Dermatofibrosarcoma protuberans (DFSP) is a type of intermediately malignant cutaneous spindle cell neoplasms, which is easy to be confused with several benign ones even after needle biopsy, especially cellular fibrous histiocytoma (cFH), resulting in inadequate excision and local recurrence. We found that as a novel skin imaging technique, high-resolution (HR) DCE MRI could distinguish DFSP. The features include infiltration of surrounding fat, ill-defined margins and large quantitative parameters. Both DFSP and cFH have type-III time-signal intensity curves (TICs). In contrast, other confused lesions presented type-II-or-I TIC. The recommendation of preoperative HR-MRI could assist dermatologists to perform surgical plan more confidently.

Since December 1997, highly pathogenic avian influenza A H5N1viruses have swept through poultry populations across Asian countries and been transmitted into African and European countries. We characterized 6 avian influenza H5N1 viruses isolated from humans in 2004 in Thailand. A highly pathogenic (HP) KAN353 strain showed faster replication and higher virulence in embryonated eggs compared to other strains, especially compared to the low pathogenic (LP) SP83 strain. HP KAN353 also showed strong cytopathogenicity compared to SP83 in Madin-Darby canine kidney cells. Interestingly, LP SP83 induced smaller plaques compared to other strains, especially HP KAN353. PB2 amino acid 627E may contribute to low virulence, whereas either PB2 amino acid 627 K or the combination of 627E/701N seems to be associated with high virulence. The in vitro assays used in this study may provide the basis for assessing the pathogenesis of influenza H5N1 viruses in vivo. Introduction H5N1 avian influenza viruses are a causative agent of outbreaks of fatal disease in poultry worldwide, and a cause of fatal infection in humans with a more than 50% mortality rate since 1997 [1,2]http://www.who.int/csr/disease/avian_influenza/country/cases_table_2009_08_11/ en/index.htm. Despite culling of all poultry on farms and probable eradication of the index genotype, novel genotypes have emerged [3]. Since 2004, the Z genotype has become dominant and spread to Southeast Asian countries including Thailand, Vietnam, Cambodia, and Laos [1]. Recently, genotype Z H5N1 viruses have been detected in domestic and wild birds in Central Asia, the Middle East, Africa and Europe, and migratory waterfowl have been implicated in the geographic expansion of the disease [4]. As of August 2009, the cumulative number of confirmed human cases of avian H5N1 influenza reported to the WHO was 438, 262 of which died http:// www.who.int/csr/disease/avian_influenza/country/ cases_table_2009_08_11/en/index.htm. It is important to elucidate the genetic determinants that allow cross species transfer of avian influenza viruses into mammalian populations and to elucidate the molecular basis of the pathogenicity in mammals, since H5N1 viruses isolated from humans in 1997 showed different virulence to mice [5-7]. Katz reported that 9 of 15 H5N1 viruses isolated from humans in Hong Kong in 1997 were highly pathogenic (HP) to mice, whereas 5 of them exhibited a low pathogenic (LP) phenotype, replicating only in the respiratory tract without mortality. The remaining one strain showed an intermediate pathogenicity phenotype [7]. All 15 viruses shared a multi-basic amino acid (aa) motif at the cleavage site between HA1 and HA2 which was lethal for experimentally infected chickens [5,8,9]. One of the HP H5N1 viruses, A/Hong Kong/483/97, contained lysine at aa position 627 in the PB2 protein, whereas one of the LP H5N1 viruses, A/Hong Kong/486/97, contained glutamic acid at the same position, demonstrating that a single aa residue at position 627 was a key molecular determinant for virulence in mice [10]. However, when PB2 aa sequences were compared among the HP H5N1 viruses, only three of the 9 HP H5N1 viruses contained a lysine at PB2 aa residue 627 (627 K) [11,12]. Thus, PB2 aa 627 K alone did not correlate with lethality in mice, suggesting that other genetic variations were involved in virulence in mice but that this residue could not affect replicative efficiency in mice [13]. * Correspondence: yonggang@biken.osaka-u.ac.jp 1 Section of Viral Infections, Thailand-Japan Research Collaboration Center on Emerging and Re-emerging Infections, Tiwanon Road, Muang, Nonthaburi 11000, Thailand Full list of author information is available at the end of the article Li et al. Virology Journal 2010, 7:112 http://www.virologyj.com/content/7/1/112 Page 2 of 7 The high cleavability of the hemagglutinin glycoprotein (HA) was essential for lethal infection in birds, suggesting that the HA protein also plays an important role in the HP phenotype in humans. As HA mediates viral binding to host cell sialic acid-specific receptors and the subsequent fusion of the membrane of the endocytosed virus particles with the endosomal membrane leads to the release of vRNP into the cytoplasm, the cleavage site is associated with H5N1 pathogenicity [10]. Other studies suggested that 92 E of the NS1 protein is important for abrogating the antiviral effects of interferon and tumor necrosis factor alpha, and may be crucial to the pathogenicity in pigs [14]. A recent study demonstrated that aa residue 66 S of PB1-F2 affects the pathogenicity of an H5N1 virus in mice [15]. Since the SP/83/04 (SP83) strain isolated in Thailand in 2004 is LP to ferrets and mice in vivo, and the KAN/353/ 04 (KAN353) strain isolated in Thailand in the same year shows HP to ferrets [16], we used these viruses to characterize in vitro phenotypes associated with the pathogenicity in animals. We also used four H5N1 viruses isolated in Thailand in 2004 from humans. Although a reverse genetics system and animal experiments are needed to confirm the segments involved in the virulence, comparison of the in vitro phenotype described in this study may provide the basis for assessing the pathogenesis of influenza H5N1 viruses in vivo. Materials and methods Viruses and cells Six H5N1 influenza viruses, SP83, KAN353, Thai/1623/ 04 (Thai1623), KK/494/04 (KK494), PCBR/2031/04 (PCBR2031), and SP/528/04 (SP528), isolated from humans in Thailand in 2004 were used in this study. The viruses were isolated with MDCK cells and grown once in 10-day-old embryonated chicken eggs. The allantoic fluid was used as the virus stock. MDCK cells were maintained in MEM supplemented with 10% newborn calf serum and antibiotics at 37°C in 5% CO2. All experiments were performed in a biosafety level 3 containment laboratory. Plaque assay To measure the virus infectivity, we performed a plaque assay as described previously [17]. Briefly, MDCK cells were plated at 6 × 105/well in 6-well microplates one day before the assay. The confluent cells were infected with serial 10-fold dilution of virus samples and incubated for 1 hr at 37°C with shaking every 15 min. The cells were washed with phosphate-buffered saline (PBS) and covered with 1% agarose in a 2 × MEM medium containing 5 μg/ml of TPCK-trypsin (Sigma, Missouri, USA). After incubation for 3 days at 37°C, the agarose was removed and the cells were fixed with 10% formaldehyde and then stained with 0.1% crystal violet to visualize the plaques. The infectivity titer was expressed by plaque-forming units (PFU). Real-time PCR The viral RNA was extracted from the culture medium of MDCK cells or allantoic fluid by using a QIAamp viral RNA Mini kit (QIAGEN, Hilden, Germany). The RNA was reverse-transcribed to cDNA by using random primers (Invitrogen, Oslo, Norway). We used 5-μl portions of cDNA to amplify the M gene by real-time PCR using a forward primer A/M264R2 (5-ACAAAGCGTCTACGCTGCAG) and a reverse primer A/M30F (5TTCTAACCGAGGTCGAAACG) as described previously http://www.nih.go.jp/niid/index-e.html (in Japanese). The amplification was performed by using SYBR Green (ABI, Warrington, UK) according to the method described previously [18] with slight modifications. The pretreatment of the reaction was carried out at 95°C for 10 min, then subjected to 40 cycles of amplification at 95°C for 15 sec and at 60°C for 1 min. Virus infection to embryonated eggs Ten-day-old embryonated eggs were inoculated with the viruses and incubated at 37°C. The dead eggs were checked every 12 hours. PBS was used as the negative control. After 24 hours of infection, allantoic fluid was used for the virus titrations by plaque assay. Sequence analyses Viral RNA extracted with a QIAamp viral RNA Mini kit was used in a one-step reverse transcription PCR (QIAGEN). The PCR products were cloned into the pGEM-T Easy Vector System (Promega, Madison, USA). The plasmid was extracted with the GenEluteTM Plasmid Miniprep Kit (Sigma) and used for sequencing by the ABI BigDye terminator cycle-sequencing kit with an ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Amino acid sequences were analyzed by BioEdit.

The global spread of the four dengue virus (DENV) serotypes (dengue-1 to -4) has made this virus a major and growing public health concern. Generally, pre-existing neutralizing antibodies derived from primary infection play a significant role in protecting against subsequent infection with the same serotype. By contrast, these pre-existing antibodies are believed to mediate a non-protective response to subsequent heterotypic DENV infections, leading to the onset of dengue illness. In this study, two monoclonal antibodies prepared by using peripheral blood mononuclear cells (PBMCs) from patients with dengue fever were characterized. Epitope mapping revealed that amino acid residues 254-278 in domain II of the viral envelope protein E were the target region of these antibodies. A database search revealed that certain sequences in this epitope region showed high conservation among the four serotypes of DENV. These two human monoclonal antibodies could neutralize DENV-2,-4 more effectively than DENV-1,-3. The amino acid sequences could not explain this difference in neutralizing activity. However, the 3D structure results showed that amino acid 274 could be the critical residue for the difference in neutralization. These results may provide basic information for the development of a dengue vaccine.

Hepatitis E virus (HEV) has becoming a well known zoonotic enteric pathogen and circulated widely inter human-animal-water-food. Generally, detection of the virus has relied on conventional reverse transcription-PCR (RT-PCR) and TaqMan/SYBR quantitative real-time RT-PCR (RT-qPCR), but these tools are usually disadvantages in time-consuming and expensive instruments required. In the present study, we report here on the development of a one-step single-tube reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for rapid detection of HEV contamination in shellfish. The amplification is completed under the isothermal condition (63 °C) for 60 min, and can be visually evaluated by staining at a time in about 1h. In addition, a total of 315 shellfish (80 Anadara granosa, 115 Scapharca subcrenata and 120 Ruditapes philippinarum) collected monthly from the Jinzhou coastal estuary of China Bohai gulf were investigated for HEV contamination by the RT-LAMP compared with a standard RT-qPCR. It was found that genotype 4 HEV was detected in all three species of shellfish sampled using the RT-LAMP assay and was in accordance with RT-qPCR detection of HEV in shellfish. Summarily, our results indicate that the RT-LAMP is a rapid, specific, sensitive and reliable method. This method offers a new tool for the routine monitoring of HEV contamination in shellfish or its harvesting waters in field.

Chikungunya virus (CHIKV) is a mosquito-transmitted alphavirus that causes Chikungunya fever (CHIKF) in millions of people mainly in developing countries. CHIKF is characterized by high fever, fatigue, headache, nausea, vomiting, rash, myalgia and severe arthralgia. To date, there is no specific treatment and no licensed vaccine against CHIKV infection. In this study, we developed a safe, efficient and easy neutralization assay of CHIKV based on vesicular stomatitis virus (VSV) pseudotype with CHIKV envelope protein and the green fluorescent protein (GFP) or luciferase as reporter gene, which could be used under a reduced safety level. The VSV pseudotype can be applied to the epidemic survey by measuring the expression of GFP or luciferase activity in infected cells. This system can also be used to study the mechanisms of virus entry.

Double-stranded RNA (dsRNA) and its mimic, polyinosinic acid: polycytidylic acid [Poly (I:C)], are recognized by toll-like receptor 3 (TLR3) and induce interferon (IFN)-β in many cell types. Poly (I:C) is the most potent IFN inducer. In in vivo mouse studies, intraperitoneal injection of Poly (I:C) elicited IFN-α/β production and natural killer (NK) cells activation. The TLR3 pathway is suggested to contribute to innate immune responses against many viruses, including influenza virus, respiratory syncytial virus, herpes simplex virus 2, and murine cytomegalovirus. In Chikungunya virus (CHIKV) infection, the viruses are cleared within 7–10 days postinfection before adaptive immune responses emerge. The innate immune response is important for CHIKV clearance.

Objectives: Chikungunya virus (CHIKV) is an alphavirus belonging to the Togaviridae family. Alphaviruses cause a chronic non-cytopathic infection in mosquito cells, while they develop a highly cytopathic infection in cells originating from various vertebrates. In this study, we compared the cytopathic effect (CPE) induced by CHIKV in Vero cells and a mosquito cell line, C6/36 cells. Methods: CPE and the virus titers were compared between the CHIKV-infected C6/36 and Vero cells. Apoptosis was measured by TUNEL assay, and the differences between the C6/36 and Vero cells were compared. Results: CHIKV infection induced strong CPE and apoptosis in the Vero cells, but light CPE in the C6/36 cells. The virus titers produced in the C6/36 cells were much higher than those produced in the Vero cells. Conclusions: The reason CHIKV induced strong CPE is that this virus triggers strong apoptosis in Vero cells compared with C6/36 cells. CHIKV established a persistent infection in C6/36 cells after being passaged 20 times. CHIKV infection in mosquito cells was distinct from that in Vero cells. The cell and species specificity of CHIKV-induced cell death implies that the cellular and viral regulators involved in apoptosis may play an important role in determining the outcome of CHIKV infection.

We present here a case of cough, expectoration and fever for six days. After investigation by the doctor and epidemiologist, it was confirmed that this patient had a history of contact with a novel influenza virus. All the results of the real time PCR on novel Swine Influenza H1 were positive. Blood-gas assay PO250.6 mmHg, hypoxemia and computed tomography (CT) of lungs indicated patchy dense shadow scattered in both lungs in which the inflatable bronchial shadow was observed. A visible change in leakage around the shadow was seen. This was a serious case of infection from a novel influenza virus and the patient received systemic treatment: oseltamivir 75mg bid po, methylprednisolone 40mg qd iv, biapenem 0.6 q12h iv, and moxifloxacin 0.4qd po. On discharge from hospital, Swine influenza H1 was negative. Lungs showed apparent absorption of the inflammation. Respiratory failure had been corrected. Patients infected with a novel influenza virus should be given low-dose hormone and an antiviral drug as soon as possible after the infection is confirmed.

This study brings the analysis of amino acid sequences of matrix protein (M1) from the influenza virus A (H1N1, H3N2 and H5N1) during 2007-2208. 741 sequences of M1 were compared, of them, H1N1 388; H3N2 251 and H5N1 102. Even though, the M1 is relatively conserved among the influenza A viruses, we found some variations in the M1 among the viruses, H1N1, H3N2 and H5N1. The nuclear localization signal at amino acid 101 to 105 is RKLKR for H1N1 and H3N2, but for H5N1 is KKLKR. All differences of amino acid in M1 of H1, H3 and H5 were listed. 80 sequences of M1 of H1N1 H3N2 and H5N1 were used for phylogenetic analysis. There is no reasontantment found in the M1 among these subtypes. Further study is needed to study the differences of the function of M1 among H1N1, H3N2 and H5N1. The M1 of H5N1 may contribute to the high pathogenesis to this virus.

Since December 1997, highly pathogenic avian influenza A H5N1 viruses have swept through poultry populations across Asian countries and been transmitted into African and European countries. We characterized 6 avian influenza H5N1 viruses isolated from humans in 2004 in Thailand. A highly pathogenic (HP) KAN353 strain showed faster replication and higher virulence in embryonated eggs compared to other strains, especially compared to the low pathogenic (LP) SP83 strain. HP KAN353 also showed strong cytopathogenicity compared to SP83 in Madin-Darby canine kidney cells. Interestingly, LP SP83 induced smaller plaques compared to other strains, especially HP KAN353. PB2 amino acid 627E may contribute to low virulence, whereas either PB2 amino acid 627 K or the combination of 627E/701N seems to be associated with high virulence. The in vitro assays used in this study may provide the basis for assessing the pathogenesis of influenza H5N1 viruses in vivo.

To examine the effect of the antigenic drift of H1N1 influenza viruses on herd immunity, neutralization antibodies from 744 sera from Thai healthy volunteers in 2008–2009, who had not been vaccinated for at least the last 5 years, were investigated by microneutralization (MN) and hemagglutination inhibition (HI) assays. Significantly higher MN titers were observed for the H1N1 Thai isolate in 2006 than in 2008. The results indicate that the antigenically drifted virus effectively escaped herd immunity. Since the low neutralization activity of herd immunity against drifted viruses is an important factor for viruses to spread efficiently, continuous sero-epidemiological study is required for public health.

Inbred mice have been widely used for the study of influenza viruses as a mammalian model, while suitable cell lines derived from murine tissue have been limited. Here, we established several immortalized cell clones from respiratory regions of inbred mice (C57BL/6 and BALB/c) by transformation using simian virus 40 large T antigen expression vector. Twenty-five cell clones from C57/BL and BALB/c, designated as MRDC/C and MRDC/B series, respectively, showed different susceptibility to Thai isolates of influenza A virus H5N1. Two murine cell clones, C6 and B7 which were extensively studied expressed both SAα2,3 and SAα2,6 sialic acid receptors. Interestingly, the 6 Thai patient-derived H5N1 isolates examined showed varied virus propagation efficiency in murine cell clones, although there were only slight differences in their propagation in MDCK and A549 cell lines. The results indicate that the murine cell clones are useful for examining the propagation efficiency of H5N1 viruses in vitro.

Amantadine and oseltamivir are used to treat influenza A virus infections; however, resistance to these drugs has been widely reported throughout the world. In this study, the frequency and genetic characteristics of the drug-resistant influenza A viruses that circulated in Thailand from 2006 to 2008 were investigated. The nucleotide sequences of the NA and M2 genes were elucidated in order to identify mutations that confer oseltamivir- and amantadine-resistant phenotypes, respectively. A total of 66 influenza A viruses including 44 H1N1 and 22 H3N2 subtypes isolated in Bangkok and 13 provinces of Thailand from 2006 to 2008 were analyzed. Our results demonstrated that seven out of 32 (22%) of the H1N1 viruses isolated in 2006 in Thailand carried the amino acid S31N substitution, which confers amantadine-resistance, although no isolates in 2007 or 2008 possessed the mutation. In the cases of oseltamivir-resistance, four of 10 (40%) of the H1N1 viruses isolated in 2008 were predicted to be resistant to the drug, although none of the 34 viruses isolated in 2006 or 2007 were predicted to be resistant. Surprisingly, all 9 H3N2 viruses isolated in 2008 appeared to be resistant to the amantadine and none were resistant in 2006 or 2007. Phylogenetic analysis based on the HA, M, and NA genes demonstrated that the amantadine-resistant H1N1 isolates had been produced by genetic reassortment. All of the amantadine-resistant H3N2 viruses were clustered in one of these three genes and possessed double mutations of S193F and D225N in the HA gene.

Patients infected with H5N1 influenza A virus, who had a severe or fatal outcome, exhibited several characteristic clinical manifestations including lymphopenia. In this study, human CD4+ T-cell lines and healthy donor-derived peripheral blood mononuclear cells (PBMCs) were examined for susceptibility to infection with Thai isolates of H5N1 in comparison to those of H1N1. Although cellular levels were variable between H5N1 and H1N1 in T-cell lines and PBMCs, rates of production of progeny virions were significantly higher in H5N1 infections, suggesting a more efficient release of virions. In addition, cytopathogenicity in PBMCs, leading to a decline in CD4+ T-cell numbers, were much severer with H5N1 than H1N1. Thus, human T cells could be an important target for infection with H5N1.

RNA interference (RNAi) has become one of the most powerful and popular approach on gene silencing in clinical research study especially in virology due to the gene-specific suppression property of small interfering RNA (siRNA). In this report, we demonstrate that expression of vector-mediated small hairpin RNA (shRNA) against human immunodeficiency virus type 1 (HIV-1) integrase (IN), one of the three important enzymes in HIV infection by controlling the integration of viral RNA to host DNA, could suppress the protein synthesis of EGFP-tagged IN in HeLa cell model efficiently. Furthermore, we show that IN shRNA can successfully reduce the HIV particles production in 293T cells at the level similar to the positive control of HIV-1 tat shRNA. These results provide the therapeutic possibility of HIV replication using RNAi against HIV-1 integrase.

Lipid rafts are involved in the life cycle of many viruses. In this study, we showed that lipid rafts also play an important role in the life cycle of severe acute respiratory syndrome (SARS)-coronavirus (CoV). Cholesterol depletion by pretreatment of Vero E6 cells with methyl-beta-cyclodextrin (MbetaCD) inhibited the production of SARS-CoV particles released from the infected cells. This inhibition was prevented by addition of cholesterol to the culture medium, indicating that the reduction of virus particle release was caused by the loss of cholesterol in the cell membrane. In contrast, cholesterol depletion at the post-entry stage (3h post-infection) caused only a limited effect on virus particle release. Northern blot analysis revealed that the levels of viral mRNAs were significantly affected by pretreatment with MbetaCD, but not by treatment at 3h post-infection. Interestingly, no apparent evidence for colocalization of angiotensin converting enzyme 2 with lipid rafts in the membrane of Vero E6 cells was obtained. These results suggest that lipid rafts could contribute to SARS-CoV infection in the early replication process in Vero E6 cells.