Protein tyrosine phosphatases, together with protein tyrosine kinases, control many molecular signaling steps that control life at cellular and organismal levels. Impairing alterations in the genes encoding the involved proteins is expected to profoundly affect the quality of life-if compatible with life at all. Here, we review the current knowledge on the effects of germline variants that have been reported for genes encoding a subset of the protein tyrosine phosphatase superfamily; that of the thirty seven classical members. The conclusion must be that the newest genome research tools produced an avalanche of data that suggest 'guilt by association' for individual genes to specific disorders. Future research should face the challenge to investigate these accusations thoroughly and convincingly, to reach a mature genotype-phenotype map for this intriguing protein family.

Ever since the association between FLG loss-of-function variants and ichthyosis vulgaris and atopic dermatitis disease onset was identified, FLGs function has been under investigation. Intraindividual genomic predisposition, immunological confounders, and environmental interactions complicate the comparison between FLG genotypes and related causal effects. Using CRISPR/Cas9, we generated human FLG-knockout (ΔFLG) N/TERT-2G keratinocytes. FLG deficiency was shown by immunohistochemistry of human epidermal equivalent cultures. Next to (partial) loss of structural proteins (involucrin, hornerin, keratin 2, and transglutaminase 1), the stratum corneum was denser and lacked the typical basket weave appearance. In addition, electrical impedance spectroscopy and transepidermal water loss analyses highlighted a compromised epidermal barrier in ΔFLG human epidermal equivalents. Correction of FLG reinstated the presence of keratohyalin granules in the stratum granulosum, FLG protein expression, and expression of the proteins mentioned earlier. The beneficial effects on stratum corneum formation were reflected by the normalization of electrical impedance spectroscopy and transepidermal water loss. This study shows the causal phenotypical and functional consequences of FLG deficiency, indicating that FLG is not only central in epidermal barrier function but also vital for epidermal differentiation by orchestrating the expression of other important epidermal proteins. These observations pave the way to fundamental investigations into the exact role of FLG in skin biology and disease.

Late cornified envelope (LCE) proteins are small cationic epidermal proteins with antimicrobial properties, and the combined deletion of LCE3B and LCE3C genes is a risk factor for psoriasis that affects skin microbiome composition. In a yeast two-hybrid screen, we identified CYSRT1 as an interacting partner of members of all LCE groups except LCE6. These interactions were confirmed in a mammalian cell system by coimmunoprecipitation. CYSRT1 is a protein of unknown function that is specifically expressed in cutaneous and oral epithelia and spatially colocalizes with LCE proteins in the upper layers of the suprabasal epidermis. Constitutive CYSRT1 expression is present in fully differentiated epidermis and can be further induced in vivo by disruption of the skin barrier upon stratum corneum removal. Transcriptional regulation correlates to keratinocyte terminal differentiation but not to skin bacteria exposure. Similar to LCEs, CYSRT1 was found to have antibacterial ac-tivity against Pseudomonas aeruginosa. Comparative gene sequence analysis and protein amino acid alignment indicate that CYSRT1 is highly conserved among vertebrates and has putative antimicrobial activity. To sum-marize, we identified CYSRT1 in the outer skin layer, where it colocalizes with LCE proteins and contributes to the constitutive epidermal antimicrobial host defense repertoire.Journal of Investigative Dermatology (2023) 143, 1498e1508; doi:10.1016/j.jid.2023.01.022

Congenital disorders of glycosylation (CDG) are inherited metabolic diseases characterized by mutations in enzymes involved in different steps of protein glycosylation, leading to aberrant synthesis, attachment or processing of glycans. Recently, immunological dysfunctions in several CDG types have been increasingly documented. Despite these observations, detailed studies on immune cell dysfunction in PMM2-CDG and other CDG types are still scarce. Studying PMM2-CDG patient immune cells is challenging due to limited availability of patient material, which is a result of the low incidence of the disease and the often young age of the subjects. Dedicated immune cell models, mimicking PMM2-CDG, could circumvent many of these problems and facilitate research into the mechanisms of immune dysfunction. Here we provide initial observations about the immunophenotype and the phagocytic function of primary PMM2-CDG monocytes. Furthermore, we assessed the suitability of two different glycosylation-impaired human monocyte models: tunicamycin-treated THP-1 monocytes and PMM2 knockdown THP-1 monocytes induced by shRNAs. We found no significant differences in primary monocyte subpopulations of PMM2-CDG patients as compared to healthy individuals but we did observe anomalous surface glycosylation patterns in PMM2-CDG patient monocytes as determined using fluorescent lectin binding. We also looked at the capacity of monocytes to bind and internalize fungal particles and found a slightly increased uptake of C. albicans by PMM2-CDG monocytes as compared to healthy monocytes. Tunicamycin-treated THP-1 monocytes showed a highly decreased uptake of fungal particles, accompanied by a strong decrease in glycosylation levels and a high induction of ER stress. In contrast and despite a drastic reduction of the PMM2 enzyme activity, PMM2 knockdown THP-1 monocytes showed no changes in global surface glycosylation levels, levels of fungal particle uptake similar to control monocytes, and no ER stress induction. Collectively, these initial observations suggest that the absence of ER stress in PMM2 knockdown THP-1 cells make this model superior over tunicamycin-treated THP-1 cells and more comparable to primary PMM2-CDG monocytes. Further development and exploitation of CDG monocyte models will be essential for future in-depth studies to ultimately unravel the mechanisms of immune dysfunction in CDG.

Skin barrier function is the result of orchestrated terminal differentiation of keratinocytes, forming the lipid-surrounded hydrophobic cornified envelope of the stratum corneum. CRISPR-Cas9 has the potential to meticulously dissect the functional and structural components of the stratum corneum by precisely editing any gene of interest. We here illustrate the complementary possibilities of introducing CRISPR-Cas9 machinery in immortalized N/TERT keratinocytes to generate Filaggrin knockout (ΔFLG) isogenic cell lines and organotypic human ΔFLG epidermal equivalents (ΔFLG- HEE). FLG deficiency was accompanied by (partial) loss of other structural and functional proteins, such as involucrin, hornerin, and transglutaminases. Consequently, transepithelial electrical resistance (TEER) indicated a decreased barrier function in ΔFLG-HEEs. Homology directed repair of the ΔFLG clonal lines reinstated FLG protein expression and the concomitant expression of the aforementioned epidermal differentiation proteins in FLG-restored HEEs. The phenotypical consequences of FLG deficiency in cell lines with an identical genetic background and in absence of predicted CRISPR-Cas9 off-target effects indicate a functional role for FLG – not only in epidermal barrier function – but also in epidermal barrier development which provides new insights into the disease pathogenesis of atopic dermatitis and ichthyosis vulgaris.

Clinical data suggest that the protein tyrosine phosphatase PTPN13 exerts an anti-oncogenic effect. Its exact role in tumorigenesis remains, however, unclear due to its negative impact on FAS receptor-induced apoptosis. Methods: We crossed transgenic mice deleted for PTPN13 phosphatase activity with mice that overexpress human HER2 to assess the exact role of PTPN13 in tumor development and aggressiveness. To determine the molecular mechanism underlying the PTPN13 tumor suppressor activity we developed isogenic clones of the aggressive human breast cancer cell line MDA-MB-231 overexpressing either wild type or a catalytically-inactive mutant PTPN13 and subjected these to phosphoproteomic and gene ontology analyses. We investigated the PTPN13 consequences on cell aggressiveness using wound healing and Boyden chamber assays, on intercellular adhesion using videomicroscopy, cell aggregation assay and immunofluorescence. Results: The development, growth and invasiveness of breast tumors were strongly increased by deletion of the PTPN13 phosphatase activity in transgenic mice. We observed that PTPN13 phosphatase activity is required to inhibit cell motility and invasion in the MDA-MB-231 cell line overexpressing PTPN13. In vivo, the negative PTPN13 effect on tumor invasiveness was associated with a mesenchymal-to-epithelial transition phenotype in athymic mice xenografted with PTPN13-overexpressing MDA-MB-231 cells, as well as in HER2-overexpressing mice with wild type PTPN13, compared to HER2-overexpressing mice that lack PTPN13 phosphatase activity. Phosphoproteomic and gene ontology analyses indicated a role of PTPN13 in the regulation of intercellular junction-related proteins. Finally, protein localization studies in MDA-MB-231 cells and HER2-overexpressing mice tumors confirmed that PTPN13 stabilizes intercellular adhesion and promotes desmosome formation. Conclusions: These data provide the first evidence for the negative role of PTPN13 in breast tumor invasiveness and highlight its involvement in cell junction stabilization.

N-glycosylation of membrane receptors is important for a wide variety of cellular processes. In the immune system, loss or alteration of receptor glycosylation can affect pathogen recognition, cell-cell interaction, and activation as well as migration. This is not only due to aberrant folding of the receptor, but also to altered lateral mobility or aggregation capacity. Despite increasing evidence of their biological relevance, glycosylation-dependent mechanisms of receptor regulation are hard to dissect at the molecular level. This is due to the intrinsic complexity of the glycosylation process and high diversity of glycan structures combined with the technical limitations of the current experimental tools. It is still challenging to precisely determine the localization and site-occupancy of glycosylation sites, glycan micro- and macro-heterogeneity at the individual receptor level as well as the biological function and specific interactome of receptor glycoforms. In addition, the tools available to manipulate N-glycans of a specific receptor are limited. Significant progress has however been made thanks to innovative approaches such as glycoproteomics, metabolic engineering, or chemoenzymatic labeling. By discussing examples of immune receptors involved in pathogen recognition, migration, antigen presentation, and cell signaling, this Mini Review will focus on the biological importance of N-glycosylation for receptor functions and highlight the technical challenges for examination and manipulation of receptor N-glycans.

Study motivation and knowledge retention benefit from regular student self-assessments. Inclusion of certainty-based learning (CBL) in computer-assisted formative tests may further enhance this by enabling students to identify whether they are uninformed or misinformed regarding the topics tested, which may trigger future study actions including instructor consultation. Using a cross-over study design involving two out of thirteen computer-assisted formative assessments (CAFAs) of a first-year cell biology course, we compared student-instructor interactions, student learning experiences and final exam scores between two (bio)medical science student cohorts who worked with different CBL-containing CAFAs. A total of 389 students participated in the study. After completion 159 (41%) filled in a questionnaire on their experience with CBL during supervised CAFAs. In the control group the median duration of student-instructor interactions was 90 s (range 60–140 s), and this increased with 20 s to 110 s (range 60–150 s) in the group working with a CBL-based CAFA. The number of interactions was similar in both groups (0.22 per student per hour, regardless of CBL inclusion). Forty percent of the students expected that CBL would positively influence their study behavior, and 23% also anticipated a positive effect on examination scores. Student examination scores, however, were not affected by CBL. Almost half of the students (43%) were in favor of CBL inclusion in future computer-assisted learning modules, whereas 33% did not see merit in including CBL in CAFAs. Incorporation of CBL in a single formative assessment led to a slight increase in student-instructor interaction times, but had effect neither on the number of student-instructor interactions nor on exam scores. CBL inclusion positively influenced student’s appreciation of the coursework, presumably by helping students to evaluate their mastery level and identify misconceptions. A more extensive enrollment of CBL beyond an individual formative assessment, throughout a course or a curriculum, may possibly reveal positive effects on study efficacy.

Directional cell migration in dense three-dimensional (3D) environments critically depends upon shape adaptation and is impeded depending on the size and rigidity of the nucleus. Accordingly, the nucleus is primarily understood as a physical obstacle; however, its pro-migratory functions by stepwise deformation and reshaping remain unclear. Using atomic force spectroscopy, time-lapse fluorescence microscopy and shape change analysis tools, we determined the nuclear size, deformability, morphology and shape change of HT1080 fibrosarcoma cells expressing the Fucci cell cycle indicator or being pre-treated with chromatin-decondensating agent TSA. We show oscillating peak accelerations during migration through 3D collagen matrices and microdevices that occur during shape reversion of deformed nuclei (recoil), and increase with confinement. During G1 cell-cycle phase, nucleus stiffness was increased and yielded further increased speed fluctuations together with sustained cell migration rates in confinement when compared to interphase populations or to periods of intrinsic nuclear softening in the S/G2 cell-cycle phase. Likewise, nuclear softening by pharmacological chromatin decondensation or after lamin A/C depletion reduced peak oscillations in confinement. In conclusion, deformation and recoil of the stiff nucleus contributes to saltatory locomotion in dense tissues.This article is part of a discussion meeting issue ‘Forces in cancer: interdisciplinary approaches in tumour mechanobiology’.

Diffuse gliomas often carry point mutations in isocitrate dehydrogenase ( IDH1mut), resulting in metabolic stress. Although IDHmut gliomas are difficult to culture in vitro, they thrive in the brain via diffuse infiltration, suggesting brain-specific tumor-stroma interactions that can compensate for IDH-1 deficits. To elucidate the metabolic adjustments in clinical IDHmut gliomas that contribute to their malignancy, we applied a recently developed method of targeted quantitative RNA next-generation sequencing to 66 clinical gliomas and relevant orthotopic glioma xenografts, with and without the endogenous IDH-1R132H mutation. Datasets were analyzed in R using Manhattan plots to calculate distance between expression profiles, Ward's method to perform unsupervised agglomerative clustering, and the Mann Whitney U test and Fisher's exact tests for supervised group analyses. The significance of transcriptome data was investigated by protein analysis, in situ enzymatic activity mapping, and in vivo magnetic resonance spectroscopy of orthotopic IDH1mut- and IDHwt-glioma xenografts. Gene set enrichment analyses of clinical IDH1mut gliomas strongly suggest a role for catabolism of lactate and the neurotransmitter glutamate, whereas, in IDHwt gliomas, processing of glucose and glutamine are the predominant metabolic pathways. Further evidence of the differential metabolic activity in these cancers comes from in situ enzymatic mapping studies and preclinical in vivo magnetic resonance spectroscopy imaging. Our data support an evolutionary model in which IDHmut glioma cells exist in symbiosis with supportive neuronal cells and astrocytes as suppliers of glutamate and lactate, possibly explaining the diffuse nature of these cancers. The dependency on glutamate and lactate opens the way for novel approaches in the treatment of IDHmut gliomas.-Lenting, K., Khurshed, M., Peeters, T. H., van den Heuvel, C. N. A. M., van Lith, S. A. M., de Bitter, T., Hendriks, W., Span, P. N., Molenaar, R. J., Botman, D., Verrijp, K., Heerschap, A., ter Laan, M., Kusters, B., van Ewijk, A., Huynen, M. A., van Noorden, C. J. F., Leenders, W. P. J. Isocitrate dehydrogenase 1-mutated human gliomas depend on lactate and glutamate to alleviate metabolic stress.

Proper control of the phosphotyrosine content in signal transduction proteins is essential for normal cell behavior and is lost in many pathologies. Attempts to normalize aberrant tyrosine phosphorylation levels in disease states currently involve either the application of small compounds that inhibit tyrosine kinases (TKs) or the addition of growth factors or their mimetics to boost receptor-type TK activity. Therapies that target the TK enzymatic counterparts, the multi-enzyme family of protein tyrosine phosphatases (PTPs),are still lacking despite their undisputed involvement in human diseases. Efforts to pharmacologically modulate PTP activity have been frustrated by the conserved structure of the PTP catalytic core, providing a daunting problem with respect to target specificity. Over the years, however, many different protein interaction-based regulatory mechanisms that control PTP activity have been uncovered, providing alternative possibilities to control PTPs individually. Here, we review these regulatory principles, discuss existing biologics and proteinaceous compounds that affect PTP activity, and mention future opportunities to drug PTPs via these regulatory concepts.

Using a mouse protein tyrosine phosphatase rescence in situ hybridization. In an intronic region o f the IA-2 cDNA fragment as a probe, cosmid clones containing segments gene a polymorphic microsatellite sequence was found, which of the hum an IA-2 PTPase gene (PTPRN) were isolated. The will be useful as a genetic m arker for the 2q35 —» q36 region, gene was assigned to chromosome region 2q35 -> q36.1 by fluoIn recent years, protein tyrosine phosphatases (PTPases), tyrosine phosphatase domain, whereas the receptor-type which oppose the actions of protein tyrosine kinases (PTKs), PTPases generally contain two tandemly repeated cytoplasmic have gained attention as regulators of important cellular protyrosine phosphatase domains. Exceptions are, for example, cesses, such as cell growth and differentiation (Walton and DixPTP-SL (Hendriks et al., 1995) and IA-2 (Lan et a l , 1994; Lu et on, 1993). The phosphotyrosine content of cellular proteins is al., 1994), which are transm em brane proteins with only a single determined by a balanced action of PTKs and PTPases; in tyrosine phosphatase domain. some cases these enzymes have been shown to work in concert We mouse PTPase cDNA fragment, in signal transduction networks, which carry signals from the mPTP38 (Hendriks et al., 1995), that was identical to secell membrane to the nucleus (Brady-Kalnay and 1994). quences within mouse IA-2 cDNA (Lu et al., 1994). In this paper, we describe the use of m PTP38 as a probe to isolate Until now, a substantial num ber of PTPase genes has been mouse full-length cDNAs and hum an genomic cosmid clones identified, which can be classified into two large subgroups: for IA-2. The human IA-2 gene (PTPRN) ( 1) the cytosolic and nuclear PTPases and (2) the receptor-type chromosome region 2q35 —> q36 .1. PTPases. As a rule, the cytosolic and nuclear PTPases have one Materials and methods Supported by a grant from the Dutch Cancer Society (Koningin Wilhelmina F Received 12 April 1995; revision accepted 13 December 1995. Request reprints from Dr, W.J.A.J. Hendriks, Department of Cell Biology and Histology, University of Nijmegen, Adelbertusplein 1, PO Box 9101, 65001-IB Nijmegen (The Netherlands); telephone: +31-80-614329; fax: +31-80-540525; e-mail: kuncelbl@cammsl.caos.kun.nl. Isolation o f IA-2 cDNA and genomic clones The 368-bp PCR fragment mPTP38 (Hendriks et al., 1995), was labeled radioactively by random priming and used as a probe to screen a mouse brain cDNA phage library (Stratagcne). Hybridization conditions were those as described by Hendriks et al. (1995). After hybridization, fil­ ters were washed two times at high stringency (0.1 % SDS, 0.04 M sodium phosphate [pH 7.4], 1 inM EDTA) for 20 min at 65 °C. Positively hybridiz­ ing phages were plaque-purified, and the inserts were rescued as pBlueK A R G E R E-mail karger@kargcr,ch Fax + 41 61 306 12 34 http:// www, karger, ch © 1996 S. Karger AG, Basel 0301-0171/96/0732-0145$ 10.00/0 V W E S G C T V I V M L T P L V E D G V tctgtccctag AT GGT GTG GGA GAG CGG CTG CAC CGT CAT CGT CAT GCA CAC CCC GCT GGT GGA GGA TGG TGT K Q C D R Y W P D E G A S L Y H CAA GCA GTG TGA CCG CTA CTG GCC AGT TGA GGG TGC CTC CCT CTA CCA C gtatataaggtcagcagggccccacagca aggggacaatggatgtgggaagagtagatgatggccttttcgtaacgttttcttcaccaaatgagcactcaacagtcttttaaaaaggcttttat tggccctgctcatgattcatacatatatgaatatatataaacacatatatgcatacccatatattcacatatatatacatgtgtgtgtcctgttt gcccggggtgggcgaagaactccagcatgagattcgggtacc Fig. 1. Genomic sequence of part of the human PTP38/IA2 gene present in clone PTP3S/7.16S (GenBank accession No. Z48226). Exon sequences that correspond to nucleotides 2,462 to 2,572 in the IA-2 cDNA sequence (Lan et al., 1994) are in capital letters; intronic regions are depicted in lower-case letters. Above the exonic sequence the deduced amino acid sequence is shown in single letter notation. The sequence amplified by primer set F388 and R388 is underlined. The microsatellite is doubly under­ lined. Script SK plasmids (Stratagene), following the instructions of the manufacsteps using rabbit-anti-FITC and mouse-anti-rabbit-FITC. A Zeiss epifluorturer, and sequenced. escence microscope was used for visual examination of the chromosome The same mouse probe was used to screen a human genomic library in slides. Digital images were obtained using a high-performance cooled CCD cosmid vector Supercos 1, kindly provided by Dr Marten Hofker (University camera (Photometries) coupled to a Macintosh Ilci computer. The Oncorof Leiden, The Netherlands). Hybridization and washing conditions were as Image F.I.S.H. software package (Oncor-Imaging) was used for analysis of described above. the digital images. Characterization o f a microsatellite al the human PTPRN locus Sau3A subclones from cosmid PTP38/7 were screened for the presence of microsatellite sequences by hybridizing recombinants-containing filters for 2 h at 37 °C in 5 x SSPE, 0.3% SDS with a mixture of oligonucleotides that were 5' end-labeled using [y-^PJATP and T4 polynucleotide kinase (Life Technologies). The oligonucleotide mixture consisted of 100 ng of oligonu­ cleotide (GA)7, (TG)7, (CAC)5, and (CTG)s, each. The insert of one positive clone (PTP38/7.16) was further shortened by Sstl digestion and self-ligation, yielding clone PTP38/7.16S, and sequenced. Results and discussion Polymerase chain reaction (PCR) Based on sequence information in clone PTP38/7.16S, unique oligonu­ cleotides flanking the IA-2 microsatellite were designed and tested in a PCR, PCR was performed in a 50-p.l volume containing 40 ng of genomic DNA, 50 We recently isolated three novel mouse PTPase cDNA frag­ ments (Hendriks et al., 1995) using degenerate primers based on conserved catalytic domains in the rapidly expanding gene family (Walton and Dixon, 1993). One of these fragments, mPTP38 (Z23060), corresponds to a 4-kb transcript that is exclusively expressed in mouse brain (Hendriks et al., 1995). To obtain full-length cDNA clones, a mouse brain cDNA libra­ ry was screened using m PTP38 as a probe. In this way, a 3.6-kb raM KC1, 20 mM Tris-HCl (pH 8.3), 1.0 mM MgCl2, 0.01 % gelatin, 0,1 % cDNA clone (PTP38-32) was isolated and sequenced entirely. Triton-XlOO, and 100 ng of oligonucleotides F38 8 (5'-GGCCCTGCTCATWhile this work was nearing completion, the sequence of a GATTC-3' and R388 (5'-TCTATGAACGCTTTTTGACTC-3'). Oligonu­ cleotide F388 was 5' end-labeled with [y-32P]ATP and T4 polynucleotide kinase. After an initial denaturation step of 5 min at 950 C, 1 U of Taq polymouse cDNA clone designated mIA-2 was published (Lu et al., 1994) that appeared to be identical to our clone. The mouse merase was added to the reaction mixture, and 32 cycles were performed; IA-2 cDNA also exhibits 92% identity with the published each cycle involved denaturation at 940 C for 45 s, annealing at 430 C for 30 hum an IA-2 cDNA (Lan et al., 1994) that was isolated from an s, and elongation at 7 2 0 C for 40 s, with a final extension step of 5 min at 720 C. PCR products were separated on 6 % denaturating polyacrylamide gels, and bands were visualized by autoradiography at 8 0 0 C. Fluorescence in situ hybridization (FISH) Nonradioactive in situ hybridization to normal human lymphocyte metaphase spreads was performed essentially according to De Leeuw et al. (1993). Briefly, cosmid DNA (1 jag) was labeled with biotin-14-dATP (Life Technologies) by nick-translation, purified, and ethanol precipitated togeth­ er with a 50-fold excess of Cot-1 DNA (Life Technologies). Subsequently, 250 ng was dissolved in 12 jj.1 of hybridization mixture consisting o f 2 x SSC, 10 % dextran sulfate, 1 % Tween-20, and 50 % formamide. The hybridization mixture was heat-denatured and then incubated overnight at 37 °C to heatdenatured chromosome spreads enclosed under a cover slip. Immunocytochcmical detection of the hybridizing probes was achieved using fluorescein insulinoma subtraction library. Very recently, the putative rat homolog of IA-2, called PTPLP, has been reported to show 98.4% homology in amino acid sequence with the intracellular part of the mIA-2 protein (Kambayashi et al., 1995). Using cDNA fragment m PTP-38 as a probe, seven indepen­ dent, but overlapping, hum an IA-2 genomic cosmid clones (PTP38/1 through PTP38/7), spanning approximately 50 kb, were isolated. Their identity as PT PR N gene-containing cosmids was confirmed by sequence analysis o f an 0 .8-kb subclone (PTP38/7.16S), originating from cosmid PTP38/7, that con­ tains a region that is 100% identical to nucleotides 5,462 to 2,572 of the IA-2 cDNA (Lan et al., 1994) (Fig. 1). In the same isothiocyanate (FITC)-conjugated avidin, followed by two amplification subclone a microsatellite repeat o f 14 CA dinucleotides was 146 Cytogenet Cell Genet 73:145-148 (1996) Fig. 2. Chromosomal localization of the human PTPRN gene by FISH. The arrows indicate the location of the hybridization signals of the biotinylated probe (cosmid PTP38/7) to human metaphase chromosome spreads. identified. Oligonucleotides flanking this repeat were designed tumors originating from tissues that normally express IA-2, to amplify a segment of 163 bp and test the polymorphic value Frequent allelic losses of chromosome 2q have been reported in of this microsatellite, using DNA of 37 unrelated Caucasian non-small cell lung carcinoma, colorectal carcinoma, and neuindividuals. Four alleles were observed, with frequencies of roblastom a(Tsuchiyaetal., 1992; K ohnoet al., 1994; Shiseki et 0.054(167 bp), 0.20 (165 bp), 0.73 (163 bp), and 0.04 (161 bp), a l , 1994), but involvement of PTPase IA-2 remains to beinvesyielding a heterozygosity value o f 0.44. Thus, the polymorphic tigated. Although a potential tum or suppressor was suggested to microsatellite repeat can serve as a genetic marker (D2S1753E) be homozygously deleted at region 2q 33 in a small cell lung for the PTPRN locus. carcinoma cell line (Kohno et a l , 1994), based on our physical The chromosomal localization o f hum an PTPRN was d

The receptor tyrosine kinase (RTK) MET represents a promising tumor target in a subset of glioblastomas. Most RTK inhibitors available in the clinic today, including those inhibiting MET, affect multiple targets simultaneously. Previously, it was demonstrated that treatment with cabozantinib (MET/VEGFR2/RET inhibitor) prolonged survival of mice carrying orthotopic patient-derived xenografts (PDX) of the MET-addicted glioblastoma model E98, yet did not prevent development of recurrent and cabozantinib-resistant tumors. To exclude VEGFR2 inhibition-inflicted blood–brain barrier normalization and diminished tumor distribution of the drug, we have now investigated the effects of the novel MET-selective inhibitor Compound A in the orthotopic E98 xenograft model. In vitro, Compound A proved a highly potent inhibitor of proliferation of MET-addicted cell lines. In line with its target selectivity, Compound A did not restore the leaky blood–brain barrier and was more effective than cabozantinib in inhibiting MET phosphorylation in vivo. Compound A treatment significantly prolonged survival of mice carrying E98 tumor xenografts, but did not prevent eventual progression. Contrasting in vitro results, the Compound A–treated xenografts displayed high levels of AKT phosphorylation despite the absence of phosphorylated MET. Profiling by RNA sequencing showed that in vivo transcriptomes differed significantly from those in control xenografts. Implications: Collectively, these findings demonstrate the plasticity of paracrine growth factor receptor signaling in vivo and urge for prudency with in vitro drug-testing strategies to validate monotherapies. Mol Cancer Res; 15(11); 1587–97. ©2017 AACR.

Terminally differentiating epidermal keratinocytes express a large number of structural and antimicrobial proteins that are involved in the physical barrier function of the stratum corneum and provide innate cutaneous host defense. Late cornified envelope (LCE) genes, located in the epidermal differentiation complex on chromosome 1, encode a family of 18 proteins of unknown function, whose expression is largely restricted to epidermis. Deletion of two members, LCE3B and LCE3C (LCE3B/C-del), is a widely-replicated psoriasis risk factor that interacts with the major psoriasis-psoriasis risk gene HLA-C*06. Here we performed quantitative trait locus analysis, utilizing RNA-seq data from human skin and found that LCE3B/C-del was associated with a markedly increased expression of LCE3A, a gene directly adjacent to LCE3B/C-del. We confirmed these findings in a 3-dimensional skin model using primary keratinocytes from LCE3B/C-del genotyped donors. Functional analysis revealed that LCE3 proteins, and LCE3A in particular, have defensin-like antimicrobial activity against a variety of bacterial taxa at low micromolar concentrations. No genotype-dependent effect was observed for the inside-out or outside-in physical skin barrier function. Our findings identify an unknown biological function for LCE3 proteins and suggest a role in epidermal host defense and LCE3B/C-del-mediated psoriasis risk.

Deficiency of the cysteine protease inhibitor cystatin M/E (Cst6) in mice leads to disturbed epidermal cornification, impaired barrier function, and neonatal lethality. We report the rescue of the lethal skin phenotype of ichq (Cst6-deficient; Cst6-/-) mice by transgenic, epidermis-specific, reexpression of Cst6 under control of the human involucrin (INV) promoter. Rescued Tg(INV-Cst6)Cst6ichq/ichq mice survive the neonatal phase, but display severe eye pathology and alopecia after 4 mo. We observed keratitis and squamous metaplasia of the corneal epithelium, comparable to Cst6-/-Ctsl+/- mice, as we have reported in other studies. We found the INV promoter to be active in the hair follicle infundibulum; however, we did not observe Cst6 protein expression in the lower regions of the hair follicle in Tg(INV-Cst6)Cst6ichq/ichq mice. This result suggests that unrestricted activity of proteases is involved in disturbance of hair follicle biology, eventually leading to baldness. Using quenched activity-based probes, we identified mouse cathepsin B (CtsB), which is expressed in the lower regions of the hair follicle, as an additional target of mouse Cst6. These data suggest that Cst6 is necessary to control CtsB activity in hair follicle morphogenesis and highlight Cst6-controlled proteolytic pathways as targets for preventing hair loss.-Oortveld, M. A. W., van Vlijmen-Willems, I. M. J. J., Kersten, F. F. J., Cheng, T., Verdoes, M., van Erp, P. E. J., Verbeek, S., Reinheckel, T., Hendriks, W. J. A. J., Schalkwijk, J., Zeeuwen, P. L. J. M. Cathepsin B as a potential cystatin M/E target in the mouse hair follicle.

Please be advised that this information was generated on 2017-03-31 and may be subject to change. In order to elucidate the cellular and molecular processes which are involved in Norrie disease (NO), we have used gene targeting technology to generate ND mutant mice. The murine homologue of the ND gene was cloned and shown to encode a polypeptide that shares 94% of the amino acid sequence with its human counterpart. RNA in situ hybridization revealed expression in retina, brain and the olfactory bulb and epithelium of 2 week old mice. Hemizygous mice carrying a replacement mutation in exon 2 of the ND gene developed retrolental structures in the vitreous body and showed an overall disorganization of the retinal ganglion cell layer. The outer plexiform layer disappears occasionally, resulting in a juxtaposed inner and outer nuclear layer. At the same regions, the outer segments of the photoreceptor cell layer are no longer present. These ocular findings are consistent with observations in ND patients and the generated mouse line provides a faithful model for study of early pathogenic events in this severe X-linked recessive neurological disorder.

The infiltrative behavior of diffuse gliomas severely reduces therapeutic potential of surgical resection and radiotherapy, and urges for the identification of new drug-targets affecting glioma growth and migration. To address the potential role of protein tyrosine phosphatases (PTPs), we performed mRNA expression profiling for 91 of the 109 known human PTP genes on a series of clinical diffuse glioma samples of different grades and compared our findings with in silico knowledge from REMBRANDT and TCGA databases. Overall PTP family expression levels appeared independent of characteristic genetic aberrations associated with lower grade or high grade gliomas. Notably, seven PTP genes (DUSP26, MTMR4, PTEN, PTPRM, PTPRN2, PTPRT and PTPRZ1) were differentially expressed between grade II-III gliomas and (grade IV) glioblastomas. For DUSP26, PTEN, PTPRM and PTPRT, lower expression levels correlated with poor prognosis, and overexpression of DUSP26 or PTPRT in E98 glioblastoma cells reduced tumorigenicity. Our study represents the first in-depth analysis of PTP family expression in diffuse glioma subtypes and warrants further investigations into PTP-dependent signaling events as new entry points for improved therapy.