identified as an essential mediator of normal T-cell development regulating the large-scale chromatin remodeling and enhancer–promoter interactions in several lineage-specific gene loci (Cai et al., 2003Cai S. Han H.J. Kohwi-Shigematsu T. Tissue-specific nuclear architecture and gene expression regulated by SATB1.Nat Genet. 2003; 34: 42-51Crossref PubMed Scopus (345) Google Scholar). In the skin, SATB1 is essential for higher-order chromatin folding and transcriptional regulation of the epidermal differentiation complex locus in keratinocytes (Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar). Interestingly, genetic ablation of Satb1 in mouse skin causes thinning of the epidermis accompanied by downregulation in the expression of terminal differentiation-associated genes (Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar). We confirmed the direct regulation of Satb1 by miR-21 using a luciferase reporter assay. Cotransfection of HaCaT cells with pro-miR-21 mimic and the Satb1 3′ untranslated region reporter construct caused a significant reduction in luciferase activity (P < 0.001) compared with their corresponding controls, whereas this effect was not detected when miR-21 binding sites in the Satb1 3′ untranslated region were mutated (Figure 1j). This is consistent with published data showing miR-21 targeting of SATB1 in rectal cancer cells (Lopes-Ramos et al., 2014Lopes-Ramos C.M. Habr-Gama A. Quevedo Bde S. Felício N.M. Bettoni F. Koyama F.C. et al.Overexpression of miR-21-5p as a predictive marker for complete tumor regression to neoadjuvant chemoradiotherapy in rectal cancer patients.BMC Med Genomics. 2014; 7: 68Crossref PubMed Scopus (65) Google Scholar). The functional interactions of miR-21 and SATB1 in keratinocytes were evaluated by transfecting primary human and mouse epidermal keratinocytes with pro-miR-21 mimic and anti-miR-21, which resulted in the decreased and increased expression of SATB1 mRNA and protein, respectively, as determined by RT-qPCR and western blot (Figure 1k–n, Supplementary Materials and Methods). Additionally, reduced Satb1 expression was confirmed by RT-qPCR and immunofluorescent analysis in both mouse and human aged epidermis (Figure 2a–d). To further explore the plausible functional link between miR-21 and SATB1 in skin aging, we overexpressed SATB1 and miR-21 in keratinocytes using SATB1-expressing lentiviral particles or pro-miR-21 mimic. We confirmed the increased expression of Satb1 (SATB1 Leti + miR-Control) or miR-21 (Control Leti + pro-miR-21) in primary mouse epidermal keratinocytes as determined by RT-qPCR (Figure 2e and f, Supplementary Materials and Methods). However, coexpression of both SATB1 and miR-21 (SATB1 Leti + pro-miR-21) significantly reduced SATB1 expression (Figure 2e). RT-qPCR analysis also revealed that Satb1 induces expression of differentiation-associated genes, supporting its role as a promoter of terminal keratinocyte differentiation (Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar). Forced expression of miR-21 abolished SATB1-induced upregulation of Krt1, Krt10, and Krt17 (Figure 2g). Therefore, our data suggest that miR-21 contributes to the age-associated alterations in gene expression, at least in part, by targeting Satb1. The downregulation of SATB1 in human keratinocytes by miRNA-191 has been shown to establish epigenetic modifications leading to senescence (Lena et al., 2012Lena A.M. Mancini M. Rivetti di Val Cervo P. Saintigny G. Mahé C. Melino G. et al.MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation.Biochem Biophys Res Commun. 2012; 423: 509-514Crossref PubMed Scopus (49) Google Scholar). SATB1 has also been associated with increased lifespan, whereas a reduction in its expression was seen with age and in age-related pathologies, such as diabetes in mice, demonstrating the general involvement of SATB1 in counteracting the senescence and/or aging pathways (Zhang et al., 2009Zhang M. Poplawski M. Yen K. Cheng H. Bloss E. Zhu X. et al.Role of CBP and SATB-1 in aging, dietary restriction, and insulin-like signaling.PLOS Biol. 2009; 7: e1000245Crossref PubMed Scopus (79) Google Scholar). An increasing number of studies have identified miR-21 as a senescence, inflammation, and cancer-associated miRNA (Olivieri et al., 2013Olivieri F. Rippo M.R. Procopio A.D. Fazioli F. Circulating inflamma-miRs in aging and age-related diseases.Front Genet. 2013; 4: 121Crossref PubMed Scopus (145) Google Scholar). Therefore, our data suggest that the negative regulation of SATB1 by miR-21 in keratinocytes may be an important age-phase–specific regulation leading to senescence and promoting disease states in skin. Taken together, we demonstrate that (i) miR-21 expression is increased in human and mouse aging skin; (ii) SATB1 expression is inversely correlated with miR-21 in young and aged skin; and (iii) Satb1 serves as a genuine direct target of miR-21 in keratinocytes. Thus, by regulating SATB1 in epidermal keratinocytes, miR-21 may contribute to the higher-order chromatin remodeling and establishment of enhancer–promoter networks involved in epidermal differentiation, as well as increase susceptibility to age-related pathological conditions, such as tumorigenesis. These data provide a platform for the establishment of novel approaches for pharmacological manipulation of skin aging via modulation of the miR-21 activity in keratinocytes. Mohammed I. Ahmed: http://orcid.org/0000-0002-9051-7681 Maximilian E. Pickup: http://orcid.org/0000-0002-6006-2540 Alexander G. Rimmer: http://orcid.org/0000-0002-3038-9948 Majid Alam: http://orcid.org/0000-0002-5783-6605 Andrei N. Mardaryev: http://orcid.org/0000-0002-7826-5506 Krzysztof Poterlowicz: http://orcid.org/0000-0001-6173-5674 Natalia V. Botchkareva: http://orcid.org/0000-0002-5202-6822 Vladimir A. Botchkarev: http://orcid.org/0000-0002-9119-0895 The authors state no conflict of interest. This work was supported by funding from Nottingham Trent University, United Kingdom, UoA03 QR and Capital Funds (MIA), as well as by the grant from Amway, USA to VAB and NVB. Conceptualization: MIA, NVB, VAB; Data Curation: MIA, AGR, KP, MAA, MEP, ANM, NVB, VAB; Formal Analysis: MIA, AGR, KP, MAA, MEP, ANM, NVB, VAB; Funding Acquisition: MIA, VAB, NVB; Investigation: MIA, AGR, KP, MAA, MEP, ANM, NVB, VAB; Supervision: MIA, NVB, VAB; Writing - Original Draft Preparation: MIA, NVB, VAB. Animal studies were performed in accordance with protocols approved by the UK Home Office Project License. C57Bl/6 mice were purchased from Charles River Laboratories. Skin samples were collected at 8 weeks (young sample) and 2 years old (aged samples) and snap frozen in liquid nitrogen for histological and RNA analysis. Human skin was obtained from healthy donors (42–78 years old) undergoing face-lift and abdominoplasty surgery. Donor age and sites of tissue biopsies can be seen in Supplementary Table S1. Tissue was obtained with full written consent adhering to the Declaration of Helsinki principles, following ethical and institutional approval under human tissue act guidelines. Quantitative reverse transcriptase–PCR total RNA was isolated using the miRNeasy Kit (Qiagen, Hilden, Germany). For detection of the mature form of microRNA-21 (miR-21) TaqMan, quantitative reverse transcriptase–PCR was performed using TaqMan Real Time PCR Assay (Applied Biosystems, Foster City, CA) under the following cycling conditions: 95 °C for 10 minutes, followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 60 seconds. Differences between samples and controls were calculated based on the Ct (ΔΔCt) method and normalized to the U6 values. Data from triplicates were pooled, mean ± standard error of the mean was calculated, and statistical analysis was performed using unpaired Student's t-test. For detection of Satb1 and epidermal differentiation genes, 1 μg of total RNA was converted into cDNA using the qPCRBIO cDNA Synthesis Kit system (PCR Biosystems, London, United Kingdom). Gene expression was performed on QuantStudio5 Real Time PCR System (Life Technologies, Carlsbad, CA) using qPCRBIO SyGreen mix (PCR Biosystems). PCR primers were designed with Beacon Designer software (PREMIER Biosoft International, Palo Alto, CA; Supplementary Table S2). Amplification was performed at the following conditions: 95 °C for 5 minutes, followed by 40 cycles of denaturation (95 °C for 15 seconds), annealing (30 seconds at temperature experimentally determined for each primer pairs), and elongation (72 °C for 15 seconds). Differences between samples and controls were calculated based on the Ct (ΔΔCt) method and normalized to mouse (Actb) or human ACTB (actin). Data from triplicates were pooled, mean ± standard error of the mean was calculated, and statistical analysis was performed using unpaired Student's t-test. Skin cryosections (10 μm) were fixed in 4% paraformaldehyde for 10 minutes at room temperature. Tissues sections were acetylated in triethanolamine buffer (4.5 mM triethanolamine, 6 M NCl, and 3 mM acetic anhydride) for 10 minutes and permeabilized (1% Triton X-100/1x diethyl pyrocarbonate–treated phosphate buffered saline) for 30 minutes; slides were hybridized with 2.5 pmol double DIG-labelled miR-21 (Exiqon, Copenhagen, Denmark) and diluted in hybridization buffer (50% formamide DI, 2x saline sodium citrate, 1% dextran sulfate, and 0.4 mg/ml transfer RNA) for 16–18 hours at 60 °C overnight. Slides subsequently were washed in 2x saline sodium citrate (10 minutes, 4 times, 65 °C), 0.1x saline sodium citrate (60 minutes, 65 °C), and 0.2x saline sodium citrate (10 minutes, room temperature). Immunodetection of miR-21 was performed with sheep alkaline phosphatase–conjugated anti-DIG antibody (1:2500, Life Technologies) followed by a staining reaction with BM Purple solution (Life Technologies). Skin cryosections (10 μm) were fixed in 4% paraformaldehyde for 10 minutes at room temperature and were stained overnight with rabbit Satb1 (Abcam, Cambridge, United Kingdom; 1:200, ab49061), followed by application of corresponding donkey anti-rabbit Alexa-555 antibody (Life Technologies, 1:200) for 45 minutes at room temperature. Incubation steps were interspersed by washes with phosphate buffered saline. Sections were counter stained with DAPI. Primary human epidermal keratinocytes were isolated as previously described (Aunin et al., 2017Aunin E. Broadley D. Ahmed M.I. Mardaryev A.N. Botchkareva N.V. Exploring a Role for Regulatory miRNAs in Wound Healing during Ageing: involvement of miR-200c in wound repair.Sci Rep. 2017; 7: 3257Crossref PubMed Scopus (33) Google Scholar) and grown in keratinocyte media 2 (PromoCell, Heidelberg, Germany), containing 0.06 mM CaCl2, epidermal growth factor (0.125 ng/ml), and bovine pituitary extract (40 μg/ml). Primary mouse epidermal keratinocytes were prepared from newborn mice at postnatal days 2–3, as described previously (Ahmed et al., 2014Ahmed M.I. Alam M. Emelianov V.U. Poterlowicz K. Patel A. Sharov A.A. et al.MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway.J Cell Biol. 2014; 207: 549-567Crossref PubMed Scopus (49) Google Scholar). Primary mouse epidermal keratinocytes were grown in EMEM calcium-free medium (Lonza, Basel, Switzerland) supplemented with 0.05 mM calcium, at 33 °C, 8% CO2 (Scientific Laboratory Suppliers, Nottingham, United Kingdom) until 60–70% confluent. Human and mouse keratinocytes were transfected with 200 nM of pro-miR-21 mimic, anti-miR-21, and corresponding miR-controls (Dharmacon, Lafayette, CO) using Lipofectamine RNAiMAX (Life Technologies) as published previously (Ahmed et al., 2011Ahmed M.I. Mardaryev A.N. Lewis C.J. Sharov A.A. Botchkareva N.V. MicroRNA-21 is an important downstream component of BMP signalling in epidermal keratinocytes.J Cell Sci. 2011; 124: 3399-3404Crossref PubMed Scopus (59) Google Scholar). Cells were harvested 24 hours (pro-miR-21) and 48 hours (anti-miR-21) after transfection and used for further analyses. Proteins were extracted from cultured cells using RIPA lysis buffer (50 mm Tris-HCl, 1% NP-40, 0.25% sodium deoxycholate, 150 mm NaCl, and 1 mm EDTA; pH 7.4) and cOmplete ULTRA Protease Inhibitor Cocktail (Sigma-Aldrich, St. Louis, MO), as described previously (Ahmed et al., 2014Ahmed M.I. Alam M. Emelianov V.U. Poterlowicz K. Patel A. Sharov A.A. et al.MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway.J Cell Biol. 2014; 207: 549-567Crossref PubMed Scopus (49) Google Scholar). In brief, 10–20 micrograms of protein were processed for western blot analysis, followed by membrane incubation with primary antibody against SATB1 (Abcam; ab49061, 1:1,000), glucose-6-phosphate dehydrogenase (Abcam; ab8245, 1:10,000), or tubulin (Abcam; ab7291, 1:20,000) overnight at 4 °C. Horseradish peroxidase–tagged IgG antibodies were used as secondary antibodies (Thermo Fisher Scientific, Waltham, MA; 1:5,000). Antibody binding was visualized with an enhanced chemiluminescence's system (SuperSignal West Pico Kit, Thermo Fisher Scientific) and autoradiographed with X-ray film (CL-Xposure Film, Thermo Fisher Scientific) or iBright Gel-Doc Imager (Thermo Fisher Scientific). Possible miR-21 target genes were estimated as a consensus from the following three different prediction algorithms: TargetScan (http://www.targetscan.org/) predicts biological targets of microRNAs by searching for the presence of conserved sites that match the seed region of each microRNA, miRanda (http://microrna.sanger.ac.uk) uses an algorithm to predict microRNA–mRNA pairs, and PicTar (http://genie.weizmann.ac.il/pubs/mir07/mir07_data.html) confirms candidates predicted by the other two algorithms. HaCaT cells were grown in DMEM (Life Technologies) supplemented with heat-inactivated 10% fetal bovine serum in an atmosphere of 5% CO2 at 37 °C, until 60–70% confluent as described previously (Ahmed et al., 2014). 3′ UTR fragments of Satb1 containing miR-21 putative target sites were amplified from mouse genomic DNA using forward and reverse primers containing XhoI and NotI restriction sequences, respectively. For 3′ UTR of Satb1 fragment, 5′- CTCCTGCAGCATCATGTCAT -3′ and 5′- ACCACTCCTAATCAGCACATTTC -3′ forward and reverse primers, respectively, were used. Site-directed mutagenesis was performed using a QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA) to mutate the Satb1 binding site according to the manufacturer's instructions. For the dual luciferase assay, these constructs (200 ng) were cotransfected with 200 nM pro-miR-21 mimic or negative control mimic (Life Technologies) into HaCaT cells using 0.5 μl Lipofectamine 2000 (Life Technologies) in 96-well plates. At 24 hours after transfection, the relative luciferase activities were determined using Dual-Glo Luciferase Assay System (Promega, Madison, WI). The assay was performed in triplicate for three independent trials. For production of control and Satb1-expressing lentiviruses, HEK293T cells were cotransfected with control plasmid (Genecopoeia, Rockville, MD) and pEZ-Lv215-Satb1-eGFP (Genecopoeia, LPP-Mm19720-Lv215) and helper plasmids (pTAT, pREV, pHagp2[GAG/Pol], and pVSV-G) using Lenti-Pac HIV Expression Packaging Kit (Genecopoeia, HPK-LvTR) as per the manufacturer's protocol. Cell culture medium containing viruses was collected 24 hours, 48 hours, and 72 hours after transfection, followed by precipitation of the viral particles using PEG-it Virus Precipitation Solution (System Biosciences) as per the manufacturer's protocol. Primary mouse epidermal keratinocytes were infected with Satb1 and corresponding control lentiviral particles in combination with 10 μg/ml polybrene (Sigma-Aldrich) for 48 hours. To examine the regulatory effects of miR-21 on Satb1-induced gene expression, keratinocytes were transfected with 200 nM synthetic pro-miR-21 mimic or microRNA negative controls for 4 hours (post–48-hour lentiviral treatments). All experiment groups were collected for quantitative reverse transcriptase–PCR analysis 24 hours after pro-miR-21 mimic treatment. Download .xlsx (.01 MB) Help with xlsx files Supplementary Tables 1 and 2

Increased evidence suggests that alterations in chromatin structure result in aberrant pro-inflammatory cytokines expression that leads to prolonged inflammatory responses. CCCTC-binding factor (CTCF) is a transcriptional repressor that insulates the expression of neighbouring genes and is involved in chromatin interactions between distal and proximal gene regulatory elements. However, the role of CTCF in the control of pro-inflammatory cytokines expression in the skin cells remains unknown. Here, we show that CTCF is expressed in the nuclei of normal human epidermal keratinocytes (NHEK) and dermal fibroblasts (DF), while its siRNA-mediated deficiency induces cell-type specific changes in pro-inflammatory gene expression. Knockdown of CTCF using siRNAs leads to significant reductions in the transcription of a number of pro-inflammatory genes (TNF, IL1B, IL12B, IL17A, IL19, IL23A, IL36A, CXCL8) in NHEK. In contrast, transcript levels of these genes were markedly up-regulated in CTCF-depleted DF. Furthermore, TNF-alpha treatment causes a more profound inhibitory effect on the CTCF expression in DF compared to NHEK. Finally, we show that CTCF is down-regulated in primary psoriatic fibroblasts compared to DF, while CTCF expression was not affected in psoriatic keratinocytes. Taken together, these data suggest that the chromatin architectural protein CTCF is involved in cell-type specific regulation of pro-inflammatory genes in the skin cells, which suggests its involvement in pathogenesis of inflammatory skin diseases such as psoriasis.

Increased evidence suggests that alterations in chromatin structure result in aberrant pro-inflammatory cytokines expression that leads to prolonged inflammatory responses. CCCTC-binding factor (CTCF) is a transcriptional repressor that insulates the expression of neighbouring genes and is involved in chromatin interactions between distal and proximal gene regulatory elements. However, the role of CTCF in the control of pro-inflammatory cytokines expression in the skin cells remains unknown. Here, we show that CTCF is expressed in the nuclei of normal human epidermal keratinocytes (NHEK) and dermal fibroblasts (DF), while its siRNA-mediated deficiency induces cell-type specific changes in pro-inflammatory gene expression. Knockdown of CTCF using siRNAs leads to significant reductions in the transcription of a number of pro-inflammatory genes (TNF, IL1B, IL12B, IL17A, IL19, IL23A, IL36A, CXCL8) in NHEK. In contrast, transcript levels of these genes were markedly up-regulated in CTCF-depleted DF. Furthermore, TNF-alpha treatment causes a more profound inhibitory effect on the CTCF expression in DF compared to NHEK. Finally, we show that CTCF is down-regulated in primary psoriatic fibroblasts compared to DF, while CTCF expression was not affected in psoriatic keratinocytes. Taken together, these data suggest that the chromatin architectural protein CTCF is involved in cell-type specific regulation of pro-inflammatory genes in the skin cells, which suggests its involvement in pathogenesis of inflammatory skin diseases such as psoriasis.

Mammalian genomes are highly populated with silent virus-like repeat elements evolutionally originated from integrated retroviruses. Lsh, a member of the SNF2 chromatin-remodelling family, is involved in the control of DNA methylation during embryonic development. Here, we show that in the epidermis, the Lsh protein is expressed in the basal epidermal keratinocytes (KCs). Constitutive and epidermal-specific Lsh ablation in mice leads to severe skin inflammation associated with epidermal hyperplasia and marked alterations in the epidermal structure. Primary KCs isolated from newborn Lsh KO mice prior to the development of inflammatory phenotype showed substantial alterations in the genome-wide DNA methylation patterns compared to controls. Bisulfite sequencing revealed that in Lsh-deficient KCs, the majority of hypomethylated DNA sites are found at the repeat sequences containing Long Terminal Repeats (LTR), Long Interspersed Elements (LINEs) and minor satellites. The global transcriptome profiling and GSEA analysis of Lsh-null KCs revealed a dramatic upregulation of the genes involved in anti-viral defence response, type I interferon- and interferon g-mediated signalling pathways, as well as increased expression of Keratins 16/17 and downregulation of Keratin 10, Loricrin, Involucrin, Filaggrin compared to controls. These data reveal Lsh as a critical determinant controlling DNA methylation and silencing of the repetitive elements in epidermal KCs and suggest a new model for analyses of the role of the endogenous retroviral-like elements as pathogenic agents in autoimmune skin diseases.

Polycomb repressive complex 2 (PRC2) catalyses methylation of Lys-27 of histone H3 leading to transcriptional repression of target genes. In mouse skin, Ezh2, a catalytic subunit of PRC2, prevents premature differentiation of epidermal progenitor cells and their ectopic differentiation into Merkel cells. However, the role of PRC2 in human skin homeostasis remains unclear. Here, we show an increased EZH2 and H2K27me3 expression in differentiated suprabasal keratinocytes in human epidermis. Similarly, Ca2+-induced differentiation markedly up-regulated EZH2 expression in primary human epidermal keratinocytes (NHEK). Interestingly, knockdown of PRC2 subunits EZH1, EZH2 and EED using siRNA and small molecule inhibitors GSK126 and UNC1999 up-regulated expression of KRT1, LOR and FLG genes and suppressed cell proliferation in NHEKs cultured in low Ca2+ condition. However, disruption of the PRC2 function in already differentiated keratinocytes did not affect expression of the terminal differentiation genes. Bioinformatic analysis of genome-wide EZH2 and H3K27me3 distribution identified distinct sets of PRC2 targets in undifferentiated progenitor cells and their differentiated progeny. Taken together, these results highlight a critical role for PRC2 in human epithelial progenitor cells proliferation and differentiation.

Epigenetic regulatory machinery drives cell differentiation process via controlling covalent DNA/histone modifications and spatial chromatin interactions involving gene promoters and enhancers. Alterations in epigenetic regulatory mechanisms contribute to the development of many pathological conditions, including inflammation and cancer. Chromatin architectural protein CTCF controls enhancer/promoter interactions and terminal keratinocyte (KC) differentiation: ChIP-seq analyses revealed predominance of the CTCF binding to the distal gene regulatory elements versus gene promoters in KCs, while tamoxifen-treated K14-CreER/Ctcf fl/fl mice show alterations of the epidermal barrier structure and inflammation. Microarray analyses revealed that, together with altered expression of the genes involved in the control of KC differentiation, immune response and tumorigenesis, DNA 5-methylcytosine oxidizing Tet2 and Tet3 enzymes were markedly upregulated in the epidermis of K14-CreER/Ctcf fl/fl mice compared to controls. Furthermore, genetic Tet2 ablation in the compound K14-CreER/Ctcf fl/fl/Tet2 fl/fl mice was capable of rescuing alterations of epidermal barrier structure and inflammation caused by Ctcf loss in KCs. Also, K14-CreER/Ctcf fl/fl/Tet2 fl/fl mice showed significantly reduced capacity to develop epidermal tumors in chemical skin carcinogenesis model compared to K14-CreER/Ctcf fl/fl or control mice. Thus, these data suggest that Tet2-mediated DNA 5-methylcytosine oxidation plays pivotal roles in mediating the effects of CTCF on genome architecture during epidermal barrier maintenance in normal skin, as well as promotes epidermal inflammation and tumorigenesis upon CTCF ablation.

Background and Objective Visible light has beneficial effects on cutaneous wound healing, but the role of potential photoreceptors in human skin is unknown. In addition, inconsistency in the parameters of blue and red light‐based therapies for skin conditions makes interpretation difficult. Red light can activate cytochrome c oxidase and has been proposed as a wound healing therapy. UV‐blue light can activate Opsin 1‐SW, Opsin 2, Opsin 3, Opsin 4, and Opsin 5 receptors, triggering biological responses, but their role in human skin physiology is unclear. Materials and Methods Localization of Opsins was analyzed in situ in human skin derived from face and abdomen by immunohistochemistry. An ex vivo human skin wound healing model was established and expression of Opsins confirmed by immunohistochemistry. The rate of wound closure was quantitated after irradiation with blue and red light and mRNA was extracted from the regenerating epithelial tongue by laser micro‐dissection to detect changes in Opsin 3 ( OPN3) expression. Retention of the expression of Opsins in primary cultures of human epidermal keratinocytes and dermal fibroblasts was confirmed by qRT‐PCR and immunocytochemistry. Modulation of metabolic activity by visible light was studied. Furthermore, migration in a scratch‐wound assay, DNA synthesis and differentiation of epidermal keratinocytes was established following irradiation with blue light. A role for OPN3 in keratinocytes was investigated by gene silencing. Results Opsin receptors (OPN1‐SW, 3 and 5) were similarly localized in the epidermis of human facial and abdominal skin in situ . Corresponding expression was confirmed in the regenerating epithelial tongue of ex vivo wounds after 2 days in culture, and irradiation with blue light stimulated wound closure, with a corresponding increase in OPN3 expression. Expression of Opsins was retained in primary cultures of epidermal keratinocytes and dermal fibroblasts. Both blue and red light stimulated the metabolic activity of cultured keratinocytes. Low levels of blue light reduced DNA synthesis and stimulated differentiation of keratinocytes. While low levels of blue light did not alter keratinocyte migration in a scratch wound assay, higher levels inhibited migration. Gene silencing of OPN3 in keratinocytes was effective (87% reduction). The rate of DNA synthesis in OPN3 knockdown keratinocytes did not change following irradiation with blue light, however, the level of differentiation was decreased. Conclusions Opsins are expressed in the epidermis and dermis of human skin and in the newly regenerating epidermis following wounding. An increase in OPN3 expression in the epithelial tongue may be a potential mechanism for the stimulation of wound closure by blue light. Since keratinocytes and fibroblasts retain their expression of Opsins in culture, they provide a good model to investigate the mechanism of blue light in wound healing responses. Knockdown of OPN3 led to a reduction in early differentiation of keratinocytes following irradiation with blue light, suggesting OPN3 is required for restoration of the barrier function. Understanding the function and relationship of different photoreceptors and their response to specific light parameters will lead to the development of reliable light‐based therapies for cutaneous wound healing. Lasers Surg. Med. © 2018 Wiley Periodicals, Inc.

Independent regulation of the peripheral clock to the central clock may be promising for the treatment of skin disorders. Opsins (OPN) are photoentrainment GPCRs and Cryptochromes (CRYs) are transcription factors of the molecular circadian clock, both are blue light receptors, however their role in human skin is not clear. Expression of CRYs and OPNs in female facial and abdominal skin was compared by immunohistochemistry (IHC). Changes in the circadian clock of primary epidermal keratinocytes investigated by stabilisation of CRY with KL001 or by knockdown of CRY1 or OPN3 using siRNA. Keratinocytes were irradiated with 2 J/cm2 blue light. Migration analysed by a scratch-wound assay, DNA synthesis by EdU incorporation and differentiation by IHC and qRT-PCR. Changes in CRYs expression confirmed by qRT-PCR. We have previously shown expression of OPN1, 3 and 5 in human skin. Differential localisation of CRY1 and CRY2 was seen in facial human skin, while CRY1 expression was nuclear, CRY2 was mainly cytoplasmic. CRY2 but not CRY1 was expressed in abdominal skin. Treatment with KL001 which stabilizes CRY1, inhibited migration and induced KRT1 and KRT10, an effect which was abrogated by knockdown of OPN3. Knockdown of CRY1 also induced keratinocyte differentiation, but had no effect on migration. Interestingly, knockdown of OPN3 upregulated CRY1 expression, while KL001 upregulated OPN3 expression. Blue light increased early differentiation of epidermal keratinocytes, which was abrogated by both OPN3 silencing and KL001. However, a decrease in DNA synthesis seen after blue light irradiation was only abrogated after KL001 treatment. In conclusion, our findings highlight the importance of a functional circadian clock during epidermal barrier maintenance and wound healing processes. Furthermore, we have shown for the first time the regulation of the peripheral human epidermal clock with blue light.

Mammalian skin fulfills a large number of functions including protection of the organism against environmental (physical, chemical, biological) stressors, maintenance of body temperature and water balance, transmission of sensory information and psycho-social communications. To efficiently fulfill these complex functions, the skin develops as an organ that is capable of maintaining its structural integrity and shows a high degree of plasticity in response to changing environmental conditions. Skin development results in formation of the epidermis, dermis and cutaneous appendages. During postnatal life, the epithelial components of the skin, including the epidermis and hair follicles, regenerate, a process that involves the activation of dedicated pools of stem cells. After injury, epidermal and hair follicle stem cells contribute to skin regeneration by supplying their progenies to restore the skin epithelium. Skin development and regeneration are controlled by signaling/transcription factor-mediated and epigenetic mechanisms, which operate in concert to regulate gene expression. Signals received from the external environment are transmitted to the cell nucleus, which operates as a command center conferring responsiveness to extrinsic cues into distinct transcriptional outcomes. Here, we review the current state of research illustrating the critical cross-talk between signaling/transcription factor-mediated and epigenetic mechanisms which is required for execution of skin-specific programs of gene activation and silencing during development, regeneration and adaptation to environmental factors. Additional efforts are required to fully understand how the epigenome in cutaneous cells is re-organized during these processes. Future research in this direction will help to bridge the gap between our current knowledge of signaling/transcription factor-mediated and epigenetic mechanisms and potential applications of signaling and epigenetic modulators, which may provide new approaches for treatment of skin disorders and protection of skin against environmental stressors.

After the First International Symposium on Skin Epigenetics at the University of Bradford (UK) in 2012 (Botchkarev et al., 2013Botchkarev V.A. Fessing M.Y. Botchkareva N.V. Westgate G. Tobin D.J. First International Symposium “Epigenetic Control of Skin Development and Regeneration”: how chromatin regulators orchestrate skin functions.J Invest Dermatol. 2013; 133: 1918-1921Abstract Full Text Full Text PDF PubMed Scopus (7) Google Scholar), the research in this area has progressed substantially toward understanding how epigenetic regulatory machinery operates in concert with signaling pathways and transcription factors to control gene expression in normal skin and how epigenetic mechanisms are dysregulated in many pathological conditions including inflammatory skin disorders and cancer. To summarize recent achievements in skin epigenetics and to provide an opportunity for investigators to meet again and discuss the most important aspects of this rapidly expanding area, International Symposium “Epigenetic Regulation of Skin Regeneration and Aging” was held on March 17–19, 2016, in the Centre for Skin Sciences at the University of Bradford, UK. The Symposium was attended by over 110 participants from Europe, China, Japan, Singapore, and the United States, representing academic institutions as well as pharmaceutical and personal care industries. The Symposium program included eight Keynote lectures, the John M. Wood Memorial Lecture, and 27 talks organized into six sessions. In the Opening lectures, Prof. Cheng-Ming Chuong (University of Southern California, Los Angeles) and Prof. Fiona Watt (King’s College London, UK) introduced skin as an excellent model for epigenetic research, and Prof. Terumi Kohwi-Shigematsu (University of California, San Francisco) presented data on how epigenetic machinery contributes to neoplastic cell transformation. Following up the previous research on the role of DNA methyltransferase 1 in the control of hair follicle development and aging of mice (Li et al., 2012Li J. Jiang T.X. Hughes M.W. Wu P. Yu J. Widelitz R.B. et al.Progressive alopecia reveals decreasing stem cell activation probability during aging of mice with epidermal deletion of DNA methyltransferase 1.J Invest Dermatol. 2012; 132: 2681-2690Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar), Chuong described about how keratin genes are organized in the chicken genome. Similar to mammals, chicken keratin genes are clustered into distinct loci on chromosomes 25 and 27; whereas β-keratin genes on chromosome 25 show more inter-appendage differences in their expression, those on chromosome 27 show more intra-appendage differences, thus providing specific molecular targets for the study of epigenetic regulation (Wu et al., 2015Wu P. Ng C.S. Yan J. Lai Y.C. Chen C.K. Lai Y.T. et al.Topographical mapping of alpha- and beta-keratins on developing chicken skin integuments: functional interaction and evolutionary perspectives.Proc Natl Acad Sci USA. 2015; 112: E6770-E6779Crossref PubMed Scopus (58) Google Scholar). Watt described interplay between signaling and epigenetic mechanisms in the context of a recently discovered network of interactions involving different epigenetic regulators that affects two functionally related gene sets involved in the anchorage of epidermal stem cells to their niches (Mulder et al., 2012Mulder K.W. Wang X. Escriu C. Ito Y. Schwarz R.F. Gillis J. et al.Diverse epigenetic strategies interact to control epidermal differentiation.Nat Cell Biol. 2012; 14: 753-763Crossref PubMed Scopus (115) Google Scholar). Kohwi-Shigematsu discussed how the chromatin architectural protein and genome organizer SATB1 enables cells to change their phenotypes by regulating genes through higher-order chromatin reorganization and epigenetic modification in cancers of distinct cell types to regulate epigenetic modification, transcription, and drive metastasis (Kohwi-Shigematsu et al., 2012Kohwi-Shigematsu T. Kohwi Y. Takahashi K. Richards H.W. Ayers S.D. Han H.J. et al.SATB1-mediated functional packaging of chromatin into loops.Methods. 2012; 58: 243-254Crossref PubMed Scopus (29) Google Scholar, Kohwi-Shigematsu et al., 2013Kohwi-Shigematsu T. Poterlowicz K. Ordinario E. Han H.J. Botchkarev V.A. Kohwi Y. Genome organizing function of SATB1 in tumor progression.Semin Cancer Biol. 2013; 23: 72-79Crossref PubMed Scopus (94) Google Scholar). DNA methylation/hydroxymethylation and different chemical modifications of the histone proteins play pivotal roles in the control of gene activation/silencing and promoter/enhancer interactions in epithelial stem cells and their progenies (Avgustinova and Benitah, 2016Avgustinova A. Benitah S.A. Epigenetic control of adult stem cell function.Nat Rev Mol Cell Biol. 2016; 17: 643-658Crossref PubMed Scopus (144) Google Scholar). Prof. Wolf Reik (Babraham Institute, Cambridge, UK) presented his work on mechanisms that regulate epigenetic reprogramming, which appears to be conserved in mammals and is essential for imprinting, transition to pluripotency, and the generation of induced pluripotent stem cells. His laboratory has identified signaling events that regulate DNA methylation dynamics during early development and that connect reprogramming firmly with naïve pluripotency; ongoing work is focused on the roles of these pathways in natural and experimental reprogramming (von Meyenn et al., 2016von Meyenn F. Iurlaro M. Habibi E. Habibi E. Liu N.Q. Salehzadeh-Yazdi A. et al.Impairment of DNA methylation maintenance is the main cause of global demethylation in naive embryonic stem cells.Mol Cell. 2016; 62: 848-861Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). Prof. Salvador Benitah’s laboratory (Institute for Research in Biomedicine, Barcelona, Spain) reported that de novo DNA methylation catalyzed by Dnmt3a and Dnmt3b occurs in human epidermal stem cells and their differentiated counterparts at the most active subset of enhancers in a histone H3K36me3-dependent manner. Both Dnmt3a and Dnmt3b bind to superenhancers associated with genes that either define the ectodermal lineage or establish the stem cell and differentiated states: Dnmt3a is required to maintain high levels of DNA hydroxymethylation at the center of the enhancers, and Dnmt3b is necessary to maintain high levels of DNA methylation along the enhancer (Rinaldi et al., 2016Rinaldi L. Datta D. Serrat J. Morey L. Solanas G. Avgustinova A. et al.Dnmt3a and Dnmt3b associate with enhancers to regulate human epidermal stem cell homeostasis.Cell Stem Cell. 2016; 19: 1-11Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). Prof. Sarah Millar (University of Pennsylvania, Philadelphia) discussed the roles for histone deacetylases (HDACs) and their interaction with transcription factors leading to chromatin compaction and transcriptional repression. Following up previous work showing the roles for HDAC1 and HDAC2 in the control of embryonic epidermal development (LeBoeuf et al., 2010LeBoeuf M. Terrell A. Trivedi S. Sinha S. Epstein J.A. Olson E.N. et al.Hdac1 and Hdac2 act redundantly to control p63 and p53 functions in epidermal progenitor cells.Dev Cell. 2010; 19: 807-818Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar), she reported that, in contrast to ubiquitous expression of HDAC1/2 in skin epithelia, genetic deletion of Hdac3 in embryonic mouse epidermis disrupts stepwise differentiation of the epidermis. These data show that HDAC3 coordinates expression of differentiation proteins and lipids to establish a functional barrier via distinct molecular mechanisms. Dr. Yuri Schwartz (University of Umea, Sweden) and Dr. Elena Ezhkova (Mount Sinai School of Medicine, New York, NY) presented the data on how Polycomb Group proteins operate as epigenetic repressors essential for control of development and cell differentiation (Schwartz and Pirrotta, 2014Schwartz Y.B. Pirrotta V. Ruled by ubiquitylation: a new order for polycomb recruitment.Cell Rep. 2014; 8: 321-325Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Dr. Schwartz discussed similarities and differences between Polycomb mechanisms in different species and linked them to recently discovered pervasive nontargeted survey of the genome by Polycomb Group proteins (Lee et al., 2015Lee H.G. Kahn T.G. Simcox A. Schwartz Y.B. Pirrotta V. Genome-wide activities of polycomb complexes control pervasive transcription.Genome Res. 2015; 25: 1170-1181Crossref PubMed Scopus (92) Google Scholar). Dr. Ezhkova reported that the loss of function of core components of the different Polycomb complexes (PRC1 vs. PRC2) can result in different or even opposing biological outcomes, despite their shared genomic targets (Dauber et al., 2016Dauber K.L. Perdigoto C.N. Valdes V.J. Santoriello F.J. Cohen I. Ezhkova E. Dissecting the roles of polycomb repressive complex 2 subunits in the control of skin development.J Invest Dermatol. 2016; 136: 1647-1655Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, Perdigoto et al., 2016Perdigoto C.N. Dauber K.L. Bar C. Tsai P.C. Valdes V.J. Cohen I. et al.Polycomb-mediated repression and sonic hedgehog signaling interact to regulate Merkel cell specification during skin development.PLoS Genet. 2016; 12: e1006151Crossref PubMed Scopus (42) Google Scholar). Prof. Jonathan Higgins (Newcastle University, UK) discussed how histone H3T3 phosphorylation regulates protein association and dissociation from chromosomes during mitosis and can recruit “reader” proteins or displace them from chromatin. Future research will aim to generate the first genome-wide maps of mitotic histone phosphorylation and to uncover roles of histone phosphorylation in the decisions to retain bookmarks or release proteins from chromatin. This will help uncover mechanisms for memorizing and reprogramming gene expression during cell division (Wang and Higgins, 2013Wang F. Higgins J.M. Histone modifications and mitosis: countermarks, landmarks, and bookmarks.Trends Cell Biol. 2013; 23: 175-184Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). Prof. Bogi Andersen (University of California, Irvine) reported on the role of the transcription factor GRHL3 and epigenetic factors in the control of human epidermal keratinocyte differentiation and migration: during differentiation, GRHL3 primarily binds to superenhancers and activates transcription of epidermal differentiation genes, and during migration, GRHL3 binds to promoter regions and represses the expression of inhibitors of migration (Hopkin et al., 2012Hopkin A.S. Gordon W. Klein R.H. Espitia F. Daily K. Zeller M. et al.GRHL3/GET1 and trithorax group members collaborate to activate the epidermal progenitor differentiation program.PLoS Genet. 2012; 8: e1002829Crossref PubMed Scopus (60) Google Scholar, Peyrard-Janvid et al., 2014Peyrard-Janvid M. Leslie E.J. Kousa Y.A. Smith T.L. Dunnwald M. Magnusson M. et al.Dominant mutations in GRHL3 cause Van der Woude Syndrome and disrupt oral periderm development.Am J Hum Genet. 2014; 94: 23-32Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar). These data suggest that alterations in the enhancer structure and spatial rearrangement in chromatin binding of key transcription factors are responsible for the different functional states of keratinocytes. The 2016 John M. Wood Memorial Lecturer Prof. Elaine Fuchs (Rockefeller University, New York, NY) described her most recent work on the epigenetics and transcriptional regulation of stem cells during tissue regeneration, wound repair, and malignant progression. Her team has unravelled interactions between stem cells and their environment, which are manifested through dynamic changes in chromatin landscapes that orchestrate stem cell plasticity and allow stem cells to survive outside their native niche (reviewed in Adam and Fuchs, 2016Adam R.C. Fuchs E. The yin and yang of chromatin dynamics in stem cell fate selection.Trends Genet. 2016; 32: 89-100Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, Fuchs, 2016Fuchs E. Epithelial skin biology: three decades of developmental biology, a hundred questions answered and a thousand new ones to address.Curr Top Dev Biol. 2016; 116: 357-374Crossref PubMed Scopus (96) Google Scholar). Prof. Fuchs has also reported about recent insights into the biology of enhancers in skin epithelial stem cells and how pioneer transcription factors regulate superenhancer assembly in normal and malignant keratinocytes (Adam et al., 2015Adam R.C. Yang H. Rockowitz S. Larsen S.B. Nikolova M. Oristian D.S. et al.Pioneer factors govern super-enhancer dynamics in stem cell plasticity and lineage choice.Nature. 2015; 521: 366-370Crossref PubMed Scopus (260) Google Scholar, Yang et al., 2015Yang H. Schramek D. Adam R.C. Keyes B.E. Wang P. Zheng D. et al.ETS family transcriptional regulators drive chromatin dynamics and malignancy in squamous cell carcinomas.eLife. 2015; 4: e10870Crossref PubMed Scopus (55) Google Scholar). Nuclear compartmentalization of the genes, enhancer elements, and transcription machinery play essential roles in the control of gene expression (Bickmore and van Steensel, 2013Bickmore W.A. van Steensel B. Genome architecture: domain organization of interphase chromosomes.Cell. 2013; 152: 1270-1284Abstract Full Text Full Text PDF PubMed Scopus (509) Google Scholar, Cremer et al., 2015Cremer T. Cremer M. Hubner B. Strickfaden H. Smeets D. Popken J. et al.The 4D nucleome: evidence for a dynamic nuclear landscape based on co-aligned active and inactive nuclear compartments.FEBS Lett. 2015; 589: 2931-2943Crossref PubMed Scopus (150) Google Scholar, Dekker and Mirny, 2016Dekker J. Mirny L. The 3D genome as moderator of chromosomal communication.Cell. 2016; 164: 1110-1121Abstract Full Text Full Text PDF PubMed Scopus (530) Google Scholar). Prof. Peter Fraser (Babraham Institute, Cambridge, UK) reported on the progress in the further development of chromatin conformation capture technology that allows identification of spatial chromatin interactions in the nucleus. Fraser’s laboratory developed a promoter-capture Hi-C technology to identify distal sequences interacting with annotated gene promoters in 17 primary human hematopoietic cell types and several mouse cell types. In his talk, Peter Fraser reported that more than half of the identified interactions are cell type- or lineage-specific and preferentially link actively transcribed promoters with distal active enhancers. These population studies provide useful information on the range of genome interactions with exciting insights into human genetic variation and disease (Gilbert and Fraser, 2015Gilbert D.M. Fraser P. Three dimensional organization of the nucleus: adding DNA sequences to the big picture.Genome Biol. 2015; 16: 181Crossref PubMed Scopus (3) Google Scholar). Drs. Mike Fessing and Andrei Mardaryev (University of Bradford, UK) presented the data on the higher-order chromatin organization of the epidermal differentiation complex locus in keratinocytes (Botchkarev et al., 2012Botchkarev V.A. Gdula M.R. Mardaryev A.N. Sharov A.A. Fessing M.Y. Epigenetic regulation of gene expression in keratinocytes.J Invest Dermatol. 2012; 132: 2505-2521Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, Fessing, 2014Fessing M.Y. Gene regulation at a distance: higher-order chromatin folding and the coordinated control of gene transcription at the epidermal differentiation complex locus.J Invest Dermatol. 2014; 134: 2307-2310Abstract Full Text Full Text PDF PubMed Scopus (5) Google Scholar, Fessing et al., 2011Fessing M.Y. Mardaryev A.N. Gdula M.R. Sharov A.A. Sharova T.Y. Rapisarda V. et al.p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis.J Cell Biol. 2011; 194: 825-839Crossref PubMed Scopus (129) Google Scholar, Mardaryev et al., 2014Mardaryev A.N. Gdula M.R. Yarker J.L. Emelianov V.U. Poterlowicz K. Sharov A.A. et al.p63 and Brg1 control developmentally regulated higher-order chromatin remodelling at the epidermal differentiation complex locus in epidermal progenitor cells.Development. 2014; 141: 101-111Crossref PubMed Scopus (62) Google Scholar). These talks conclude that spatial interactions within and between lineage-specific gene loci in keratinocytes are essential for coordinated regulation of gene expression, implicating their role in governing epithelial differentiation and function. Dr. Christina de Guzman Strong (Washington University, St. Louis, MO) identified previously dynamic chromatin remodeling and activation of the epidermal differentiation complex locus with respect to an epidermal-specific enhancer, 923, thus enabling enhancer-centric studies to elucidate transcriptional activation (Oh et al., 2014Oh I.Y. Albea D.M. Goodwin Z.A. Quiggle A.M. Baker B.P. Guggisberg A.M. et al.Regulation of the dynamic chromatin architecture of the epidermal differentiation complex is mediated by a c-Jun/AP-1-modulated enhancer.J Invest Dermatol. 2014; 134: 2371-2380Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). Data presented in her talk show that intraepidermal differentiation complex chromatin contacts are enriched with respect to the 923 enhancer and Flg promoter and that transchromatin interactions enriched in loci are involved in the control of gene expression and epidermal function. Dr. Huiqing Jo Zhou (Radboud University, Nijmegen, The Netherlands) reported on epigenome profiling of differentiating human primary epidermal keratinocytes and characterized a catalog of dynamically regulated genes and p63-bound enhancers that are relevant for epidermal development and related diseases (Kouwenhoven et al., 2015Kouwenhoven E.N. Oti M. Niehues H. van Heeringen S.J. Schalkwijk J. Stunnenberg H.G. et al.Transcription factor p63 bookmarks and regulates dynamic enhancers during epidermal differentiation.EMBO Rep. 2015; 16: 863-878Crossref PubMed Scopus (95) Google Scholar). Dr. Zhou concluded that p63 bookmarks the genomic loci as a placeholder and functions as a pioneer factor, recruiting other co-regulators to modify the chromatin environment and regulate genes through temporal- and spatial-specific active enhancers during epithelial and epidermal development. Noncoding RNAs, including microRNAs, play pivotal roles in the control of gene expression (Botchkareva, 2012Botchkareva N.V. MicroRNA/mRNA regulatory networks in the control of skin development and regeneration.Cell Cycle. 2012; 11: 468-474Crossref PubMed Scopus (48) Google Scholar, Wang and Chang, 2011Wang K.C. Chang H.Y. Molecular mechanisms of long noncoding RNAs.Mol Cell. 2011; 43: 904-914Abstract Full Text Full Text PDF PubMed Scopus (3246) Google Scholar, Yi and Fuchs, 2012Yi R. Fuchs E. A miR image of stem cells and their lineages.Curr Top Dev Biol. 2012; 99: 175-199Crossref PubMed Scopus (14) Google Scholar). Dr. Rui Yi (University of Colorado, Boulder, USA) reported on his studies of the role of microRNA-mediated mechanisms in the control of skin development, including general factors of microRNA biogenesis such as Dgcr8, Xpo5, Dicer, and Argonaute, as well as individual microRNAs such as miR-203/205/200s (Jackson et al., 2013Jackson S.J. Zhang Z. Feng D. Flagg M. O'Loughlin E. Wang D. et al.Rapid and widespread suppression of self-renewal by microRNA-203 during epidermal differentiation.Development. 2013; 140: 1882-1891Crossref PubMed Scopus (61) Google Scholar, Wang et al., 2013Wang D. Zhang Z. O'Loughlin E. Wang L. Fan X. Lai E.C. et al.MicroRNA-205 controls neonatal expansion of skin stem cells by modulating the PI(3)K pathway.Nat Cell Biol. 2013; 15: 1153-1163Crossref PubMed Scopus (101) Google Scholar). He also presented the results of his recent work showing that adaptive expression of a Foxc1-Nfatc1-bone morphogenic protein network in the activated hair follicle stem cells is required to reinforce the quiescent cellular state and maintain the stem cell identity, illustrating an unexpectedly dynamic response by quiescent stem cells to self-renewal (Wang et al., 2016Wang L. Siegenthaler J.A. Dowell R.D. Yi R. Foxc1 reinforces quiescence in self-renewing hair follicle stem cells.Science. 2016; 351: 613-617Crossref PubMed Scopus (86) Google Scholar). Dr. Michaela Frye (University of Cambridge, UK) spoke about the role of RNA modifications in the control of cell differentiation. Studies from Frye’s laboratory showed that cytosine 5 methylation is a common posttranscriptional modification in transfer RNA and that hypomethylation of transfer RNAs causes the up-regulation of cellular stress pathways and a global reduction of protein synthesis (Blanco and Frye, 2014Blanco S. Frye M. Role of RNA methyltransferases in tissue renewal and pathology.Curr Opin Cell Biol. 2014; 31: 1-7Crossref PubMed Scopus (81) Google Scholar). Data obtained in Frye’s laboratory show that activation of stress response pathways drives both a global reduction of protein synthesis and altered translation of specific mRNAs that together promote stem cell functions and tumorigenesis (Blanco et al., 2016Blanco S. Bandiera R. Popis M. Hussain S. Lombard P. Aleksic J. et al.Stem cell function and stress response are controlled by protein synthesis.Nature. 2016; 534: 335-340Crossref PubMed Scopus (244) Google Scholar). Dr. Markus Kretz (University of Regensburg, Germany) continued the discussion on the role of noncoding RNAs in the control of epidermal differentiation. Using human organotypic epidermis as a model system, Kretz’s laboratory aims to understand how long noncoding RNAs help regulate the intricate balance between progenitor cells undergoing continual regeneration and highly differentiated cells forming the mature tissue environment and how this balance is affected during cancer progression. Kretz’s recent work shows that several long noncoding RNAs play important roles in regulating the homeostasis of normal epidermal tissue and might also be implicated in its neoplastic progression (Thorenoor et al., 2016Thorenoor N. Faltejskova-Vychytilova P. Hombach S. Mlcochova J. Kretz M. Svoboda M. et al.(Long non-coding RNA ZFAS1 interacts with CDK1 and is involved in p53-dependent cell cycle control and apoptosis in colorectal cancer.Oncotarget. 2016; 7: 622-637Crossref PubMed Scopus (63) Google Scholar). Dr. Anna Mandinova (Harvard University, Charlestown, MA) reported that YBX1 mRNA binding protein negatively controls the translation of a senescence-associated subset of cytokine mRNAs in epidermal progenitor cells, thus suggesting YBX1 as a critical posttranscriptional effector required for maintenance of epidermal tissue homeostasis. Dr. Eleonora Candi (University of Rome, Italy) spoke about the role of noncoding transcripts with ultraconserved element in keratinocytes differentiation (Marini et al., 2016Marini A, Lena AM, Panatta E, Ivan C, Han L, Liang H, et al. Ultraconserved long non-coding RNA uc.63 in breast cancer. Oncotarget 2016; August 2016.Google Scholar). Candi’s laboratory identified ultraconserved element 291 as a crucial player, with knockdown results in enhanced proliferation and significant reduction of the terminal differentiation program. These results indicate that noncoding transcripts with ultraconserved element have a key role in driving keratinocyte terminal differentiation. Prof. Daniel Aberdam (University of Paris, France) spoke about progress in showing an important role of exosomes as mRNA and microRNA transporting elements in intercellular communications and signaling (Erbani et al., 2016Erbani J. Aberdam D. Larghero J. Vanneaux V. Pluripotentstem cells and other innovative strategies for the treatment of ocular surface diseases.Stem Cell Rev. 2016; 12: 171-178Crossref PubMed Scopus (15) Google Scholar). Normal human keratinocytes release exosomal microRNAs that modulate pigmentation of melanocytes, and the cutaneous wound healing response can be modulated by exosomes derived from mesenchymal stem cells through the activation of the Wnt pathway, angiogenesis, and extracellular matrix remodeling. These data show a potential for using exosomes as a novel approach for modulating gene expression in distinct skin cell populations and managing skin disorders. Spatial genome organization and expression of many components of epigenetic regulatory machinery are markedly changed during aging (Chandra and Kirschner, 2016Chandra T. Kirschner K. Chromosome organisation during ageing and senescence.Curr Opin Cell Biol. 2016; 40: 161-167Crossref PubMed Scopus (36) Google Scholar). Prof. Peter Adams (University of Glasgow/Beatson Institute for Cancer Research, Scotland) discussed the role for cellular senescence as a stable proliferation arrest implicated in tumor suppression and aging. In melanocytes, diverse senescence can contribute to tumor suppression, a debilitating congenital syndrome (congenital melanocytic nevus syndrome) and cell aging. Dissecting the mechanisms of cell senescence in melanocytes is yielding insights to combat melanoma, treat congenital melanocytic nevus syndrome, and promote healthy aging (Rai and Adams, 2012Rai T.S. Adams P.D. Lessons from senescence: chromatin maintenance in non-proliferating cells.Biochim Biophys Acta. 2012; 1819: 322-331Crossref PubMed Scopus (50) Google Scholar). Dr. Eric Shirmer (University of Edinburgh, Scotland) spoke about how spatial genome organization contributes to the regulation of gene expression and the role of tissue-specific nuclear envelope transmembrane proteins that regulate positioning of specific subsets of genes during cell differentiation (Czapiewski et al., 2016Czapiewski R. Robson M.I. Schirmer E.C. Anchoring a leviathan: how the nuclear membrane tethers the genome.Front Genet. 2016; 7: 82Crossref PubMed Scopus (42) Google Scholar). During myogenesis, three muscle-specific nuclear envelope transmembrane proteins with genome organization functions influence the expression levels of 38% of all genes involved in muscle-specific differentiation. In Emery-Dreifuss muscular dystrophy patients, several of these spatial genome organization nuclear envelope transmembrane proteins from muscle serve as strong candidates contributing to the disease progression, suggesting that gene misregulation may contribute significantly to the Emery-Dreifuss muscular dystrophy pathophysiology. Dr. John Connelly (Queen Mary University of London, UK) reported that transmission of mechanical forces to the nucleus play a role in the intracellular positioning, mitosis, and cell motility. Connelly’s laboratory showed that cross-talk between the cytolinker plectin and F-actin controls keratin network organization and the three dimensional nuclear morphology of keratinocytes (Almeida et al., 2015Almeida F.V. Walko G. McMillan J.R. McGrath J.A. Wiche G. Barber A.H. et al.The cytolinker plectin regulates nuclear mechanotransduction in keratinocytes.J Cell Sci. 2015; 128: 4475-4486Crossref PubMed Scopus (34) Google Scholar). Data from Connelly’s laboratory suggest that the biophysical cues may directly regulate chromatin remodeling in keratinocytes and raise interesting questions about the impact on epidermal cell fate and function. Prof. Karima Djabali (Technical University Munich, Germany) spoke about Hutchinson-Gilford progeria premature aging syndrome, which eventuates in the production of a mutant form of the nuclear lamin A (or progerin). Progerin is accumulated in dermal fibroblasts and selected terminally differentiated keratinocytes of aged individuals (McClintock et al., 2007McClintock D. Ratner D. Lokuge M. Owens D.M. Gordon L.B. Collins F.S. et al.The mutant form of lamin A that causes Hutchinson-Gilford progeria is a biomarker of cellular aging in human skin.PLoS One. 2007; 2: e1269Crossref PubMed Scopus (261) Google Scholar) and is expressed in vascular cells, resulting in vessel wall cell loss and replacement by fibrous tissue. This provides the basis for further study of the potential role of abnormal forms of lamin A in the process of normal skin aging (Eisch et al., 2016Eisch V. Lu X. Gabriel D. Djabali K. Progerin impairs chromosome maintenance by depleting CENP-F from metaphase kinetochores in Hutchinson-Gilford progeria fibroblasts.Oncotarget. 2016; 7: 24700-24718Crossref PubMed Scopus (16) Google Scholar). Dr. Andrey Sharov (Boston University, MA) reported about the role of Lsh, a member of the SNF2 chromatin-remodeling family, which is involved in the control of DNA methylation patterns during embryonic development. Prof. Cord Brakebusch (University of Copenhagen, Denmark) spoke about epigenetic control of IL-23 expression in keratinocytes involving histone methylation, which is regulated by tumor necrosis factor and the actin cytoskeletal organizer N-WASP (Lefever et al., 2010Lefever T. Pedersen E. Basse A. Paus R. Quondamatteo F. Stanley A.C. et al.N-WASP is a novel regulator of hair-follicle cycling that controls antiproliferative TGF{beta} pathways.J Cell Sci. 2010; 123: 128-140Crossref PubMed Scopus (28) Google Scholar). These data suggest a novel role for N-WASP in keratinocytes in the initiation of IL-23–dependent skin inflammation. Prof. Honglin Wang (Shanghai Jiao Tong University, China) reported that NF-κB activation triggered by inflammatory cytokines induces the transcription of microRNA miR-31, one of the most dynamic microRNAs identified in the skin of psoriatic patients and mouse models (Yan et al., 2015Yan S. Xu Z. Lou F. Zhang L. Ke F. Bai J. et al.NF-kappaB-induced microRNA-31 promotes epidermal hyperplasia by repressing protein phosphatase 6 in psoriasis.Nat Commun. 2015; 6: 7652Crossref PubMed Scopus (152) Google Scholar). Because dysfunctional regulatory T cells have been identified in individuals with psoriasis, Wang’s laboratory showed miR-31 and its target Gprc5a as critical regulators for regulatory T-cells generation, suggesting a previously unrecognized epigenetic mechanism for dysfunctional regulatory T cells in skin inflammation and psoriasis (Zhang et al., 2015Zhang L. Ke F. Liu Z. Bai J. Liu J. Yan S. et al.MicroRNA-31 negatively regulates peripherally derived regulatory T-cell generation by repressing retinoic acid-inducible protein 3.Nat Commun. 2015; 6: 7639Crossref PubMed Scopus (71) Google Scholar). Prof. J.T. Elder (University of Michigan, Ann Arbor, MI) continued discussion about the genetics and epigenetics of psoriasis (Li et al., 2014Li B. Tsoi L.C. Swindell W.R. Gudjonsson J.E. Tejasvi T. Johnston A. et al.Transcriptome analysis of psoriasis in a large case-control sample: RNA-seq provides insights into disease mechanisms.J Invest Dermatol. 2014; 134: 1828-1838Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar). Elder’s laboratory was testing the hypothesis that specific alterations in chromatin structure and gene regulation in skin-homing T cells and myeloid dendritic cells underlie the effects of many psoriasis-associated genetic variants. Data from his laboratory resulted in generation of genetic and epigenetic maps helping identify the regulatory variations underlying psoriasis genetic signals on a genome-wide basis. Dr. Malgorzata Wiench (University of Birmingham, UK) reported on how epigenetic mechanisms contribute to cancer initiation and progression in the context of the role for DNA modifications in the activity of distal regulatory elements in squamous cell carcinomas (Wiench et al., 2011Wiench M. John S. Baek S. Johnson T.A. Sung M.H. Escobar T. et al.DNA methylation status predicts cell type-specific enhancer activity.EMBO J. 2011; 30: 3028-3039Crossref PubMed Scopus (168) Google Scholar). Using genome-wide DNase I hypersensitive sites sequencing methods, Wiench’s laboratory identified squamous cell carcinoma-specific regulatory elements and showed that treatment with 5-aza-cytidine significantly alters the epigenetic landscape in cancer cells. Thus, identification of the DNA demethylation changes could potentially hold therapeutic value for squamous cell carcinoma. Finally, Dr. Oleg Fedorov (Oxford University, UK) spoke about distinct classes of small molecules that modulate the activity of epigenetic regulators in normal and neoplastic cells. The regulation of chromatin structure and gene expression is governed by a multitude of proteins that “write,” “read,” and “erase” histone marks. Fedorov highlighted the recent progress in the field of bromodomain inhibitors and their potential application in multiple disease areas such as inflammation and cancer (Hammitzsch et al., 2015Hammitzsch A. Tallant C. Fedorov O. O'Mahony A. Brennan P.E. Hay D.A. et al.CBP30, a selective CBP/p300 bromodomain inhibitor, suppresses human Th17 responses.Proc Natl Acad Sci USA. 2015; 112: 10768-10773Crossref PubMed Scopus (160) Google Scholar, Montenegro et al., 2016Montenegro RC, Clark PG, Howarth A, Wan X, Ceroni A, Siejka P, et al. BET inhibition as a new strategy for the treatment of gastric cancer. Oncotarget 2016; June 2016.Google Scholar). The Symposium served as an important step in integrating research in skin and chromatin biology and provided a platform for further analyses of the epigenetic mechanisms that control reorganization of gene expression programs in different skin cell lineages during normal homeostasis and regeneration, as well as during skin aging and inflammatory and neoplastic skin disorders. The Symposium helped bridge the gap between our current knowledge of basic epigenetic mechanisms and understanding on how their alterations contribute to the development of pathological skin conditions, such as psoriasis and cancer. Hopefully, this symposium will help in the further development of skin epigenetics as a novel area of basic and applied cutaneous research and will promote the research toward generation of novel cohorts of epigenetic drugs for the treatment of skin disorders.