Summary Dual base editors (DBEs) enable simultaneous A‐to‐G and C‐to‐T conversions, expanding mutation types. However, low editing efficiency and narrow targeting range limit the widespread use of DBEs in plants. The single‐strand DNA binding domain of RAD51 DBD can be fused to base editors to improve their editing efficiency. However, it remains unclear how the DBD affects dual base editing performance in plants. In this study, we generated a series of novel plant DBE‐SpGn tools consisting of nine constructs using the high‐activity cytidine deaminase evoFERNY, adenosine deaminase TadA8e and DBD in various fusion modes with the PAM‐flexible Streptococcus pyogenes Cas9 (SpCas9) nickase variant SpGn (with NG‐PAM). By analysing their editing performance on 48 targets in rice, we found that DBE‐SpGn constructs containing a single DBD and deaminases located at the N‐terminus of SpGn exhibited the highest editing efficiencies. Meanwhile, constructs with deaminases located at the C‐terminus and/or multiple DBDs failed to function normally and exhibited inhibited editing activity. We identified three particularly high‐efficiency dual base editors (C‐A‐SpGn, C‐A‐D‐SpGn and A‐C‐D‐SpGn), named PhieDBEs (Plant high‐efficiency dual base editors), capable of producing efficient dual base conversions within a narrow editing window (M 5 ~ M 9 , M = A/C). The editing efficiency of C‐A‐D‐SpGn was as high as 95.2% at certain target sites, with frequencies of simultaneous C‐to‐T and A‐to‐G conversions as high as 81.0%. In summary, PhieDBEs (especially C‐A‐D‐SpGn) can produce diverse mutants and may prove useful in a wide variety of applications, including plant functional genomics, precise mutagenesis, directed evolution and crop genetic improvement, among others.

A plethora of CRISPR effectors, such as Cas3, Cas9, and Cas12a, are commonly employed as gene editing tools. Among these, Cas12 effectors developed based on Class II type V proteins exhibit distinct characteristics compared to Class II type VI and type II effectors, such as their ability to generate non-allelic DNA double-strand breaks, their compact structures, and the presence of a single RuvC-like nuclease domain. Capitalizing on these advantages, Cas12 family proteins have been increasingly explored and utilized in recent years. However, the characteristics and applications of different subfamilies within the type V protein family have not been systematically summarized. In this review, we focus on the characteristics of type V effector (CRISPR/Cas12) proteins and the current methods used to discover new effector proteins. We also summarize recent modifications based on engineering of type V effectors. In addition, we introduce the applications of type V effectors for gene editing in animals and plants, including the development of base editors, tools for regulating gene expression, methods for gene targeting, and biosensors. We emphasize the prospects for development and application of CRISPR/Cas12 effectors with the goal of better utilizing toolkits based on this protein family for crop improvement and enhanced agricultural production.

CRISPR/Cas9-based cytosine base editors (CBEs) and adenine base editors (ABEs) can efficiently mediate C-to-T/G-to-A and A-to-G/T-to-C substitutions, respectively; however, achieving base transversions (C-to-G/C-to-A and A-to-T/A-to-C) is challenging and has been rarely studied in plants. Here, we constructed new plant C-to-G base editors (CGBEs) and new A-to-Y (T/C) base editors and explored their base editing characteristics in rice. First, we fused the highly active cytidine deaminase evoFENRY and the PAM-relaxed Cas9-nickase variant Cas9n-NG with rice and human uracil DNA N-glycosylase (rUNG and hUNG), respectively, to construct CGBE-rUNG and CGBE-hUNG vector tools. The analysis of five NG-PAM target sites showed that these CGBEs achieved C-to-G conversions with monoallelic editing efficiencies of up to 27.3% in T0 rice, with major byproducts being insertion/deletion mutations. Moreover, for the A-to-Y (C or T) editing test, we fused the highly active adenosine deaminase TadA8e and the Cas9-nickase variant SpGn (with NG-PAM) with Escherichia coli endonuclease V (EndoV) and human alkyladenine DNA glycosylase (hAAG), respectively, to generate ABE8e-EndoV and ABE8e-hAAG vectors. An assessment of five NG-PAM target sites showed that these two vectors could efficiently produce A-to-G substitutions in a narrow editing window; however, no A-to-Y editing was detected. Interestingly, the ABE8e-EndoV also generated precise small fragment deletions in the editing window from the 5′-deaminated A base to the SpGn cleavage site, suggesting its potential value in producing predictable small-fragment deletion mutations. Overall, we objectively evaluated the editing performance of CGBEs in rice, explored the possibility of A-to-Y editing, and developed a new ABE8e-EndoV tool, thus providing a valuable reference for improving and enriching base editing tools in plants.

The development of clustered regularly interspaced palindromic repeats (CRISPR)-associated protein (Cas) variants with a broader recognition scope is critical for further improvement of CRISPR/Cas systems. The original Cas9 protein from Streptococcus canis (ScCas9) can recognize simple NNG-protospacer adjacent motif (PAM) targets, and therefore possesses a broader range relative to current CRISPR/Cas systems, but its editing efficiency is low in plants. Evolved ScCas9+ and ScCas9++ variants have been shown to possess higher editing efficiencies in human cells, but their activities in plants are currently unknown. Here, we utilized codon-optimized ScCas9, ScCas9+ and ScCas9++ and a nickase variant ScCas9n++ to systematically investigate genome cleavage activity and cytidine base editing efficiency in rice (Oryza sativa L.). This analysis revealed that ScCas9++ has higher editing efficiency than ScCas9 and ScCas9+ in rice. Furthermore, we fused the evolved cytidine deaminase PmCDA1 with ScCas9n++ to generate a new evoBE4max-type cytidine base editor, termed PevoCDA1-ScCas9n++ . This base editor achieved stable and efficient multiplex-site base editing at NNG-PAM sites with wider editing windows (C- 1 -C17 ) and without target sequence context preference. Multiplex-site base editing of the rice genes OsWx (three targets) and OsEui1 (two targets) achieved simultaneous editing and produced new rice germplasm. Taken together, these results demonstrate that ScCas9++ represents a crucial new tool for improving plant editing.

Plant Biotechnology JournalVolume 18, Issue 12 p. 2385-2387 Brief CommunicationsOpen Access Quantitative regulation of Waxy expression by CRISPR/Cas9-based promoter and 5'UTR-intron editing improves grain quality in rice Dongchang Zeng, Dongchang Zeng State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorTaoli Liu, Taoli Liu State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorXingliang Ma, Xingliang Ma State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorBin Wang, Bin Wang State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorZhiye Zheng, Zhiye Zheng College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorYaling Zhang, Yaling Zhang State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorXianrong Xie, Xianrong Xie State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorBowen Yang, Bowen Yang State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorZhe Zhao, Zhe Zhao State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorQinlong Zhu, Corresponding Author Qinlong Zhu zhuql@scau.edu.cn orcid.org/0000-0001-7622-6450 State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, China Correspondence (Tel +86 20 85281908; fax +86 20 85282180; email: zhuql@scau.edu.cn (QZ) and ygliu@scau.edu.cn (Y-GL))Search for more papers by this authorYao-Guang Liu, Corresponding Author Yao-Guang Liu ygliu@scau.edu.cn orcid.org/0000-0001-9201-2997 State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, China Correspondence (Tel +86 20 85281908; fax +86 20 85282180; email: zhuql@scau.edu.cn (QZ) and ygliu@scau.edu.cn (Y-GL))Search for more papers by this author Dongchang Zeng, Dongchang Zeng State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorTaoli Liu, Taoli Liu State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorXingliang Ma, Xingliang Ma State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorBin Wang, Bin Wang State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorZhiye Zheng, Zhiye Zheng College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorYaling Zhang, Yaling Zhang State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorXianrong Xie, Xianrong Xie State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorBowen Yang, Bowen Yang State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorZhe Zhao, Zhe Zhao State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, ChinaSearch for more papers by this authorQinlong Zhu, Corresponding Author Qinlong Zhu zhuql@scau.edu.cn orcid.org/0000-0001-7622-6450 State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, China Correspondence (Tel +86 20 85281908; fax +86 20 85282180; email: zhuql@scau.edu.cn (QZ) and ygliu@scau.edu.cn (Y-GL))Search for more papers by this authorYao-Guang Liu, Corresponding Author Yao-Guang Liu ygliu@scau.edu.cn orcid.org/0000-0001-9201-2997 State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China College of Life Sciences, South China Agricultural University, Guangzhou, China Correspondence (Tel +86 20 85281908; fax +86 20 85282180; email: zhuql@scau.edu.cn (QZ) and ygliu@scau.edu.cn (Y-GL))Search for more papers by this author First published: 02 June 2020 https://doi.org/10.1111/pbi.13427Citations: 63AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat In cereal crops, grain starches are composed of different proportions of amylose and amylopectin, which determine the cooking and eating qualities. The amylose synthesis is controlled by the Waxy (Wx) gene encoding a granule bound NDP-glucose-starch glucosyltransferase (Shure et al., 1983). In rice (Oryza sativa L.), the varied activities of natural Wx alleles regulate different amylose contents (AC), gel consistency (GC) and pasting viscosity of grain starches; these factors together influence the grain appearance, cooking/eating quality and starch physical characters (Zhang et al., 2019). Wxa is a strong allele mainly distributing in indica (an O. sativa subspecies) cultivars producing high ACs (25%–30%) (Wang et al., 1995). While Wxb, presenting mainly in japonica (another subspecies) cultivars, is a weak allele producing moderate ACs (15–18%) (Isshiki et al., 1998). Generally, rice grains with higher ACs and lower GC values have poor eating quality, while those with moderate ACs (15–20%) and higher GC values (60–80 mm) give better taste for most consumers. Using the successive backcrossing methods, Wxb can be introgressed into indica varieties to improve the grain quality. However, the traditional breeding methods are time consuming and difficult to break close linkage drags with undesirable traits. We previously employed CRISPR/Cas9 to target the Wx coding region to generate glutinous rice (Ma et al., 2015). However, this kind of function-knockout strategy produces only null gene alleles, and when Wx is targeted generally glutinous lines are generated. Studies on generating various quantitative variations of traits by genome editing are rare. To rapidly improve rice grain quality, here, we developed CRISPR/Cas9 editing strategies to generate new Wx alleles producing various ACs by quantitative regulation of its expression, using an elite indica variety TianFengB (TFB) as a test. TFB is a widely used parent in hybrid rice breeding for its high-yield performance, but its grain quality (and of the resultant hybrids) is poor due to higher AC (ca. 25%) and lower GC (56 mm; see below). Disruption of promoter sequences by genome editing may change agronomic traits (Li et al., 2017; Rodríguez-Leal et al., 2017). Therefore, we selected a ca. 2.0-kb upstream sequence of Wxa in TFB for targeting, which contains a 0.9-kb promoter regulatory region and a 1.1-kb intron-containing 5’untranslation region (UTR) (Figure 1a). The first strategy is based on transcriptional regulation, thus we analysed the promoter sequence using Plant-CARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) and identified three putative cis-regulatory elements (CREs), Endosperm-box, A-box and CAAT-box. We designed four pairs of targets (T1–T8) in this region (Figure 1a) using CRISPR-GE (Xie et al., 2017) for multiplex editing. The second strategy we explored is for post-transcriptional regulation by targeting the 5’UTR intronic splicing site (5’UISS) of Wxa with a target T9 to alter the intron-splicing pattern and efficiency. In addition, a coding-exon editing (with a target T10) was done to produce glutinous rice. Using our CRISPR/Cas9 system (Ma et al., 2015), we prepared six constructs for the double-target or single-target editing (Figure 1a, b), and used them for Agrobacterium-mediated transformation of TFB. Figure 1Open in figure viewerPowerPoint Improvement of rice grain quality by quantitative regulation of Wx expression via promoter and 5’UISS editing using CRISPR/Cas9. (a) Structure of Wxa and target sites at the promoter region (T1–T8 in four pairs), the intronic splicing site within the 5’untranslation region (5’UISS; T9) or a coding exon (T10). F-RT/R-RT and F-qRT/R-qRT, primers for RT-PCR and qRT-PCR, respectively. (b) Nucleotide variations (in red) at the targets (protospacer adjacent motif in italic) of homozygous mutant lines (T2) from an indica variety TFB carrying Wxa. ‘-’ and ‘del’, base deletion; ‘in’, base insertion; ‘subs’, base substitution (AGACACAAATTCCTTCAGTTCTTTGTCTATCGGGCT). Sequences between the targets are omitted. Lower-case letters, the intron. TFBg, a glutinous line. (c, d) cDNAs (RNAs from 15-day-old seeds) showing mRNA splicing by sequencing 24 clones each line (c) and agarose-gel analysis (d). Asterisks indicate spliced-out nucleotides. KY131, a japonica variety with Wxb having a G-to-T mutation at the splicing site (SS). Actin 1, a control. (e) Measurements of Wx expression, amylose content (AC) and gel consistency (GC). Bars, SD (n = 3). Samples without a same letter show significant difference by Duncan's test (P < 0.05). (f) Polished grains of TFB and representative edited lines. (g) Rapid visco analysis profiles of grain starches of the lines. HHZ, an indica variety (with Wxb and 17.1% AC) as a comparison. cP (centi Poise), viscosity unit. From transgenic (T1) segregating families, we PCR-selected transgene-free plants and further identified 23 homozygous mutant T2-lines (Figure 1b). These lines had base insertions or deletions at the targets, or fragment deletions (or a 36-bp substitution) between the paired targets, which removed the putative CREs, respectively (Figure 1b). In two lines (UISS-1, UISS-6) by the 5’UISS-editing, the intronic splicing site (GT) was deleted (Figure 1c). We named some of these Wx mutant alleles that showed obviously down-regulated expression largely affecting AC (see below) as follows: Wxa-dE (Endosperm-box deleted in T1T2-2 line), Wxa-dU (unknown element deleted in T3T4-2), Wxa-dA (A-box deleted in T5T6-5), Wxa-dC1, Wxa-dC2 and Wxa-dC3 (CAAT-box deleted in T7T8-4, T7T8-5 and T7T8-6, respectively), and WxdS1, WxdS2 and WxdS3 (splicing-site deleted/impaired in UISS-1, UISS-2 and UISS-6) (Figure 1b). We selected a T10-edited mutant (TFBg) for analyses. To investigate the splicing patterns of the 5’UISS-edited lines, we performed reverse transcription (RT)-PCR and cDNA-sequencing. UISS-1 (WxdS1), UISS-2 (WxdS2) and UISS-6 (WxdS3) generated multiple alternatively or atypically spliced transcripts with various frequencies, similar to Wxb in a japonica variety KY131 (Figure 1c). Three transcripts (WxdS1-3, WxdS3-4 and Wxb-4) were found to retain the non-spliced intron. These major alternative splicing events with size differences were confirmed by gel electrophoresis (Figure 1d). Obviously, the splicing-site deletion in UISS-1 and UISS-6 resulted in the altered intron-splicing patterns (and suppressed splicing of some transcripts). However, the 2-bp deletion near the 5’UISS in UISS-2 also produced an alternative transcript (WxdS2-1 with 58.3%) (Figure 1c), suggesting that this 2-bp deletion might change the pre-mRNA conformation affecting correct intron splicing. Then, we used quantitative RT-PCR (qRT-PCR) to measure mature mRNA levels of these lines in developing endosperm. In T7T8-4 (Wxa-dC1), T7T8-5 (Wxa-dC2) and T7T8-6 (Wxa-dC3), the expression levels were down-regulated to 37.4%, 32.7% and 24.9% of TFB, respectively (Figure 1e). The lines with deletions of the Endosperm-box (T1T2-2), unknown element(s) (T3T4-2) and A-box (T5T6-5) also showed significantly decreased mRNA (85.2%, 67.4% and 60.5% of TFB, respectively). However, the rest lines with base variations at the targets had little or no expression changes. These results verified the regulatory roles of these putative CREs on transcription. In addition, all the 5’UISS-edited lines exhibited decreased mRNA levels; especially, the lines WxdS1 (UISS-1), WxdS2 (UISS-2) and WxdS3 (UISS-6) had only ca. 10% mRNA levels of TFB, suggesting that these mis-splicing, atypical splicing and non-splicing might largely reduce the transcript stability. The base editing of intronic splicing sites within coding regions could cause aberrant mRNA splicing and gene function knockout (Li et al., 2019). However, our strategy of editing exon/intron border sequences within 5’UTRs can quantitatively regulate gene activity and phenotypic performance (see below). Next, we measured AC and GC of these lines. The lines without the CAAT-box showed reduced ACs, from 24.6 % in TFB to moderate levels of 19.6% (T7T8-4), 18.1% (T7T8-5) and 17.8% (T7T8-6) (Figure 1e). While ACs of UISS-1, UISS-2, UISS-6 were 10.6%, 9.8% and 11.5%, respectively (Figure 1e); these lines are novel valuable ‘soft rice’ germplasms. TFBg had 2.4% AC, a typical glutinous rice. Some other edited lines also produced slightly reduced ACs, such as 23.8% (T3T4-2), 22.8% (T5T6-5) and 22.9% (UISS-5). These AC variations were related to the corresponding Wx mRNA levels. In accordance with the AC reductions, T7T8-4, T7T8-5, T7T8-6, UISS-1, UISS-2 and UISS-6 showed increased GC values (62–83 mm, comparing to 56 mm of TFB) (Figure 1e). In addition, the polished grain appearances of T7T8-4, T7T8-5 and T7T8-6 were similar to that of TFB (Figure 1f). However, due to the lower ACs in UISS-1, UISS-2 and UISS-6, their polished grains had lower endosperm transparency with milky-white appearances (Figure 1f). We further used Rapid visco analysis (RVA) to assess the starch quality (Fitzgerald et al., 2003). The RVA viscosity indexes of the edited lines varied to various degrees relating to their ACs (Figure 1g). Among them, PT7T8-4, PT7T8-5 and PT7T8-6 showed significantly decreased viscosity indexes, closer to those of indica HHZ (carrying Wxb with 17.1% AC) that has high grain quality. Finally, we observed that the major agronomic traits (1000-grain weight, grain length, grain width, plant height and plant morphology) of these edited lines were similar to TFB, except for slightly decreased 1000-grain weight in UISS-1, UISS-2 and UISS-6 (93%–95% of TFB). In summary, we developed high-efficient CRISPR/Cas9-mediated promoter/5’UISS-engineering strategies for generating new quantitative trait alleles with fine-tuned transcriptional and post-transcriptional regulations of gene expression activity. We expect that application of these grain-improved lines having desirable AC and GC levels and their exploitation in hybrid rice breeding will provide rice products with better quality to meet consumer’s preferences. As CREs and 5’UTR introns are present in many genes, our study provides a promising breeding method for improvement of important traits in crops and other organisms. Acknowledgements This work was supported by grants from the Major Program of Guangdong Basic and Applied Research (2019B030302006), the National Natural Science Foundation of China (31921004, 31971915) and the Guangdong special support program of young top-notch talent in science and technology innovation (2019TQ05N147). Conflict of interest The authors declare no conflict of interest. Author contributions Y.-G.L. and Q.Z. designed the studies. D.Z., T.L., X.M., B.W., Z.Z., Y.Z., X.X., B.Y. and Z. Z. performed the experiments. D.Z., T.L., Q.Z. and Y.-G.L. analysed data. Y.-G.L. and Q.Z. wrote the paper. References Fitzgerald, M., Martin, M., Ward, R., Park, W. and Shead, H. (2003) Viscosity of rice flour: A rheological and biological study. J Agric Food Chem. 51, 2295– 2299. Isshiki, M., Morino, K., Nakajima, M., Okagaki, R., Wessler, S., Izawa, T. and Shimamoto, K. (1998) A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5′ splice site of the first intron. Plant J. 15, 133– 138. Li, X., Xie, Y., Zhu, Q. and Liu, Y. (2017) Targeted genome editing in genes and cis- regulatory regions improves qualitative and quantitative traits in crops. Mol. Plant, 10, 1368– 1370. Li, Z., Xiong, X., Wang, F., Liang, J. and Li, J.F. (2019) Gene disruption through base editing-induced messenger RNA missplicing in plants. New Phytol. 222, 1139– 1148. Ma, X., Zhang, Q., Zhu, Q., Liu, W., Chen, Y., Qiu, R., Wang, B. et al. (2015) A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant, 8, 1274– 1284. Rodríguez-Leal, D., Lemmon, Z., Man, J., Bartlett, M. and Lippman, Z. (2017) Engineering quantitative trait variation for crop improvement by genome editing. Cell, 171, 470– 480. Shure, M., Wessler, S. and Fedoroff, N. (1983) Molecular identification and isolation of the Waxy locus in maize. Cell, 35, 225– 233. Wang, Z., Zheng, F., Shen, G., Gao, J., Snustad, D., Li, M., Zhang, J. et al. (1995) The amylose content in rice endosperm is related to the post-transcriptional regulation of the waxy gene. Plant J. 7, 613– 622. Xie, X., Ma, X., Zhu, Q., Zeng, D., Li, G. and Liu, Y. (2017) CRISPR-GE: a convenient software toolkit for CRISPR-based genome editing. Mol Plant, 10, 1246– 1249. Zhang, C., Zhu, J., Chen, S., Fan, X., Li, Q., Lu, Y., Wang, M. et al. (2019) Wxlv, the ancestral allele of rice Waxy gene. Mol. Plant, 12, 1157– 1166. Citing Literature Volume18, Issue12December 2020Pages 2385-2387 FiguresReferencesRelatedInformation

Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9)-mediated genome editing can efficiently produce gene-knockout mutants. On the other hand, CRISPR/Cas-derived base editors offer the ability to induce precise nucleotide substitutions (Komor et al., 2016Komor A.C. Kim Y.B. Packer M.S. Zuris J.A. Liu D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.Nature. 2016; 533: 420-424Crossref PubMed Scopus (1725) Google Scholar). Cytidine base editors (CBEs) consist of a cytidine deaminase fused with a Cas9-nickase variant (Cas9n, with a D10A substitution) and can achieve site-specific C-to-T substitution. Similarly, adenine base editors use an adenine deaminase for A-to-G substitution. These systems have been used in various organisms (Mishra et al., 2019Mishra R. Joshi R.K. Zhao K. Base editing in crops: current advances, limitations and future implications.Plant Biotechnol. J. 2019; 18: 20-31Crossref PubMed Scopus (50) Google Scholar). However, the Cas9 complex requires target sites containing NGG protospacer adjacent motifs (PAMs), thus restricting selection of potential targets. A number of CBEs have been developed using Cas9 variants (mostly Cas9n), cytidine deaminases (such as rAPOBEC1 and PmCDA1), and uracil glycosylase inhibitor (UGI) domains. These CBEs of the first generation (BE1, rAPOBEC1-dCas9), second generation (BE2, rAPOBEC1-dCas9-UGI), and third generation (BE3, rAPOBEC1-Cas9n-UGI) have moderate editing efficiencies in mammalians (Komor et al., 2016Komor A.C. Kim Y.B. Packer M.S. Zuris J.A. Liu D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.Nature. 2016; 533: 420-424Crossref PubMed Scopus (1725) Google Scholar). Some newly developed CBEs have incorporated improvements, such as optimizing the domain-linking sequences, fusing two UGI domains to the Cas9n C terminus, or using a bipartite nuclear localization signal (bpNLS), to produce the fourth-generation BE4 and BE4max systems with enhanced editing activities in human cells (Komor et al., 2017Komor A.C. Zhao K.T. Packer M.S. Gaudelli N.M. Waterbury A.L. Koblan L.W. Kim Y.B. Badran A.H. Liu D.R. Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity.Sci. Adv. 2017; 3: eaao4774Crossref PubMed Scopus (287) Google Scholar; Koblan et al., 2018Koblan L.W. Doman J.L. Wilson C. Levy J.M. Tay T. Newby G.A. Maianti J.P. Raguram A. Liu D.R. Improving cytidine and adenine base editors by expression optimization and ancestral reconstruction.Nat. Biotechnol. 2018; 36: 843-846Crossref PubMed Scopus (256) Google Scholar). Through incorporating codon-optimized bpNLS and Anc689 APOBEC, the Anc689BE4max editors showed higher editing efficiencies than BE4 editors in rice (Oryza sativa) (Wang et al., 2019Wang M. Wang Z. Mao Y. Lu Y. Yang R. Tao X. Zhu J.K. Optimizing base editors for improved efficiency and expanded editing scope in rice.Plant Biotechnol. J. 2019; 17: 1697-1699Crossref PubMed Scopus (23) Google Scholar). In addition, combining the PmCDA1 deaminase from the activation-induced cytidine deaminase (AID) family with Cas9n produced a new target-AID editor with improved editing efficiency and expanded editing window in plants (Shimatani et al., 2017Shimatani Z. Kashojiya S. Takayama M. Terada R. Arazoe T. Ishii H. Teramura H. Yamamoto T. Komatsu H. Miura K. et al.Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion.Nat. Biotechnol. 2017; 35: 441-443Crossref PubMed Scopus (326) Google Scholar). By fusing the human APOBEC3A (hA3A) and Cas9n, a BE4 A3A-PBE also had an improved plant-editing efficiency (Zong et al., 2018Zong Y. Song Q. Li C. Jin S. Zhang D. Wang Y. Qiu J. Gao C. Efficient C-to-T base editing in plants using a fusion of nCas9 and human APOBEC3A.Nat. Biotechnol. 2018; 36: 950-953Crossref Scopus (147) Google Scholar). A plant Discriminated single-guide RNAs (sgRNAs)-based SurroGate system integrated a hygromycin-resistance gene repair reporter system to enrich potentially base-edited callus cells for increasing the output base-editing efficiency (Xu et al., 2020Xu W. Yang Y. Liu Y. Kang G. Wang F. Li L. Lv X. Zhao S. Yuan S. Song J. et al.Discriminated sgRNAs-based SurroGate system greatly enhances the screening efficiency of plant base-edited cells.Mol. Plant. 2020; 13: 169-180Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar). In addition, a system with dual cytosine and adenine base editors was developed for targeted random mutagenesis of plant genes (Li et al., 2020Li C. Zhang R. Meng X. Chen S. Zong Y. Lu C. Qiu J. Chen Y. Li J. Gao C. Targeted, random mutagenesis of plant genes with dual cytosine and adenine base editors.Nat. Biotechnol. 2020; 38: 875-882Crossref PubMed Scopus (96) Google Scholar). Although great efforts have been made, plant CBEs still have lower editing activities, narrow editing windows, and limitations on target sequence context and target selection (Li et al., 2017Li J. Sun Y. Du J. Zhao Y. Xia L. Generation of targeted point mutations in rice by a modified CRISPR/Cas9 system.Mol. Plant. 2017; 10: 526-529Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar). The Cas9n-NG variant recognizes NG-PAMs, thus having broader genome-targeting scope (Nishimasu et al., 2018Nishimasu H. Shi X. Ishiguro S. Gao L. Hirano S. Okazaki S. Noda T. Abudayyeh O.O. Gootenberg J.S. Mori H. et al.Engineered CRISPR-Cas9 nuclease with expanded targeting space.Science. 2018; 361: 1259-1262Crossref PubMed Scopus (370) Google Scholar). Furthermore, the phage-assisted continuous evolution system was used to generate three evolved genes for deaminases, evorAPOBEC1, evoFERNY, and evoCDA1, which were fused with Cas9n to develop evoBE4max CBEs with higher editing efficiency, without target sequence context preference, than the BE4max CBEs in mammalians (Thuronyi et al., 2019Thuronyi B.W. Koblan L.W. Levy J.M. Yeh W. Zheng C. Newby G.A. Wilson C. Bhaumik M. Shubina-Oleinik O. Holt J.R. et al.Continuous evolution of base editors with expanded target compatibility and improved activity.Nat. Biotechnol. 2019; 37: 1070-1079Crossref PubMed Scopus (86) Google Scholar). However, it is unclear whether these CBEs, especially using Cas9n-NG, effectively works in plants. Here, we report the development of new plant high-efficiency CBEs (PhieCBEs) produced by fusing these evolved cytidine deaminases with two Cas9n-NG variants. Based on the previous hA3A deaminase (Zong et al., 2018Zong Y. Song Q. Li C. Jin S. Zhang D. Wang Y. Qiu J. Gao C. Efficient C-to-T base editing in plants using a fusion of nCas9 and human APOBEC3A.Nat. Biotechnol. 2018; 36: 950-953Crossref Scopus (147) Google Scholar) and the evolved cytidine deaminases (Thuronyi et al., 2019Thuronyi B.W. Koblan L.W. Levy J.M. Yeh W. Zheng C. Newby G.A. Wilson C. Bhaumik M. Shubina-Oleinik O. Holt J.R. et al.Continuous evolution of base editors with expanded target compatibility and improved activity.Nat. Biotechnol. 2019; 37: 1070-1079Crossref PubMed Scopus (86) Google Scholar), we synthesized rice codon-optimized sequences encoding these deaminases and bpNLS (Supplemental Figure 1) and fused them with the rice codon-optimized Cas9n-NG gene (Zeng et al., 2020Zeng D. Li X. Huang J. Li Y. Cai S. Yu W. Li Y. Huang Y. Xie X. Gong Q. et al.Engineered Cas9 variant tools expand targeting scope of genome and base editing in rice.Plant Biotechnol. J. 2020; 18: 1348-1350Crossref PubMed Scopus (18) Google Scholar) to generate four PhieCBEs: PevorAPOBEC1-CBE4max-Cas9n-NG (PevorAC1-NG), PevoFERNY-CBE4max-Cas9n-NG (PevoFERNY-NG), PevoCDA1-CBE4max-Cas9n-NG (PevoCDA1-NG), and PhA3A-CBE4max-Cas9n-NG (PhA3A-max-NG) (Figure 1A). In addition, we created a new eCas9n-NG variant (see below) from the enhanced-fidelity eCas9 (Slaymaker et al., 2015Slaymaker I.M. Gao L. Zetsche B. Scott D.A. Yan W.X. Zhang F. Rationally engineered Cas9 nucleases with improved specificity.Science. 2015; 351: 84-88Crossref PubMed Scopus (1244) Google Scholar) by introducing the D10A substitution, and used it to construct a new PhieCBE, PevoCDA1-CBE4max-eCas9n-NG (PevoCDA1-eNG) (Figure 1A). Our previously reported CBE4 rAC1-NG (Zeng et al., 2020Zeng D. Li X. Huang J. Li Y. Cai S. Yu W. Li Y. Huang Y. Xie X. Gong Q. et al.Engineered Cas9 variant tools expand targeting scope of genome and base editing in rice.Plant Biotechnol. J. 2020; 18: 1348-1350Crossref PubMed Scopus (18) Google Scholar) was used for comparison. We designed nine rice genomic targets, four with NGG-PAMs and five with NG-PAMs (Figure 1B), to test the editing efficiencies of these CBEs by multiplex editing in rice (Supplemental Figure 2). Sequencing of the targets (each 24–34 T0 plants) showed that PhieCBEs had much higher editing efficiencies (average rates 27.6%–62.6%) than that of rAC1-NG (8.5%). PevoFERNY-NG exhibited the highest editing efficiency (62.6%) and had moderate levels (40.6% and 44.8%) for two targets (T4 and T5) that were difficult to edit with the other PhieCBEs (Figure 1B). Notably, the average editing efficiency of PevorAC1-NG was significantly improved (33.6%) compared with rAC1-NG (8.5%) (Figure 1B). The editing efficiencies of PhA3Amax-NG (39.5%) and PevoCDA1-eNG (40.1%) were higher than that of PevoCDA1-NG (27.6%). The editing efficiencies of PhieCBEs were about 3- to 8-fold higher than that of rAC1-NG, and PevoFERNY-NG had the strongest editing activity, followed by PevoCDA1-eNG, PhA3Amax-NG, PevorAC1-NG, and PevoCDA1-NG. The genome-editing activities of Cas9-NG tools at NG targets are generally lower than those of the original SpCas9 at NGG targets (Zeng et al., 2020Zeng D. Li X. Huang J. Li Y. Cai S. Yu W. Li Y. Huang Y. Xie X. Gong Q. et al.Engineered Cas9 variant tools expand targeting scope of genome and base editing in rice.Plant Biotechnol. J. 2020; 18: 1348-1350Crossref PubMed Scopus (18) Google Scholar). Our results showed that PhieCBEs also had somewhat lower editing activities at the NG targets than those at NGG targets (Figure 1C). PevoFERNY-NG had the smallest editing-efficiency variance (1.3-fold) between the NGG and NG targets, and its efficiency for NG targets (54.0%) was much higher than those (19.7%–30.36%) of the other PhieCBEs (Figure 1B and 1C). Notably, eCas9 was originally designed for enhanced fidelity rather than for NG-PAM targeting (Slaymaker et al., 2015Slaymaker I.M. Gao L. Zetsche B. Scott D.A. Yan W.X. Zhang F. Rationally engineered Cas9 nucleases with improved specificity.Science. 2015; 351: 84-88Crossref PubMed Scopus (1244) Google Scholar), but our PevoCDA1-eNG using eCas9n-NG also had relatively higher base-editing activity at the NG targets (Figure 1B), revealing eCas9n-NG as a new NG-PAM-nickase. Thus, the combination of the codon-optimized, highly active cytidine deaminases and more effective bpNLS peptide could significantly improve cytidine editing activity in rice. The rAPOBEC1-based plant CBEs usually have a preference for TC (editing site underlined) positions rather than GC positions, limiting their potential utility (Wang et al., 2019Wang M. Wang Z. Mao Y. Lu Y. Yang R. Tao X. Zhu J.K. Optimizing base editors for improved efficiency and expanded editing scope in rice.Plant Biotechnol. J. 2019; 17: 1697-1699Crossref PubMed Scopus (23) Google Scholar). The original evorAC1, evoFERNY, and evoCDA1 editors eliminate the base preference and improve the stability and target sequence compatibility in mammals (Thuronyi et al., 2019Thuronyi B.W. Koblan L.W. Levy J.M. Yeh W. Zheng C. Newby G.A. Wilson C. Bhaumik M. Shubina-Oleinik O. Holt J.R. et al.Continuous evolution of base editors with expanded target compatibility and improved activity.Nat. Biotechnol. 2019; 37: 1070-1079Crossref PubMed Scopus (86) Google Scholar). To test whether this held true for PhieCBEs, we analyzed the editing of all GC, AC, TC, and CC motifs at C3–C8 positions. On comparison with rAC1-NG with low editing efficiencies at TC, CC, GC and AC (Zeng et al., 2020Zeng D. Li X. Huang J. Li Y. Cai S. Yu W. Li Y. Huang Y. Xie X. Gong Q. et al.Engineered Cas9 variant tools expand targeting scope of genome and base editing in rice.Plant Biotechnol. J. 2020; 18: 1348-1350Crossref PubMed Scopus (18) Google Scholar), PhieCBEs (except for PevorAC1-NG) achieved effective editing of GC and AC sites (Figure 1D), suggesting their relatively higher target context compatibility. Overall, PevoFERNY-NG has the highest editing activity at both the GC and non-GC sites in rice, followed by PevoCDA1-eNG. The mutation types in the edited T0 products were either heterozygous or homozygous mutations (Figure 1D). Homozygous mutations occurred mostly at sites with high editing activity, such as TC6 at T2, CC6 at T6, and GC4 at T7 (Supplemental Figures 3 and 4). Thus, PhieCBEs have higher ability to produce homozygous mutations in generation T0. CBEs may produce some by-product mutations (insertions/deletions and base transversions) (Komor et al., 2016Komor A.C. Kim Y.B. Packer M.S. Zuris J.A. Liu D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.Nature. 2016; 533: 420-424Crossref PubMed Scopus (1725) Google Scholar). Our results showed that PevoFERNY-NG had the lowest level (2.9%) of by-product mutations (Figure 1E). Compared with the editing windows C4–C8 of BE4s, those of PhieCBEs were broadened to C2–C10 or even to C−1–C13 (Figure 1F and Supplemental Figure 4). PevoFERNY-NG had a higher editing activity at the center region (C3–C8), and the activity at both window ends was greatly reduced; however, some easy-to-edit targets could be extended to C10, such as at T8 (Supplemental Figure 4). The editing windows of PevoCDA1-NG, PevoCDA1-eNG, and PhA3Amax-NG were expanded to C−1–C15, while those of PevoFERNY-NG and PevorAC1-NG were mainly at C3–C10 (Figure 1F). Thus, PevoCDA1-NG, PevoCDA1-eNG, and PhA3Amax-NG with wider editing windows are more suitable for saturated mutation or directed evolution in plants while for site-specific editing, PevoFERNY-NG and PevorAC1-NG are better. Cas9-NG-based editing tools can also mutate sites in the sgRNA-scaffold sequences in plants (Qin et al., 2020Qin R. Li J. Liu X. Xu R. Yang J. Wei P. SpCas9-NG self-targets the sgRNA sequence in plant genome editing.Nat. Plants. 2020; 6: 197-201Crossref PubMed Scopus (16) Google Scholar). To find out whether the self-targeting occurred with PhieCBEs, we sequenced the transgenic sgRNA-scaffold sequences (with GTT-PAM). Low frequencies (3.0%–20.7%) of self-editing occurred at the T6- and/or T8-sgRNA sites, and no self-editing was detected at other targets except for T1 and T2 of PevoCDA1-eNG (Supplemental Figure 5A and 5B). Lower self-editing activities (only at T6-sgRNA) were observed in PevoFERNY-NG and evorAC1-NG. Thus, the sgRNA function of PhieCBEs may not be dominantly destroyed in transgenic cells. CBEs are prone to cause off-target mutations. In addition, evoCDA1 has higher off-target effects than evorAC1 and evoFERNY in mammalians (Thuronyi et al., 2019Thuronyi B.W. Koblan L.W. Levy J.M. Yeh W. Zheng C. Newby G.A. Wilson C. Bhaumik M. Shubina-Oleinik O. Holt J.R. et al.Continuous evolution of base editors with expanded target compatibility and improved activity.Nat. Biotechnol. 2019; 37: 1070-1079Crossref PubMed Scopus (86) Google Scholar). To test the off-target effect, we used CRISPR-GE (Xie et al., 2017Xie X. Ma X. Zhu Q. Zeng D. Li G. Liu Y. CRISPR-GE: a convenient software toolkit for CRISPR-based genome editing.Mol. Plant. 2017; 10: 1246-1249Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar) to search for homologous sites (with one to three base variations) of three targets (T2–T4), and carried out deep sequencing in transformed calli. Rare off-target mutations (0.009%–2.116%) were detected only at three T2-homologous sites containing 1-base variation, but not at those with 2- or 3-base variations (Supplemental Table 1). These data suggest that PhieCBEs might have low off-target activity on target-homologous sites, with PevoCDA1-eNG ≥ PhA3Amax-NG ≥ PevoCDA1-NG > PevoFERNY-NG ≥ PevorAC1-NG. Interestingly, PevoFERNY-NG achieved the highest on-target base-editing activity with lower off-target effects. However, eCas9n-NG did not reduce the off-target effect of the evoCDA1 deaminase. On the contrary, PevoCDA1-eNG exhibited higher on-target editing activity but also along with increased by-product and off-target mutations. The current plant BE3 and BE4 CBEs generally have problems such as low editing efficiency, target-site sequence preference, and limited target scope. In this study, we developed five PhieCBEs by fusion of plant codon-optimized evolved cytidine deaminases and an efficient nuclear localization signal, bpNLS, with Cas9n-NG or eCas9n-NG. We demonstrate that the PhieCBEs worked well in rice, and PevoFERNY-NG has superior comprehensive base-editing properties (e.g., target scope, editing window, editing efficiency, target context compatibility) compared with the other reported plant CBEs (Supplemental Table 2). These robust tools would be useful for plant functional genomics study and practical molecular breeding of crops. This work was supported by grants from the Major Program of Guangdong Basic and Applied Research ( 2019B030302006 ), the National Natural Science Foundation of China ( 31921004 ; 31971915 ), and the Guangdong special support program of Young Top-Notch Talent in Science and Technology Innovation ( 2019TQ05N147 ).

CRISPR/Cas9 systems have been widely used in functional genomics and crop genetic improvement, but the protospacer adjacent motif (PAM) sequence NGG of Streptococcus pyogenes Cas9 (SpCas9) limits its targeting scope. To expand the targetable genomic loci, several other Cas proteins and Cas9 variants with different PAM specificities have been developed (Li et al., 2019), such as Cpf1 (Cas12a) with T-rich PAM, and SpCas9 VQR and VRER variants with non-canonical NGA and NGCA PAM sequence, respectively. Recently, two engineered SpCas9 variants, xCas9 3.7 and Cas9-NG, expand the PAM recognition site to NG and show function efficiency in mammalian cells (Hu et al., 2018; Nishimasu et al., 2018). Although a few tests of the two variants have been reported in plants (Ge et al., 2019; Li et al., 2019), there are still not enough comparative data on their efficiencies on genome and base editing in plants. Furthermore, to reduce the possible off-target effects, it is necessary to develop a new Cas9 variant with both enhanced specificity (eCas9) and altered PAM site such as NG. The eCas9 variant has neutralization of positive charges in the nt-groove that can remarkably decrease off-target (Slaymaker et al., 2016). In this study, we developed a serial of variants including a new eCas9-NG and investigated the editing activities of those variants (xCas9, Cas9-NG and eCas9-NG) with expended target scope in genome editing, cytosine base editors including CBE4, xCas9n-CBE, Cas9n-NG-CBE and eCas9n-NG-CBE, adenine base editors including ABE7.10, xCas9n-ABE, Cas9n-NG-ABE and eCas9n-NG-ABE in transgenic rice. We first generated the xCas9 and Cas9-NG (Figure 1a) based on our previous rice codon-optimized SpCas9 (Ma et al., 2015) referring to the xCas9 3.7 (Hu et al., 2018) and the Cas9-NG variants (Nishimasu et al., 2018). Then, the eCas9-NG variant with K848A/K1003A/R1060A mutations (Slaymaker et al., 2016) was produced using the Cas9-NG (Figure 1a). We selected four target sites with TGN PAMs in OsWaxy (encoding starch synthase enzyme I) to test their genome-editing activities, using the wild-type SpCas9 as a control. We prepared four multiplex genome-editing constructs for rice transformation, each having four sgRNA expression cassettes targeting the TGN target sites, respectively. The results showed the Cas9-NG had the wider targeting scope and different levels of editing activities at non-canonical TGA, TGT and TGC PAM sites (9.1%–45.5%) (Figure 1b), which were similar to the previous reports (Zhong et al., 2019). Compared with Cas9-NG, the new eCas9-NG showed lower editing efficiency at non-canonical target sites with TGA (5.5%) and TGC (8.3%) (Figure 1b), suggesting that the higher specificity of eCas9-NG may affect its editing efficiency. The xCas9 only showed low editing activities (6.1%) at TGG PAM (Figure 1b), which was consistent with the previous findings that the editing efficiencies of xCas9 were low and mainly detected at the NGG PAM in Arabidopsis and rice (Ge et al., 2019; Li et al., 2019). However, the editing efficiencies of Cas9-NG (27.3%) and xCas9 (6.1%) at canonical TGG PAM were significantly reduced compared with that of Cas9 (76.5%; Figure 1b). These results indicate that the Cas9-NG and eCas9-NG could recognize non-canonical PAMs in rice, and their editing activities are better than xCas9. Both variants could generate loss-of-function mutants of the target gene, such as an OsWaxy-knockout mutant by eCas9-NG (Figure 1c). For traditional CBE and ABE editors, their target windows are substantially limited by recognizing NGG PAM (Mishra et al., 2019). Therefore, we tested the potential of these variants to expand the target region of base editing in the rice genome. We fused the rice codon-optimized rAPOBEC and double UGIs to the N-terminus and C-terminus of the nickase variants (D10A) of xCas9, Cas9-NG and eCas9-NG, respectively, to generate four CBE4 base editors (Figure 1d). To compare their CBE efficiency, we selected different target sites with PAMs of TGN and AGN in OsWaxy, CGN in OsEUI1 (Elongated Uppermost Internode 1) and GGN in OsCKX2 (encoding a cytokinin oxidase/dehydrogenase) to construct multiple-targeting vectors for rice transformation. Sequencing analysis of the transformants showed that only Cas9n-NG-CBE and eCas9n-NG-CBE produced the expected C-T conversion at the TGC PAM with efficiency of 13.3% and 22.7%, respectively, but no base-editing activity was detected for target sites with TGG, TGA and TGT PAMs (Figure 1d,j). In addition, insertion/deletion (InDel) mutation was detected in these sites targeted by Cas9n-CBE and eCas9n-NG-CBE but not by Cas9n-NG-CBE (Figure 1e). For other tested PAMs, Cas9n-NG-CBE showed different levels of C-T substitution at canonical PAMs of GGG (50%) and AGG (8.3%), and non-canonical PAMs of CGA (33.3%), GGT (25%) and CGT (5.6%), respectively (Figure 1d). For all tested PAMs, the editing windows of Cas9n-NG-CBE were mainly distributed in C3 ~ C8 and mainly at C6 position (Figure 1d–f), which was consistent with the report in rice (Wang et al., 2019). Compared with other CBE editors, such as Cas9n-NG variants fused with activation-induced deaminase PmCDA1 (Zhong et al., 2019) or hAID (Hua et al., 2019), our Cas9n-NG-CBE showed slightly higher base-editing efficiency than those variants. The Cas9n-CBE had the C-T conversion at the canonical GGG (54.8%) and AGG (22.6%) PAMs (Figure 1d), and the editing window was mainly in C6 position (Figure 1d–f). However, xCas9n-CBE did not detect base-editing activity at TGN PAMs, suggesting it work ineffectively in rice, which is similar to the observations of low efficiencies of xCas9n-CBE in rice (Hua et al., 2019; Li et al., 2019). The possible reasons for the inefficiency of xCas9 and xCas9n-CBE are that their mutations (R324L, S409I and M694I) may affect the recognition and binding of DNA-sgRNA (Hu et al., 2018; Li et al., 2019). These results indicate that the Cas9n-NG-CBE worked in rice at endogenous NG sites with a broad range of PAM sequences and had high base-editing activity at canonical NGG PAM. To expand the target scope of ABE editors, we fused the wtTadA and evolutionary TadA (TadA*) of ABE7.10 base editor (Mishra et al., 2019) to the N-terminus of above Cas9 nickase variants (D10A), to generate Cas9n-ABE, xCas9n-ABE, Cas9n-NG-ABE and eCas9n-NG-ABE, respectively (Figure 1g). We selected the same editing sites as above, and the results showed these ABE7.10 editors barely produced base editing at non-canonical PAM-containing sites, except for Cas9n-ABE at sites with canonical PAMs of GGG (55.6%) and TGG (11.1%), and for Cas9n-NG-ABE at sites with GGG (6.5%), with the editing window mainly at A7 position (Figure 1h–j). The similar results in rice were observed previously that ABE-NG has very low editing activity at sites with PAMs of CGG (2.6%), AGC (2%) and CGT (2.9%), and no adenine base editing was detected using the xCas9n variant (Hua et al., 2019), suggesting that ABE 7.10 base editor is less efficient in rice, and further efforts are also required to test other adenine base editors. These CBE4 and ABE7.10 editors mentioned above produced different frequencies and mutation types, of which Cas9n-NG-CBE induced highest homozygous editing rate (44.8%; Figure 1k). Due to more relaxed NG PAM, we detected these Cas9 variants' off-target editing possibility for each on-target site with TGN PAMs. The potential off-target sites were selected using CRISPR-GE (http://skl.scau.edu.cn/) for sequencing. As expected, we did not find off-target effects of the candidate off-target sites in editing plants by eCas9-NG. However, no off-target effects were also detected at the potential sites using Cas9, xCas9 and Cas9-NG, respectively. These results suggested that these Cas9 variants have a certain degree of specificity, and the specificity of eCas9-NG is also necessary to evaluate at more target sites. In conclusion, our results indicate that the Cas9-NG and eCas9-NG variants enable more efficient genome editing and targeted C-T single nucleotide substitutions with extended non-canonical PAMs than those of xCas9 in rice. The Cas9-NG variant is more suitable for genome engineering in rice. The versatile Cas9 variant tools for genome engineering expand the target scope in rice and possible in other plants, thus will facilitate plant functional genome and crop genetic improvement. This work was supported by grants from the Ministry of Agriculture of China (2016ZX08010001), the National Natural Science Foundation of China (31771740; 31971915) and National Undergraduate Training Programme for Innovation and Entrepreneurship (201710564238). The authors declare no conflict of interest. Y.-G.L. and Q.Z. designed the studies. D.Z., X.L., J.H., Y.L., S.C., W.Y., Y.L., Y.H., X.X., Q.G., J.T., Z.Z. and M.G. performed experiments. Q.Z., Y.-G.L. and D.Z. wrote the paper.