The article presents results of studies on development of systems for genetic detection of coronatin and syringopeptinphytotoxins in genomes of Pseudomonas syringae bacteriophages. A team of authors designed detection systems for fragments of determinants of pathogenicity factors (phytotoxins) – coronatin and syringopeptin with application of electronic resources of NCBI: BLAST nucleotide and PRIMER BLAST. Nucleotide sequences were determined, homologues characteristic of other phytopathogens were studied. The system of oligonucleotides (primers and probe) for detecting a fragment of Pseudomonas syringaephytotoxincoronatin genes (cma A gene) includes primers: forward - CAATTGCATCTCGTCGGCTG, reverse - ATTACAAGCGGCTAACGCCT, probe - BHQ1-ACCAACACGACGGCTTTCAGCC-Fam and syringopeptin (syp C gene): forward primer - CTTGCAGCTT , reverse - TTGCATCGGTTCGTCCAGTC, probe - BHQ1-TGCGCACTGCACTGGTCTGG-Fam. A number of experiments were carried out to improve the amplification protocol: DNA denaturation at a temperature of 95 0C for 300 seconds once; primer annealing - at a temperature of 95 0C for 10 seconds, at a temperature of 60 0C for 30 seconds - 5 cycles; elongation - at a temperature of 95 0C for 5 seconds, at a temperature of 60 0C for 10 seconds fluorescence - 40 cycles. According to the amplification data, these determinants of coronatin and syringopeptin were not identified in the genomes of bacteriophages Ps.s.7 UlGAU and Ps.s.27 UlGAU, which are part of biological product. When studying the genome of the bacterial strain Pseudomonas syringae № 3, used as a mother culture in production of bacteriophage biomass, coronatin and syringopeptin determinants were identified.
Currently, the shortage of fresh water is an important abiotic factor limiting the survival, growth and distribution of plants in semi-arid areas. The productivity of natural forage lands is influenced by seasonal fluctuations in temperature and precipitation, especially characteristic of the steppe Orenburg region. The uneven intra-annual distribution of precipitation does not meet the water needs of the phytocenosis in the vegetative phase of development. The aim of the study was to analyze the effect of atmospheric precipitation on agricultural forage lands of Orenburg region. An important and necessary task is to assess the interaction of agro-climatic factors on the development of agricultural land is an important and necessary task. The research area is located in a zone with a semiarid (semi-arid) climate of temperate latitudes of the Orenburg Urals of the Orenburg region (Orenburg region, Russia). Studies of agricultural land were carried out on 4 plots in the vicinity of the village of Nezhinka, Orenburg district, Orenburg region. For this purpose, various facies of agricultural lands located on the supports of watershed surfaces are identified and analyzed. To study local geosystems of various facies, we used camera methods, aerospace images and in-kind observations. Statistical and mathematical processing of digital data was carried out according to the StatsoftStatisticav 6.1 RUS program. Elements of descriptive statistics of average annual indicators (total precipitation per year, precipitation during the growing season, productivity of natural lands) revealed that the theory of normality was not rejected. The analysis of the average long-term data on the amount of precipitation and their relationship with the productivity of natural forage lands shows a reliable positive correlation between these parameters, at r2 = 0.95. In the conditions of the semi-arid zone during the growing season, plants use the moisture of atmospheric precipitation most effectively
The article presents results of the study of domestic and introduced varieties of sweet cherry in Prikubanskaya garden zone of the Krasnodar Territory in the conditions of temperature stressimpact in the spring period from 2014 to 2021. Since sweet cherry is a rather specific stone fruit crop, whichproductivity is closely dependent on abiotic factors, its cultivation is limited mainly to the southern regions. The purpose of the study was to assess the adaptability of sweet cherry varieties, different in ecological, geographical and genetic origin, to spring stress factors. A yieldvariation of sweet cherry varieties in the south of Russia over the yearswas revealed,it varied from single fruits to 65 kg per treedepending on stressors in the spring period. A close relation (r = 0.855) was established between the yield of varieties and negative temperatures in April, the impact of which leads to yield decrease by 80-90%. Cherry varieties with increased resistance to spring temperature stress factors, characterized by more stable yields within 27.4-32.3 kg per tree or 13.7-16.1 tons per hectare, were distinguished: domestic Dar Izobiliya, Volshebnitsa and Alaya, introduced - Krupnoplodnaya with a yield of 24.7 kg per tree or 12.4 tons per hectare (with a planting pattern of 5 x 4 m).
The article dwells upon the results of three-year experimental data on growth, development and yield of spring hard wheat varieties such as Bezenchukskaya Niva and Bezenchukskaya Zolotistaya under the conditions of the Chuvash Republic. It was established that in case of reduction of seeding amount of viable seeds from 7 to 3 million pcs. per 1 ha, the vegetation duration of the studied varieties of spring hard wheat decreases by 6-7 days. Sowing of 5 million of viable seeds per 1 ha ensured the maximum density of spike-bearing stems due to better parametres of total and productive tillering capacity. The formation of large main wheat head with a high content of grains in Bezenchukskaya Niva variety was noted at seeding amount of viable seeds from 3 to 5 million per 1 ha. Increase of the seeding amount of more than 5 million seeds led to a decrease of main wheat head parameters. The crop structure analysis of Bezenchukskaya Zolotistaya variety did not reveal clear patterns of change in length and grain content parameters of the main wheat head from the seeding amount. However, the highest parameter of 50.4 grams of weight of 1000 grains was obtained in the variant with a seeding amount of 6 million of viable seeds. The maximum yield increase of Bezenchukskaya Niva variety was 2.54 t/ha on average for 3 years, which was obtained on the variant with a seeding amount of 5 million of viable seeds per 1 ha. The highest yield of Bezenchukskaya Zolotistaya variety was 2.23 t/ha on average for 3 years, it was obtained at a seeding rate of 6 million of viable seeds per 1 ha.
Sorghum occupies a significant place in world agriculture and is of particular value in intensive feed production. The selection of agricultural practices for increase of seed productivity is relevant and current, since the availability of own seeds is of decisive importance in reduction of feed production cost. The studies were carried out in Omsk region in 2013, 2015–2017 in a stationary field experiment in eight-field crop rotation. The aim of the work is to study the influence of mineral nutrition conditions on yield of sweet sorghum seeds, water and nutritional regimes of meadow-black soil in the conditions of the south of Western Siberia. The experiment included a three-factor scheme: the supply of soil with mobile phosphorus according to Chirikov (factor A) - average, 50-100 mg/kg (background 0); increased, 100-120 mg/kg (I) and 140-150 mg/kg (II); high, 150-200 mg/kg (III); phosphorus fertilizer (factor B) - P0, P60; nitrogen fertilizer (factor C) - N0, N30, N60. The field experiment was implemented by mutual method of pre-sowing application of mineral fertilizers and different levels of phosphorus in the soil. The soil is meadow-black soil, medium-thick, medium-humus, heavy loamy. The reaction of the soil environment in the arable layer is neutral, the depth of groundwater in spring is 2.86, in autumn - 3.09 m. The climate of the southern forest-steppe of Omsk region is suitable for sweet sorghum cultivation with insufficient moisture in some years and uneven distribution of precipitation during the growing season. The yield of sweet sorghum seeds ranged from 2.93 to 3.46 t/ha on average for 3 years, depending on the background, the largest yield increase was noted on 0 background (N60P60) with a natural level of mobile phosphorus and pre-sowing application of nitrogen and phosphorus fertilizers. It is possible to obtain seeds of sweet sorghum in the southern forest-steppe of Omsk region. To achieve high yields on soils with an average content of mobile phosphorus, it is necessary to use nitrogen and phosphorus fertilizers. It is also indispensable to select an early ripening variety capable of forming high quality seeds in the specific conditions of Siberia.
The article presents a study of millet in the system of dry farming, depending on abiotic factors of the environment of the steppe zone of the Southern Urals. The paper compiles long-term data (2002-2021) on air temperature, precipitation, dry wind days and millet grain yield in Orenburg region. Studies of millet were carried out on the experimental field plot founded in 1990 on southern black soils of Orenburg region. The aim of the study is to determine the best impact of unregulated weather factors (precipitation, temperature, dry winds) on millet yield in crop rotations and in monocrops after application of mineral fertilizers. The research was carried out according to generally accepted method of field experiment. The object of the experiment is millet. The scheme of the experiment consists of six variants of millet sowing in four repetitions. Based on the interesting points of the study, the maximum rainfall for July is 42.2 mm and for June is 33.3 mm. Elevated temperature is observed in July 22.8 °C and the largest number of dry windy days in August is 18. The average temperature for the period (May-August) is 20.5 °C, precipitation is 125.6; 116.3 mm, dry winds - 64.0 days. There is mainly a negative reaction of millet to mineral fertilizers in the study, leading to a yield decrease ranging from 0.80 to 0.52 t/ha. The fifth variant in a two-field crop rotation has the highest yield on the agricultural background with fertilizers of 1.21 t/ha. As a result of statistical analysis of the data, it is revealed that the best impact on millet yield at two levels of agricultural background is exerted by precipitation that fell in July, except the fifth variant. The share of the influence of July precipitation was notedly determined in the second variant of the field experiment and was 70.81; 66.05% at a significance level of 0.000003; 0.000013. It is necessary to cultivate millet after hard wheat in a two-field crop rotation, since usage of fertilizers provides an increase by 0.35 tons of grain.
The article presents results of studies of a new highly effective feed additive "Pravad" based on probiotics, adaptogenes, vitamins and amino acids, which has shown itself to advantage in fish farming. Acute toxicity of Pravad feed additive was studied on laboratory animals (rats) and the hazard class was established when it was orally administered. Subchronic toxicity of the feed additive was studied, its results allowto identify the presence or absence of a combination of functional and/or morphophysiological disorders of organs and systems in case of its application. The components that make up the new feed additive are, according to State Standard GOST 12.1.007, low-toxic substances of the 4th hazard class. The obtained results on the study of acute and subchronic toxicity of Pravad feed additive showit has no toxic effect. Long-term observations of laboratory animals on which Pravad feed additive was tested did not reveal any signs of somatic distress. The results of assessment of biochemical parameters and leukocyte formula did not reveal significant differences among parametres of the experimental and control groups. This indicates that introduction of Pravad feed additive into the ration does not have a negative impact on homeostasis of animals. Intragastric administration of Pravad feed additive did not cause significant changes in the mass coefficients of kidneys, lungs, spleen, heart and liver compared to control animals. Pathological and anatomical autopsy of the animals of the experimental group did not reveal any deviations of internal organs in comparison with the animals of the control group.
Soil enzymatic activity is the most important biochemical parameter of soil fertility and it is determined by chemical composition, species and quantitative diversity of soil microbiota and plants, and the set and degree of activity of soil enzymes. The article shows the dynamics of enzymatic activity of the soil contaminated with oil from Vishenskoyedeposit in Melekesskiy district of Ulyanovsk region before and after spring wheatcultivation, as well as using biohumus, zeolite and diatomite sorbents. To assess the biological state of the soil contaminated with oil products, the activity of the main enzymes of the soil pool of the class of oxidoreductases (polyphenol oxidase), peroxidase, catalase) and the class of hydrolases (phosphatase, invertase) was determined. As a result of the studies, it was found that oil pollution reduces activity of oxidoreductase and part of hydrolytic enzymes. The inhibitiondegree correlates with oilconcentration in the soil. A direct dependence of inhibitiondegree of polyphenol oxidase, catalase, phosphatase and invertase on oil concentration was found. It was found that introduction of diatomite increased the activity of peroxidase and invertase, zeolite and biohumus - phosphatase. To assess the state of soil fertility, humus accumulation coefficient (humification coefficient) is used, which is defined as the ratio of polyphenol oxidase activity to peroxidase activity. This coefficient allowsto assess the tendencies of humus formation processes: humification or mineralization. It was determined that the introduction of low doses of oil (2-3%) increases humification coefficient, and high concentrations (8%) reduce it. To diagnose the state of oil-contaminated soils, it is recommended to determine the activity of basic enzymes: polyphenol oxidase, peroxidase, catalase, phosphatase, and invertase.
The article provides analysis of the main directions for efficiency increase of diesel fuel sage for automotive and tractor equipment. The purpose of the study is to substantiate rational concentration of antiwear additive for diesel fuel containing surface active agent of organic origin. The possibility of using vegetable oils (flax, mustard and rapeseed) and their individual components (oleic acid) in low concentrations (up to 10%) as antiwear additives to diesel fuel is considered. According to results of laboratory studies on a tribometer of TU type with a four-ball friction unit, appropriate concentrations of antiwear additive were determined. According to results of the experiments, it was found that inclusion of up to 10% of vegetable oil (flax, mustard and rapeseed) to diesel fuel allowsto increase tribological properties of the fuel without negative effects. In this case, appropriate concentration is 2%, which allows to get maximum increase of tribological properties with minimumcosts of the additive. When using oleic acid, a concentration of 2% is also appropriate, but when the concentration exceeds 4%, there are such conditions in friction pairs that are favorable for the effect of adsorption strength decrease of the rubbing surfaces, which leads to an increase oftheir wear. Oleic acid application in the amount of more than 4% is considered impractical.
In the modern market of feed and feed additives, a new trend has emerged - functional feeding complexes that heal fish, correct its metabolism, and increase productivity and quality of fish products. Such feed additives include "PRAVAD" polyvalent functional feed additive. The aim of the research was to study the effect of the new feed additive "PRAVAD" on parameters of fish antioxidant system. In order to accomplish this, two groups of sexually mature African catfish were formed. The first experimental group received PRAVAD feed supplement containing probiotics, adaptogens, essential amino acids and vitamins. It was used in addition to the main diet - "Som" feeds of LimKorm company. The control group, which was the second, received only LimKorm “Som” feed. Three months later, the content of glutathione (GSH) and the activity of glutathione-S-transferase (GST) were examined. As for fish reared with application of "PRAVAD" polyvalent functional feed additive, the GSH level of males was two times higher than that of the fish of the control group. GST activity in the group of males and females fed with the feed additive was more than 30% higher than in fish of the control group. The obtained results indicate that application of "PRAVAD" polyvalent functional feed additive in the diet of African catfish is highly effective and leads to a decrease of the damaging effect of oxidative stress. This mechanism is realized by increase of glutathione level and glutathione-S-transferase activity, both of which increase resistance to free radical and peroxide processes.
The article presents results of studies on usage of ultra-dispersive humate-sapropel suspensionin animal feeding, its effect on biochemical parameters of blood serum, including those which characterize functional state of liver.Moreover, a comparative analysis of introduction of two dosages into the rationwas carried out. The studies were carried out in the conditions of the farm SPK "ImeniIlyicha" in Novgorod region on Holstein heifers selected for insemination. It was establishedthat usage of ultra-dispersive humate-sapropel suspension in combination with the main diet at the doses of 20 ml and 25 ml allowedto increasecreatininecontent by 10.4% and 13.2%, respectively. In the same way, the consumption of ultra-dispersive humate-sapropel suspension affected the concentration of glucose in blood serum of heifers of the experimental groups, increasing it by 30.2% (20 ml) and 9.2% (25 ml). Introduction of the suspension into the rationimprovedbilirubinconcentration, increasing its values in the first experimental group by 39.6% and 14.6% in the second. There is a decrease in De Ritis coefficient by 17% (20 ml of ultra-dispersive humate-sapropel suspension) and 13.3% (25 ml) in the experimental groups; usage of ultra-dispersive humate-sapropel suspension at a dose of 20 ml in the experiment led to a decrease in Gamma HT activity by 14.6%, which allows to make an assumption about the therapeutic efficacy of ultra-dispersive humate-sapropel suspension ashepatoprotector. Thus, on the basis of the experimental data obtained, it is possible to recommend usage of ultra-dispersive humate-sapropel suspension in the rations of young animals in case of violations of liverfunctional state, as well as for preventive purposes at a dose of 20 ml per head per day.
The studies were carried out in order to determine the appropriate period of sowing and doses of mineral fertilizers for sweet sorghum in 2018-2020 on leached medium-thick, heavy loamy black soil of Zakamie of the Republic of Tatarstan. Humus content was 6.0-6.2% (according to Tyurin), alkaline hydrolysable nitrogen - 81-84 mg/kg, mobile forms of phosphorus - 167-170 mg, exchangeable potassium - 172-173 mg/kg of soil (according to Chirikov); the sum of the absorbed bases is 40.3-40.8 mg-eq per 100 g of soil, hydrolytic acidity - 3.42-3.50, pH of the salt extract - 5.6-5.7. The seeding amount was 300,000 pcs/ha of viable seeds, the depth of seed placement was 5–6 cm. Mineral fertilizers were applied after harvesting the previous crop, before main tillage. The main tillage type was 22 - 24 cm depth plowing. The forecrop was annual grasses for haylage. High weediness was observed in sorghum crops of the first term (10 May). Moreover, the doses of applied fertilizers significantly increased the weed infestation, their number was 58 pcs/m2on an unfertilized background in the full shoots phase, whereas, their number was 69 pcs/m2 on the background of N60P60K60, and 76 pcs/m2 on the background of N80P80K80. The above trend persisted throughout the growing season of the agrophytocenosis. The sowing time and the mineral nutrition background influenced both the growing season duration and crop formation: N60P60K60, the duration of the growing season averaged 113 days over three years, which is 9 days more compared to the control. The variant of the mineral background up to N80P80K80 increased the vegetation period by 15 days compared to the unfertilized variant of the experiment. The mineral nutrition background of N60P60K60 in the second term of sorghum sowing allowed to obtain a yield increase of feed mass from 6.6 to 8.0 t/ha. The application of mineral fertilizers at a dose of N80P80K80 provided a yield increase from 10.8 to 15.4 t/ha.
The article shows the results of studying the influence of soil moisture, cellulose-decomposing activity of microorganisms and the amount of nutrients on barley productivity in crop rotations and monocrops in the central zone of Orenburg region. The purpose of the experiment is to identify the effect of moisture, soil cellulolytic activity and macronutrients (nitrates, phosphorus, potassium) on barley productivity increase in crop rotations and in monocrop cultivation. The following research methods were used: field, thermostatic-weight, application-weight, ionometric and Machigin methods. There was a yield increase of barley feed and energy units up to 2.10, 1.63 and 1.24, 0.96 t/ha in the second and fourth variants of the experiment on a fertilized background on average for 2002-2020. The increase of feed unit yield occurs due to productive moisture utilization by the plant during the growing season of 32.3, 32.2 mm, nitrates - 4.20, 1.91 mg, phosphorus - 1.76, 0.50 and potassium - 2.47, 1.01 mg/100 g of soil in case of cellulose- decomposing activity of microorganisms - 7.93 and 10.37%. As far as other variants of the experiment is concerned, the range of soil moisture on nutritional background is from 17.4 to 41.7 mm during sowing and 3.5-10.5 mm during harvesting; the degree of linen decomposition - 4.05-9.37%, the content of digestible nitrates - 0.05-1.11 mg, mobile phosphorus - 0.04-0.29 mg, exchangeable potassium - 0.05-0.95 mg /100 g, feed units - 1.16-1.44 t, energy units - 0.68-0.85 t per 1 ha. As a result of the study, the influence of moisture, activity of microorganisms, nutrients on barley productivity growth was determined as a result of the aftereffects of millet and peas in crop rotations after application of mineral fertilizers at a dose of 40: 80: 40 kg (N: P: K) of the active substance per 1 ha. The yield dependence of barley energy feed units in a crop rotation with millet on the content of used nitrates in the arable soil layer was found.
The article is devoted to development of aquaculture of Artemia (A. Salina). Decapsulated eggs and live Artemianauplii, which have a high nutritional value and a necessary set of biologically active substances, are widely used in cultivation of fish larvae. Biological characteristics of Artemia, such as rapid growth, high fecundity, the amount of cysts that are preserved and stored, contributed to its commercialization. The demand for Artemia eggs is growing from year to year in the world market, but the volume of their production in natural reservoirs supplies only 40% of the demand. The missing volumes of Artemia can be satisfied by artificial reproduction in aquaculture. The purpose of our research was to assess the factors that regulate the ontogeny and productivity of A. Salina in aquaculture. The results of the research showed that the cultivation conditions we created, such as270Ctemperature, illumination intensity of 1500 lux, saturation of the environment with oxygen (SO2) - 90%, pH 8.2,provided 82% hatching of nauplii within the first day, and the hatching increased and reached 96-97% on the second day. Experimentally selected abiotic and biotic factors that determine the effectiveness of Artemiacultivation have shown fairly good results. Analysis of literature sources and our own data showed that it is not enough to improve abiotic and biotic factors inn case of in vitro cultivationin order to obtain high productivity of Artemia, first of all, it is necessary to have high-quality material - Artemia cysts or eggs, which should belocallyproduced, cultivating Artemia in a closed cycle. Development of effective biotechnology for artificial reproduction of Artemia in vitro is of great practical importance.
A comparative evaluation of two adjuvants: polyazolidinammonium modified with iodine hydrate ions (PAAH) and complete Freud's adjuvant (CFA) was conducted. The assessment was carried out in the process of hyperimmunization of rabbits with a mixture of an adjuvant and dimethyl sulfoxide antigen (DA) of a pseudotuberculous microbe. Both adjuvants stimulated antibody genesis and allowed to obtain hyperimmune sera with high antibody titers. However, CFA showed a slightly higher activity (1:819200) than PAAH (1:409600). The most pronounced stimulating effect of adjuvants was expressed at low doses of DA (0.2-1 mg/rabbit). Large doses of the antigen (16.0 mg/rabbit) enabled to obtain sera with a high antibody titer without adjuvants. The stimulating effect of DA-PAAH and DA-CFA complexes on antibody genesis is associated with the rate and quality of lymphocyte differentiation, and to a lesser extent with an increase of their number. PAAH showed a weak irritating effect on body tissues at the injection spot, and CFA had a strong irritating effect. The application of CFA led to formation of many painful indurations in the subcutaneous tissue of rabbits, which did not resolve between immunizations. Thus, usage of PAAH as an adjuvant in hyperimmunization of rabbits with DA of the pseudotuberculous microbe is potentially productive and without CFA disadvantages.
One of the leading factors of intensification of cultivation processes of agricultural products is crop rotation. Mineral fertilizers are also an essential element of farming systems. The aim of the work was to determine the influence of these two factors and their combinations on biological yield and structure of winter wheat harvest. The studies were carried out in 2019-2021 on stationary field experiment of the Federal State Budgetary Scientific Institution Federal Agricultural Kursk Research Center in Medvenskiy district of Kursk region. The soil is typical heavy loamy black soil. Winter wheat was cultivated in 3 crop rotations, where the forecrops were black fallow, green manure fallow (peas) and sown fallow (horse beans). The scheme of the experiment included for 4 levels of fertilization: without fertilizers, N60P60K60, N80P80K80, N100P100K100 kg a.i. per 1 ha. Black fallow showed the highest biological yield on high background of fertilization, as for medium and low fertilization, and also without fertilizers - on green manure. Increase of doses of mineral fertilizers provided a yieldincrease. Total and productive bushiness of winter wheat was higher in combination with green manure fallow, and the weight of 1000 grains and the number of grains in the wheat head of the main stem were higher in case of black fallow. The harvest structure parameters were lower in crop rotationthan in the other two rotations. A tendency ofparameter increase of the harvest structure was revealed: total and productive bushiness, weight of 1000 grains, the number of grains in the wheat head of the main stem in case of fertilizationlevelincrease. A close positive relationship was established between the biological yield of the crop and the total (r = 0.958) and productive (r = 0.956) bushiness, as well as the number of grains in the wheat head of the main stem (r = 0.911).
The paper presents data on growth characteristics of three cross-bred Simmental × Ayrshire × Holstein heifers. The study of growth and development of three crossbred animals showed that there is a tendency of more intensive growth of crossbred young animals of 1/8c + 1/8a + 3/4kpg and 1/16c + 1/16a + 7/8kpg genotype since the age of 6 months, which continues up to 18 months of age. The advantage of heifers of 1/8c+1/8a+3/4kpg and 1/16c+1/16a+7/8 kpg genotypes at 6 months old was 8.1-8.6 kg, at 9 months old - 9 .2 - 12.1 kg, at 12 months old - 14.7 - 18.7 kg (Р≥ 0.95), at 15 months old - 13.9-21.4 (Р≥0.95) and at 18 months old - 12.3 - 23.2 kg (P≥0.95). As far as the group of heifers with 1/16c+1/16a+7/8kpg genotype is concerned, the average daily gain was higher than their peers in all age periods. The greatest average daily increase of 775-801 grams was noted in the period from 6 months to one year old, which is 39-73 grams more than the peers of 1/4c+1/4a+1/2kpg genotype and 27-9.0 grams more than the peers of 1/ 8c+1/8a+3/4kpg genotype. At the age of 18 months, heifers of 1/16c+1/16a+7/8kpg genotype were superior to their peers of 1/4c+1/4a+1/2kpg genotype in withers height by 3.0 cm (P≥0.999), rump height by 4.9 cm (P ≥ 0.999), chest depth by 6.8 cm (P ≥ 0.999), chest girth by 19 cm (P ≥ 0.999), oblique body length by 8.6 cm (P 0.999) , width of pin bones by 2.0 cm (P≥ 0.999), head length and forehead length (P≥ 0.999). Significant differences at the age of 18 months were revealed in withers height, oblique body length and chest girth (P≥0.99; 0.999) between heifers of 1/16c+1/16a+7/8kpg and 1/8c+1/8a+ 3/4kg genotypes.
The paper presents results of thestudies on assessment of the role of organic substances created in crop rotation agrocenoses and used as fertilizer for agricultural crops (straw, green manure, crop- root residues). The studies were carried out in a five-field grain crop rotation with alternation: vetch-oat mixture as a green manure crop - winter wheat - millet - spring wheat - barley. The scheme of the experiment consisted of six variants with application of organic, organo-mineral and mineral fertilizers: 1. Control (green manure); 2. Straw of the forecrop; 3.Straw of the forecrop+ 10 kg of nitrogen (urea) per 1 ton of straw; 4.Straw of the forecrop+ Biocomposite-correctbiological preparation; 5.Biocomposite-correctbiopreparation; 6. NPK (doses of fertilizers for the planned yield of winter wheat 4.5 t/ha, millet 4.0 t/ha, spring wheat 4.0 t/ha, barley 4.0 t/ha). It was found that usage of straw as an organic fertilizer contributes to an increase of crop yields in the first year of application. Its effectiveness is greatly increased in combination with a nitrogen supplement and a biological product: the increase of grain yield was (depending on crops) from 0.19 to 0.51 t/ha. The amount of organic matter entering the soil per 1 hectare of crop rotation area in case of combined usage of green manure, straw and crop-root residues was 2 times higher than the control variant (green manure). Complete reproduction and preservation of humus content is possible in case of combined usage of green manure, straw, crop- root residues and biological preparations as organic fertilizers in order to improve the conditions of their decomposition.
The work was carried out in 2019–2021 in the conditions of the forest-steppe of the Middle Volga region on leached heavy loamy black soil with a content of humus of 6.27%, 235–291 mg/kg of available phosphorus, 95–138 mg/kg of exchangeable potassiumin the arable layer, with a sum of absorbed bases of 39.7–42.2 mg-eq/100 g, pHkcl close to neutral (6.2 units). Crop rotation was seven-field grain-grass with the following alternation of crops: 1) pea - 2) winter wheat - intermediate sowing (mustard) - 3) winter wheat - 4) barley + perennial grasses - 5) perennial grasses 1 year– 6) perennial grasses 2 year– 7) spring wheat. The experiment was repeated three times, the placement of plots was systematic. The intensive technology included usage of calculated doses of mineral fertilizers, the treatment of crops with herbicides, usage of fungicides and insecticides, fertilization with nitrogen fertilizers and growth stimulators. As far asbiologized cultivation technology is concerned, all chemical agents were replaced by biological ones (fertilizers, plant protection). The research results showed that the technologies studied in the experiment had an unequal effect on soil properties, as well as on formation of productive moisture reserves in the arable layer of leached black soil. The yield of peain case ofbiologized cultivation technology over the years of research was at the level of 2.08 t/ha, which practically does not differ from the variant with intensive technology (2.17 t/ha): the difference between them was not significant. Cultivation of peas using biologized technology is the most cost-effective. Concurrently, the cost of grain varied from 4,563 to 5,705 rubles/ha, the profit per 1 ha was 10,307–13,754 rubles/ha, the profitability of production was 81–119% (average over 3 years, 105%), while it was 21-83% (average 57%)for intensive technology.
The main task of maral breeding isproduction increase of antlers. Application of molecular genetic methods in maral breeding contributes to increase in reliability and accuracy of assessment of productivity and breeding value of stag deer at an early age. The purpose of the research is to test methods DNA isolation from biological material of marals. The biomaterial was selected fromstag deer of Altai-Sayan breed (blood, antler crumbs, cartilaginous tissue of the auricles). The work on DNA isolation from maral tissue samples was carried out in the bioengineering laboratory at Altai State University (Barnaul). DNA isolation was conducted using the method based on application of Chelex-100TM Resin chelating agent (Bio-Rad, USA), the method based on DNA precipitation Diamond DNA (OOO ABT, Russia) and commercial kit based on magnetic particles AMPure XP (Beckman Coulter, USA). The purification degree of the isolated DNA was assessed by PCR efficiency in reactions of amplification of the genes of cytochrome oxidase 1, cytochrome B of mitochondrial DNA. The highest concentration of maral DNA was established in isolation based on DNA precipitation (Diamond DNA). The concentration of DNA in the solution was 13.20 ng/µl (blood), 11.30 ng/µl (cartilaginous tissue), 5.74 ng/µl (antler crumbs).
