Chemotherapeutic resistance is a major obstacle to the effectiveness of cisplatin-based chemotherapy for gastric cancer (GC), leading to treatment failure and poor survival rates. However, the underlying mechanisms are not fully understood. Our study demonstrated that the transcription factor myocyte enhancer factor 2A (MEF2A) plays a role in chemotherapeutic drug resistance by regulating the transcription of PGC1α and KEAP1, promoting mitochondrial biogenesis. It was found that increased MEF2A expression is linked with poor prognosis, cisplatin insensitivity, and mitochondrial function in GC. MEF2A overexpression significantly decreases GC cell sensitivity in vitro and in vivo, while MEF2A knockdown enhances the sensitivity to cisplatin. Mechanistically, MEF2A activates the transcription of PGC1α, leading to increased mitochondrial biogenesis. In addition, MEF2A inhibits KEAP1 transcription, reduces NRF2 ubiquitination degradation, and activates the KEAP1/NRF2 signaling pathway, which modulates the reactive oxygen species level. The present study identifies a new critical oncogene involved in GC chemoresistance, suggesting a novel therapeutic target for GC.

The NOD-like receptor (NLR) signaling pathway may influence human immunodeficiency virus (HIV) clearance and CD4+ T cell recovery through inflammatory responses, but its specific mechanism requires further investigation. A deeper understanding of genetic variations can provide new insights into the biological mechanisms underlying the occurrence and development of immunodeficiency syndrome (AIDS). By utilizing multiple bioinformatic analyses and functional annotations, we identified single-nucleotide polymorphisms (SNPs) in the NLR signaling pathway that may affect HIV-1 infection and AIDS progression. Then, a case-control study was performed to screen risk-related variants by genotyping candidate SNPs in a sample of 500 men who have sex with men (MSM) with HIV-1 and 500 healthy controls from the Han population in Northern China. The results revealed significant association between five SNPs (NLRP3 rs4612666, MAVS rs17857295, MAVS rs6084497, MAVS rs16989000, and JAK1 rs4244165) and HIV-1 infection. Interestingly, the gene-gene interaction model composed of five SNPs exhibited a cumulative effect on the disease. Specially, the increase in risk alleles carried by the samples elevated the risk of contracting HIV-1. In addition, three SNPs (IL1B rs1143623, STAT1 rs1467199 and STAT1 rs2066804) were associated with CD4+ T cell counts in patients with AIDS. Three SNPs (OAS1 rs1131454, NLRP3 rs10754558, and MAVS rs867335) were found to be related to the clinical staging of AIDS. This finding provides insights into the genetic variants in NLR signaling pathway genes in HIV-1 infection and AIDS progression among MSM in Northern China.

Double minutes (DMs), extrachromosomal gene fragments found within certain tumors, have been noted to carry onco- and drug resistance genes contributing to tumor pathogenesis and progression. After screening for SUMO-related molecule expression within various tumor sample and cell line databases, we found that SUMO-conjugating enzyme UBC9 has been associated with genome instability and tumor cell DM counts, which was confirmed both in vitro and in vivo. Karyotyping determined DM counts post-UBC9 knockdown or SUMOylation inhibitor 2-D08, while RT-qPCR and Western blot were used to measure DM-carried gene expression in vitro. In vivo, fluorescence in situ hybridization (FISH) identified micronucleus (MN) expulsion. Western blot and immunofluorescence staining were then used to determine DNA damage extent, and a reporter plasmid system was constructed to detect changes in homologous recombination (HR) and non-homologous end joining (NHEJ) pathways. Our research has shown that UBC9 inhibition is able to attenuate DM formation and lower DM-carried gene expression, in turn reducing tumor growth and malignant phenotype, via MN efflux of DMs and lowering NHEJ activity to increase DNA damage. These findings thus reveal a relationship between heightened UBC9 activity, increased DM counts, and tumor progression, providing a potential approach for targeted therapies, via UBC9 inhibition.

Background MSM are at high risk of HIV infection. Previous studies have shown that the cell cycle regulation plays an important role in HIV-1 infection, especially at the G2/M checkpoint. ATR , Chk1 , Cdc25C and CDK1 are key genes of G2/M checkpoint. However, the association between SNPs of these genes and susceptibility to HIV-1 infection and AIDS progression remains unknown. Methods In this study, 42 tSNPs from the above four G2/M checkpoint genes were genotyped in 529 MSM and 529 control subjects from northern China to analyze this association. Results The results showed that rs34660854 A and rs75368165 A in ATR gene and rs3756766 A in Cdc25C gene could increase the risk of HIV-1 infection ( P = 0.049, OR = 1.234, 95% CI 1.001–1.521; P = 0.020, OR = 1.296, 95% CI 1.042–1.611; P = 0.011, OR = 1.392, 95% CI 1.080–1.794, respectively), while Chk1 rs10893405 ( P = 0.029, OR = 1.629, 95% CI 1.051–2.523) were significantly associated with AIDS progression. Besides, rs34660854 ( P = 0.019, OR = 1.364, 95% CI 1.052–1.769; P = 0.022, OR = 1.337, 95% CI 1.042–1.716, under Codominant model and Dominant model, respectively) and rs75368165 ( P = 0.006, OR = 1.445, 95% CI = 1.114–1.899; P = 0.007, OR = 1.418, 95% CI 1.099–1.831, under Codominant model and Dominant model, respectively) in ATR gene, rs12576279 ( P = 0.013, OR = 0.343, 95% CI 0.147-0.800; P = 0.048, OR = 0.437, 95% CI 0.192–0.991, under Codominant model and Dominant model, respectively) and rs540436 ( P = 0.012, OR = 1.407, 95% CI 1.077–1.836; P = 0.021, OR = 1.359, 95% CI 1.048–1.762, under Codominant model and Dominant model, respectively) in Chk1 gene, rs3756766 ( P = 0.013, OR = 1.455, 95% CI 1.083–1.954; P = 0.009, OR = 1.460, 95% CI 1.098–1.940, under Codominant model and Dominant model, respectively) in Cdc25C gene and rs139245206 ( P = 0.022, OR = 5.011, 95% CI 1.267–19.816; P = 0.020, OR = 5.067, 95% CI 1.286–19.970, under Codominant model and Recessive model, respectively) in CDK1 gene were significantly associated with HIV-1 infection under different models. Conclusions We found that genetic variants of G2/M checkpoint genes had a molecular influence on the occurrence of HIV-1 infection and AIDS progression in a northern Chinese MSM population.

Oculocutaneous albinism (OCA) is a genetically heterogeneous disease and is most inherited in an autosomal recessive manner. The characteristic manifestation of OCA is due to disfunction of melanin synthesis. OCA1 is the most severe subtype of OCA and is caused by homozygous or compound heterozygous variants in tyrosinase (TYR) gene, which is the key gene for melanin synthesis. This study aimed to identify the genetic variants of a northern Chinese family with OCA1. Clinical information and peripheral blood samples were collected. PCR amplification and Sanger sequencing were used to detect the entire exons and adjacent flanking sequences of TYR gene. Functional prediction of variants was performed by various bioinformatic analyses, while the pathogenicity classification of variants was evaluated according to ACMG standards and guidelines. A missense variant NM_000372.5:c.107G > C;NP_000363.1:p.C36S was discovered in TYR gene which converted cysteine to serine. Another variant in intron, NM_000372.5:c.1037-7 T > A, also affected the function of TYR gene. We verified the pathogenicity of the intron variant with a pCAS2 mini-gene based splicing assay and found that c.1037-7 T > A led to an insertion of 5 bp upstream from the common acceptor site of exon 3, which caused a frameshift TYR:c.1037-7 T > A:p.G346Efs*11. The results showed that the compound heterozygous variants c.107G > C:p.C36S and c.1037-7 T > A:p.G346Efs*11 of TYR gene were the pathogenic variants for this OCA1 family.

BACKGROUND:Polydactyly is a common congenital malformation characterized by the presence of supernumerary fingers or toes. In this case study, we sought to identify the causative pathogenic factor in a family from a northern region of China affected by non-syndromic postaxial polydactyly (PAP). METHODS:After recruiting a three-generation family with PAP, whole-exome sequencing was performed to identify the causative variant. In silico analysis and Sanger sequencing were used to validate the variant. RESULTS:We identified a novel heterozygous frameshift variant (NM_000168.6:c.4540delG, p.Asp1514Thrfs*5) in the transcriptional activator (TA1) domain of the GLI3 gene. CONCLUSION:The novel frameshift variant identified in this study further confirms the relationship between non-syndromic PAP and GLI3 and extends the previously established mutational and phenotypic spectra of GLI3.

Lynch syndrome (LS) is the most common hereditary colorectal cancer (CRCs) inherited in an autosomal-dominant manner. Here, we reported a multigeneration Chinese family clinically diagnosed with LS according to the Amsterdam II criteria. To identify the underlying causative gene for LS in this family, whole-exome sequencing (WES) was performed. A germline missense variant (c.2054C>T:p.S685F) in exon 18 of MLH1 was successfully identified by WES. Sanger sequencing verified the results of WES and also confirmed the cosegregation of the MLH1 missense variant in all affected members of the family including two unaffected family members. Bioinformatic tools predicted the identified MLH1 variant as deleterious. Immunohistochemistry (IHC) staining showed loss of MLH1 and PMS2 protein expression. In vitro expression analysis also revealed that the identified MLH1 missense variant (c.2054C>T:p.S685F) results in reduced expression of both MLH1 and PMS2 proteins. Based on the American College of Medical Genetics and Genomics (ACMG) guidelines, the missense mutation c.2054C>T in MLH1 was classified as a "pathogenic" variant. Two unaffected family members were later recommended for colonoscopy and other important cancer diagnostic inspections every 1-2 years as both were at higher risk of LS. In conclusion, our findings widen the genotypic spectrum of MLH1 mutations responsible for LS. This study increases the phenotypic spectrum of LS which will certainly help the clinicians in diagnosing LS in multigeneration families. This study also puts emphasis on the importance of genetic counselling for the benefit of asymptomatic carriers of MMR gene variants who are at higher risk of LS.

BACKGROUND:Polycystic kidney disease (PKD) is an inherited disease that is life-threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. METHODS:This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. RESULTS:Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. CONCLUSION:The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family.

Progressive familial intrahepatic cholestasis type 3 (PFIC3) is a hepatic disorder occurring predominantly in childhood and is difficult to diagnose. PFIC3, being a rare autosomal recessive disease, is caused by genetic mutations in both alleles of ABCB4, resulting in the disruption of the bile secretory pathway. The identification of pathogenic effects resulting from different mutations in ABCB4 is the key to revealing the internal cause of disease. These mutations cause truncation, instability, misfolding, and impaired trafficking of the MDR3 protein. Here, we reported a girl, with a history of intrahepatic cholestasis and progressive liver cirrhosis, with an elevated gamma-glutamyltransferase level. Genetic screening via whole exome sequencing found a novel homozygous missense mutation ABCB4:c.1195G>C:p.V399L, and the patient was diagnosed with PFIC3. Various computational tools predicted the variant to be deleterious and evolutionary conserved. For functional characterization studies, plasmids, encoding ABCB4 wild-type and selected established mutant constructs, were expressed in human embryonic kidney (HEK-293T) and hepatocellular carcinoma (HepG2) cells. In vitro expression analysis observed a reduced expression of mutant protein compared to wild-type protein. We found that ABCB4 wild type was localized at the apical canalicular membrane, while mutant p.V399L showed intracellular retention. Intracellular mistrafficking proteins usually undergo proteasomal or lysosomal degradation. We found that after treatment with proteasomal inhibitor MG132 and lysosomal inhibitor bafilomycin A1, MDR3 expression of V399L was significantly increased. A decrease in MDR3 expression of mutant V399L protein may be a result of proteasomal or lysosomal degradation. Pharmacological modulator cyclosporin A and intracellular low temperature (30°C) treatment significantly rescued both the folding defect and the active maturation of the mutant protein. Our study identified a novel pathogenic mutation which expanded the mutational spectrum of the ABCB4 gene and may contribute to understanding the molecular basis of PFIC3. Therefore, genetic screening plays a conclusive role in the diagnosis of rare heterogenic disorders like PFIC3.

Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re‐identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI‐H716 by genetic mapping and sequencing strategy, employing high‐resolution array‐based comparative genomic hybridization, high‐throughput sequencing, multiplex‐fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI‐H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi‐step evolutionary model could fit the module of DM genesis better in NCI‐H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs.

Background MSM has a high risk of HIV infection. Previous studies showed that the cell cycle regulation played an important role in HIV-1 infection, especially in G2/M checkpoint. The ATR, Chk1, Cdc25C and CDK1 are key genes in G2/M checkpoint. However, the association between the SNPs of these genes and susceptibility to HIV-1 infection and AIDS progression remains unknown. Results 42 tSNPs of G2/M checkpoint genes were genotyped to analyze the association between these tSNPs and susceptibility to HIV-1 infection and AIDS progression among MSM (529 HIV − 1 seropositive men and 529 HIV-1 seronegative men) in northern China. The results showed that rs34660854-A and rs75368165-A in ATR gene and rs3756766-A in Cdc25C gene could increase the risk of HIV-1 infection (P = 0.049, P = 0.020 and P = 0.010, respectively), and ATR rs75069062 and Chk1 rs10893405 were significantly associated with AIDS progression (P = 0.026 and P = 0.029, respectively). Besides, rs34660854 and rs75368165 in ATR gene, rs12576279 and rs540436 in Chk1 gene, rs3756766 in Cdc25C gene and rs139245206 in CDK1 gene were significantly associated with HIV-1 infection under different models (P < 0.05). Conclusions The genetic variants of G2/M checkpoint genes had a molecular impact on the genesis of HIV-1 infection and AIDS progression in northern Chinese MSM population.

Background: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results: Our results showed the mutation of 24-base pair duplication (c.183_ 206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Polycystic kidney disease (PKD) is a life‑threatening inherited disease with a morbidity of 1:500‑1,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin‑1, lipoxygenase, α‑toxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the N‑terminal domain of polycystin‑1 may present high pathogenicity in ADPKD.

This article has been withdrawn at the request of the author(s) and/or editor. The Publisher apologizes for any inconvenience this may cause. The full Elsevier Policy on Article Withdrawal can be found at https://www.elsevier.com/about/our-business/policies/article-withdrawal

Double minute chromosomes ( DMs ) are extrachromosomal cytogenetic structures found in tumour cells. As hallmarks of gene amplification, DMs often carry oncogenes and drug‐resistance genes and play important roles in malignant tumour progression and drug resistance. The mitogen‐activated protein kinase ( MAPK ) signalling pathway is frequently dysregulated in human malignant tumours, which induces genomic instability, but it remains unclear whether a close relationship exists between MAPK signalling and DMs . In the present study, we focused on three major components of MAPK signalling, ERK1 /2, JNK1 /2/3 and p38, to investigate the relationship between MAPK and DM production in tumour cells. We found that the constitutive phosphorylation of ERK1 /2, but not JNK1 /2/3 and p38, was closely associated with DMs in tumour cells. Inhibition of ERK1 /2 activation in DM ‐containing and ERK1 /2 constitutively phosphorylated tumour cells was able to markedly decrease the number of DMs , as well as the degree of amplification and expression of DM ‐carried genes. The mechanism was found to be an increasing tendency of DM DNA to break, become enveloped into micronuclei ( MNs ) and excluded from the tumour cells during the S/ G 2 phases of the cell cycle, events that accompanied the reversion of malignant behaviour. Our study reveals a linkage between ERK1 /2 activation and DM stability in tumour cells. © 2014 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.

OBJECTIVE:To establish a mouse model bearing human choriocarcinoma xenograft in severe combined immuno-deficient (SCID) beige mice and investigate the disease course and biological behaviors of the tumors.METHODS:Human choriocarcinoma JAR cells were injected in female SCID beige mice (3-5 weeks old) either subcutaneously (group A, n=6) or via the tail vein (group B, n=6). Morphological studies, radioactive immunoassay, in vivo tumor imaging and histopathological examinations were performed to confirm JAR cell engraftment at the subcutaneous injection site and in the lungs of the mice.RESULTS:On day 28 after tumor cell inoculation, the mice in group A showed palpable subcutaneous nodules, and HE staining revealed morphological features of the nodules consistent with choriocarcinoma cells; in vivo imaging in group B showed single or multiple solid tumor masses in the lungs, and tissue biopsy examination demonstrated varying degrees of tumor cell infiltration. Compared with the control mice, peripheral blood β-HCG levels in both groups A and B increased significantly on day 14 after cell inoculation (P<0.05), and the increment was more conspicuous in group B (P<0.05).CONCLUSION:Mouse models bearing human choriocarcinoma xenograft can be successfully established by injecting JAR cells either subcutaneously or via the tail vein to mimic the characteristics of epithelial solid tumors and lung metastasis of human choriocarcinoma.

Background: The tumor suppressor gene CDKN2A generates at least three different transcriptional variants, each of which is thought to encode a tumor suppressor. However, the inhibitory activities of these variants have not yet been compared in the same cells. Protein therapy is known to have several advantages over gene therapy. Thus, investigation of the exogenous protein molecule of the most effective suppressor may yield meaningful information regarding protein-based cancer therapy. Methods: The inhibitory effects of p16INK4a, p14ARF and p12 were studied in the human lung cancer cell line A549 which lacks the CDKN2A locus. The eukaryotic expression plasmids of the three transcriptional variants were constructed and stably transfected into the cells. RNA and protein expression by the plasmids was confirmed using RTPCR and fluorescence immunocytochemistry, respectively. Cell growth inhibition and cell-cycle redistribution after transfection were investigated based on growth curve and flow cytometry analyses. An exogenous His-tag fusion p16INK4a protein was obtained and purified by affinity chromatography. Cell growth inhibition and cell cycle arrest induced by the expression of p16INK4a protein were measured in A549 cells transduced with the exogenous protein. Results: While all three variants suppressed cell growth, p16INK4a had the strongest effect. Marked G1-phase accumulation and S-phase inhibition were induced by p16INK4a and p14ARF but not by p12. Exogenous p16INK4a protein was successfully expressed and purified and transduction of the fusion protein into A549 cells inhibited cell growth by G1TS arrest. Conclusions: Among the three transcript variants, p16INK4a has a greater inhibitory effect than p14ARF and p12; exogenous p16INK4a protein should be further investigated for use in cancer therapy as a protein agent. Background The cell cycle is a strictly ordered process regulated by positive regulators, including cyclins and cyclin-dependent kinase (CDKs), and by negative regulators, such as cyclin-dependent kinase inhibitors (CKIs) [1]. There are two tyepes of CKIs: the INK4 family, which includes CDKN2A, and the CIP/KIP family, of which, p21, directly inducible by p53, is an example. Cell cycle regulators are frequently mutated in many types of cancers such that cancer is now considered a cell cycle disease[2]. Accordingly, cell cycle regulators have become an important focus in carcinogenesis research and cancer therapy. The tumor suppressor gene CDKN2A, located at 9p21, generates at least three structurally and functionally unrelated transcriptional variants: p16INK4a, p14ARF and p12 [3]. In terms of structure, p16INK4a and p14ARF share the exon 2 and 3 but use unique first exons and utilize different reading frames. p16INK4a utilizes exon 1α and p14ARF utilizes exon 1β which is 20 kb upstream of exon 1α. p12 is a splice variant of an alternative donor splice site within intron 1 of p16INK4a which contains exon1α and a novel intron-1-encoded C-terminus[4]. (Figure 1). The protein products of these transcripts function via different pathways. p16INK4a specifically * Correspondence: fusb@ems.hrbmu.edu.cn 1 Laboratory of Medical Genetics, Harbin Medical University, Harbin 150081, China † Contributed equally Full list of author information is available at the end of the article © 2010 Zhang et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Zhang et al. Journal of Experimental & Clinical Cancer Research 2010, 29:74 http://www.jeccr.com/content/29/1/74 Page 2 of 8 binds to the cyclin-dependent kinases CDK4/6, thereby inhibiting the phosphorylation of the retinoblastoma protein (pRB) and causing cell-cycle arrest at the G1 phase [5]. p14ARF interacts with MDM2, which targets p53 for degradation, thereby inducing p53-dependent cell-cycle arrest in both G1 and G2 phases [6,7]. p53 participates in a wide range of activities including growth arrest, DNA repair and apoptosis and nearly 50% of human tumors have defects in p53 [8]. Less is known about p12; pRBindependent growth suppression by p12 was reported in pancreatic cells, but the tumor suppressive and cell-cycle effects of this protein are as yet unclear [4]. The CDKN2A locus is frequently inactivated in a wide variety of tumors[9-12]. Kamb examined 290 tumor cell lines and detected CDKN2A deletion in 133 of them [13]. Park examined 31 non-small cell lung cancer (NSCLC) cell lines and found that the inactivation rate of p16INK4a and p14ARF was 84% and 55% respectively. Significantly, p16INK4a was inactivated in all cell lines in which p14ARF was inactivated[14]. Conversely, restoration of the transcripts in tumors with endogenous expression deficiency has been shown to reverse the malignant phenotypes of many tumors. In lung cancer cells, for examples, Zhang X et al restored the expression of p16INK4a in A549 cells and showed that p16INK4a could suppress cell growth and block G1-S cell cycle transition both in vitro and in vivo[15]. Elevated p16INK4a protein expression also enhanced the sensitivity to cisplatin treatment of NSCLC cells[16]. Xie Qi-chao et al co-transfected p16INK4a and p14ARF into the A549 cells and found that cell growth arrest and apoptosis were induced [17]. As for p12, little is known about its status and tumor-suppressive effects. Keith et al transfected a p12 eukaryotic expression vector into C-33A and PANC-1 cells and found that the expression of the protein suppressed cell growth by 40% and 60%, respectively, and found no relationship with RB state. While all three transcripts are potential tumor suppressors in different genetic backgrounds, they may have different effects and mechanisms. So far, the activity of the transcriptional variants under the same condition has not been studied, nor is it known which variant has the strongest suppression effect. Inactivation of the CDKN2A locus has been shown to efficiently impair expression of the three transcripts simultaneously [18]. Thus, in tumors deficient in all three transcripts, it is of interest to compare the effects of each one against the same tumor background, considering the potential significance of the findings with respect to cancer therapy. Accordingly, the aim of the present study was to individually restore expression of the three transcripts in a lung-cancer cell line with endogenous expression deficiency and then to compare the inhibitory effects of each one. Distinguishing the different effects of the CDKN2A variants will identify whether they differ in their growth-inhibiting effects. This approach will, in addition, reveal the function of p12 in lung cancer cells Along with gene therapy, the use of protein therapeutic agents is rapidly developing[19,20]. More encouragingly, protein therapy has been shown to overcome the drawbacks of vector-associated toxicity and immune responses associated with gene therapy and to avoid its delayed therapeutic impacts due to the need for transcription and translation of the encoded protective protein[21]. It is therefore meaningful to identify the most effective and useful suppressor for future applications as a protein therapeutic agent. Here, the different growth inhibition effects of p16INK4a, p14ARF and p12 were investigated in a study that included the exogenous expression, purification and function of the p16INK4a protein. Our results demonstrated the different effects of the three transcripts on cell Figure 1 The three transcriptional variants of CDKN2A. The CDKN2A gene located at 9p21 generates three transcriptional variants at transcription: p16INK4a, p14ARF and p12. p16INK4a utilizes exon1α, and p14ARF utilizes exon 1β which is about 20 kb upstream of exon 1α. p16INK4a and p14ARF share common exon 2 and exon 3 but use different reading frames. p12 uses an alternative splice donor site within intron1 of p16INK4a. Zhang et al. Journal of Experimental & Clinical Cancer Research 2010, 29:74 http://www.jeccr.com/content/29/1/74 Page 3 of 8 growth and their activity at different phases of the cell cycle. Among the three variants, p16INK4a was shown to more effectively suppress the growth of A549 lung cancer cells. Our research on the p16INK4a protein could facilitate or improve the basic understanding of future cancer biotherapy with the p16INK4a protein. Methods Cell culture The human lung cancer cell line A549, deficient in the CDKN2A locus and wild-type in RB and p53 [22], was obtained from the Cell Resource Center of the Shanghai Academy of Sciences The cells were cultured in F12-K medium (Sigma-Aldrich, St.Louis, MO) supplemented with 10% fetal bovine serum (FBS) (GIBCO BRL) in a humidified 5% CO2 air incubator at 37°C. Plasmids construction and stable transfection Full-length fragments of complementary DNA (cDNA) corresponding to p16INK4a, p14ARF and p12 were obtained by reverse transcription polymerase chain reaction (RT-PCR) from AGZY and H446 cells and normal pancreas tissue, respectively, which were positive for the respective transcript. The PCR products were cloned into pGEM-T vector (Promega, Medison, WI). The PCR products were cloned into the vector pGEM-T (Promega, Medison, WI) and the transcripts PCR-amplified using primers containing the same restriction-enzyme sites as the clone vector plasmids. Primers for p16INK4a were 5'CCCAAGCTTGCATGGAGCCGGCGGCG-3' and 5'CGGGATCCCTTTCAATCGGGGATGT-3'. Primers for p14ARF were 5'-CCCAAGCTTAGATGGGCAGGGGGCGG-3' and 5'-CGGGATCCCTCCTCAGCCAGGTCCA-3'. Primers for p12 were 5'CCCAAGCTTGCATGGAGCCGGCGGCG-3' and 5'CGGGATCCCCTCATTCCTCTTCCTT-3'. The PCR products and pcDNA3 vector were double-digested with HindIII and BamHI (TaKaRa, Japan). Eukaryotic expression plasmids were constructed, verified by DNA sequencing, and then used t