A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Pear blister canker viroid (PBCVd) was detected in pear (Pyrus sp.), nashi (Pyrus serotina) and quince (Cydonia oblonga) trees from various pome fruit growing regions of Australia using dot-blot hybridisation and RT-PCR techniques. Characteristic symptoms of PBCVd infection were not observed on the infected trees. This is the first report of PBCVd infecting nashi varieties. The 12 Australian PBCVd isolates showed 92–99% nucleotide sequence identity with previously published sequences of PBCVd from other countries. The Australian isolates fell into two distinct groups based on sequence similarity and secondary structures. The possible origin of PBCVd in Australia is discussed.

The efficacy of seedlings of Prunus persica cv. GF 305, P. persica cv. Siberian C, and P. tomentosa (Nanking Cherry) as diagnostic indicators of plum pox infection, and of P. tomentosa for other Prunus viruses was evaluated by graft-inoculation with eight different strains or isolates of plum pox virus (PPV) representative of the Marcus (M) and Dideron (D) serogroups; and one isolate each of Prunus necrotic ringspot virus (PNRSV), prune dwarf Virus (PDV), and sour cherry green ring mottle virus (GRMV). The initial PPV symptoms that developed in P. tomentosa within 30 days after inoculation were chlorotic banding along the midrib spreading to lateral veins from the leaf base upward, giving the appearance of a chlorotic oak-leaf pattern. Symptoms caused by PPV-M could be distinguished from those caused by PPV-D. Virus titers in infected P. tomentosa and GF 305 were higher than those in Siberian C when measured by triple antibody sandwich enzyme-linked immunosorbent assay. Infections by PNRSV, PDV, and GRMV were evident with the first flush of vegetative growth.

Radar scattering amplitudes contain pole singularities whose importance was recognized in the context of the singularity expansion method. The scattering of impulsive signals, studied previously, was shown to involve a large number of such poles, whose residues combine to form creeping-wave pulses. It is shown here that the use of sinusoidal pulses of long but finite duration, with the carrier fre...

The induction and management of lambing was studied in a commercial flock of ewes. These ewes were bred at synchronized estrus and managed to lamb three times in 2 yr, with lambings occurring in the sequence of February, September and June. Ewes treated with 2 mg of estradiol benzoate in oil (i.m.) at approximately 17 d prior to term did not lamb in response to treatment. When 2 mg estradiol benzoate was given at 0800 on d 142 of gestation, lambing occurred an average of 37 +/- 5 h later in ewes treated in June or September and at 70 +/- 10 h later in ewes treated in February. The comparable figures for oil-treated ewes (control) were 70 +/- 5 h and 116 +/- 9 h, respectively. Altering the time of day of injection or using two injections 24 h apart did not alter the time for injection to lambing. Increasing the dose of estradiol benzoate to 15 mg decreased the time from injection to lambing (43 +/- 7 h, ewes treated in February) but also increased the incidence of dystocia (50% incidence). The incidence of dystocia averaged 8% for all other treatments and controls. Death loss of lambs to 1 wk of age was 12% and was not affected by treatment. The length of the lambing period was reduced from 9.0 +/- 3.3 d in control ewes to 3.6 +/- 1.1 d in induced ewes. A single injection of 2 mg estradiol benzoate given at 0800 on d 142 of gestation or a double treatment, with injections at 2000 on d 142 and 143, resulted in 53% of ewes lambing between 0800 and 1600 on each day of the lambing period, compared with 33% in control ewes.

An elastic body immersed in a fluid will ring when isoni- fied by sound whose frequency is the same as one of the resonances of that body. Correspondence has been established between these normal mode resonances of the body and the individual circumferential waves predicted by creeping wave theory. Insonifying the target by a rela- tively long sinusoidal wave train, with a narrow spectrum centered around, or away from, a selected resonance frequency, results in a series of superimposed responses consisting of the specular reflection and succession of creeping waves arriving after repeated circumnavi- gations of the body which, at resonance only, add in phase to generate the ringing response. Echoes from spherical targets are analyzed in this fashion and are also associated with the resonance poles in the complex frequency plane, obtained by us in the form of contour plots.

The results of a theoretical and experimental study concerning the ringing response of the individual resonances of a submersed elastic cylinder, insonified at normal incidence by sinusoidal pulses of relatively long duration, are presented. This ringing consists of a series of superimposed responses, comprising the specular reflection, and a succession of creeping waves which at resonance add in phase to synthesize the ringing response of an individual elastic-body resonance, provided the pulse spectrum is sufficiently narrow; off resonance, the ringing disappears. Analytically and experimentally obtained echoes from cylindrical targets support this interpretation and are correlated with complex-frequency poles of the scattering amplitude.

The Singularity Expansion Method has shown the transient echo amplitude of radar targets to be characterized by complex-frequency poles and their residues. We note that the use of pulsed signals of long duration permits identification of individual pole resonances by the observation of their ringing.

Experiments recently carried out at the University of Le Havre, France [G.Maze and J. Ripoche, Rev. Phys. Appl. 18, 319 (1983); J.Acoust. Soc. Am. 73, 41 (1983)] and at the CNRS laboratories, Marseilles, France [C. Gazanhes et al., Rev. CETHEDEC 70, 1 (1982); Acustica 52, 265 (1983)] regarding the scattering of acoustic transients from submerged elastic bodies exhibit in some instances the ringing of individual resonances of such target objects when insonified by tone bursts of long duration. This phenomenon is interpreted in terms of the interference of multiply circumnavigating circumferential wave trains, and its connection with the complex-frequency poles of the scattering amplitude f (ω) is established. The poles are visualized via a contour plot of ‖ f (ω)‖ in the complex-frequency plane.

The radar scattering amplitude, as a function of frequency, possesses poles whose importance was recognized in the framework of the singularity expansion method (SEM); they are located at the scatterer's complex eigenfrequencies and are characteristic for its shape and composition. For perfectly conducting targets, these poles lead to little pronounced, broad frequency resonances in the radar echoes while for dielectrically coated objects, such resonances can be very prominent. We here present pole patterns in the complex-frequency plane for dielectrically-coated spheres, and obtain the movement of the poles under changes of the thickness and dielectric constant of the coating. The results explain the appearance and disappearance of resonance peaks in previously calculated radar cross sections.

The interference features appearing in acoustic scattering amplitudes of elastic targets, when plotted versus frequency, are largely governed by the complex-frequency poles of the amplitudes. Unitarity entails the existence of a zero accompanying each pole. The dependence of interference features on the pole and zero structure of the scattering amplitude S can be strikingly visualized by plotting contour maps of |S| over the complex frequency plane. We further studied the influence of the pole structure on the scattering of long sinusoidal wave trains for tungsten carbide, aluminum, and lucite spheres and cylinders. Both quasi-stationary and transient portions of the echo are affected, as physically explained by the phase relationships between specularly reflected and circumferential pulses. [H.Ü. was partly supported by ONR.]

The breeding season was 157, 154, <126, 210 and 217 days for Rambouillet, Columbia, Suffolk, Rambouillet × Finnish Landrace and Columbia × Finnish Landrace ewes respectively. Treatment of cyclic ewes with pregnant mare serum gonadotropin (PMSG) (500 IU), following a 12-day treatment with progestin-containing intravaginal sponges, did not affect fertility, but did decrease the time from sponge removal to estrus, (control 48.0 ± 3.1 hr; PMSG 39.4 ± 1.8 hr) to the preovulatory surge of LH (control 52.7 ± 2.8 hr; PMSG 39.0 ± 1.7 hr) and FSH (control 52.3 ± 2.9 hr; PMSG 42.8 ± 1.6 hr) and caused an elevation of serum LH levels prior to the preovulatory surge (control 1.25 ± 0.18 ng/ml; PMSG 2.31 ± 0.22 ng/ml). Exposure of the purebred ewes to 18 hours of daylight in January, decreasing by 30 minutes a week subsequently, counteracted the seasonal reduction in the number of ewes lambing following induced breeding under natural daylight in May. Prolificacy was greatest in crossbred ewes and their fertility was not affected by season. Gestation period was longer for fall-bred ewes and varied with breed.