Glycogen storage disease type IIIa (GSDIIIa) causes progressive cardiomyopathy, and current high-fat dietary strategies lack consensus regarding long-term cardiovascular safety. We evaluated the efficacy and safety of high-protein versus high-fat diets in a novel cardiac-specific AGL knockout (CKO; AGLflox/flox/MHC-Cre) mouse model to specifically assess isolated cardiac responses. CKO mice were randomized at weaning to High-Protein (HPD), High-Protein High-Fat (HPHFD), or Low-Protein (LPD) diets, with approximate protein/fat/carbohydrate distributions of 40%/4%/50%, 40%/50%/10%, and 10%/4%/80%, respectively; CKO mice on normal diet (ND) and AGLflox/flox mice served as controls. Cardiac phenotypes and hepatic gluconeogenic enzymes were evaluated longitudinally up to 24 weeks. CKO-ND mice developed progressive cardiomyopathy with elevated myocardial glycogen at 24 weeks (32.01 ± 3.22 vs. 5.90 ± 2.21 mg/g in controls, p < 0.001), reduced left ventricular ejection fraction, and elevated serum creatine kinase. Both HPD and HPHFD significantly reduced myocardial glycogen burden (12.82 ± 3.58 and 15.07 ± 4.40 mg/g, p < 0.001), restored systolic function, and normalized hypertrophy. However, HPHFD induced distinct hyperlipidemia, whereas HPD maintained a stable lipid profile. Furthermore, therapeutic benefits in high-protein groups were associated with upregulated hepatic rate-limiting gluconeogenic enzymes (FBP2, PCK1). In this cardiac-specific AGL knockout model, a high-protein, non-high-fat diet attenuated cardiac glycogen accumulation and systolic dysfunction without the hyperlipidemia observed with the high-fat regimen. These preclinical findings support further evaluation of high-protein dietary strategies for GSDIIIa cardiomyopathy and suggest a possible liver-heart metabolic axis involving hepatic gluconeogenesis.

Hyperphosphatemic familial tumoral calcinosis (HFTC) is a rare autosomal recessive disorder characterized by hyperphosphatemia and ectopic calcifications. Mutations in GALNT3, which encodes a key enzyme responsible for O-glycosylation of FGF23, represent a major genetic cause of HFTC. This modification is essential for the stability and secretion of FGF23. We investigated a 4-year and 6-month-old Chinese girl with HFTC to characterize the clinical features, identify the causative variants, and explore the underlying pathogenic mechanism. Whole-exome sequencing followed by Sanger validation identified novel compound heterozygous variants in GALNT3 (c.659T>A, p.Ile220Asn and c.1850C>A, p.Ser617*). The patient exhibited hyperphosphatemia with a biochemical profile consistent with FGF23 deficiency, including extremely low intact FGF23 and elevated C-terminal fragments. Functional studies using Western blotting and wheat germ agglutinin affinity chromatography demonstrated that the mutant GALNT3 caused a severe defect in FGF23 O-glycosylation, leading to impaired secretion of intact FGF23. Glycosylated FGF23 was detected only in the medium of cells expressing wild-type GALNT3. These findings indicate that defective O-glycosylation results in failure of FGF23 secretion and functional inactivation. This study expands the mutational spectrum of GALNT3 and provides mechanistic insight into the role of GALNT3 in phosphate homeostasis.

Familial partial lipodystrophy type 3 (FPLD3) is a rare autosomal dominant disorder caused by mutations in peroxisome proliferator-activated receptor gamma(PPARG), which encodes the key adipogenic transcription factor peroxisome proliferator-activated receptor gamma(PPARγ). Clinical diagnosis is challenging due to phenotypic overlap with common metabolic syndromes. We identified a novel PPARG variant in a Chinese family and performed comprehensive functional characterization to elucidate its pathogenic mechanism. The proband, a 15-year-old boy presenting with atypical fat distribution, severe insulin resistance, hypertriglyceridemia, and pancreatitis, underwent clinical evaluation and whole-exome sequencing. The identified variant was confirmed by Sanger sequencing. Its functional impact was assessed through in silico modeling, luciferase reporter assays, protein stability analysis (cycloheximide chase), and evaluation of mitochondrial function (JC-1 staining) and adipocyte gene expression in cellular models. A heterozygous PPARG c.634C>T (p.Arg212Trp, R212W) variant was identified and segregated with the phenotype. Functional studies revealed that the R212W mutant exhibits a partial loss of transcriptional activity (~40% of wild-type) while retaining ligand sensitivity. Crucially, we demonstrated that the mutant protein has significantly reduced stability due to accelerated degradation. In adipocyte models, R212W expression led to impaired mitochondrial membrane potential, depleted cellular ATP levels, and downregulated expression of key metabolic genes (glucose transporter 4[GLUT4], adiponectin[ADIPOQ], fatty acid binding protein 4[FABP4], lipoprotein lipase[LPL], perilipin 1[PLIN1]). These functional deficits were partially rescued by treatment with the PPARγ agonist rosiglitazone. We report a novel pathogenic PPARG R212W variant associated with FPLD3. Our data extend beyond a simple loss-of-function model by establishing a multi-faceted pathogenic mechanism involving protein destabilization, mitochondrial dysfunction, and cellular bioenergetic failure. The partial rescue by rosiglitazone suggests a potential therapeutic avenue. This study underscores the importance of integrating clinical phenotyping with deep functional analysis to diagnose and understand rare monogenic lipodystrophies.

Background: Turner syndrome (TS) is a congenital sex chromosome disorder. Krabbe disease (KD) is a rare autosomal recessive neurometabolic disorder. Here, we reported the first case of a child with both conditions. Case Description: A girl presenting as short stature was diagnosed with 45,X TS at the age of 9 years, showed significant height improvement with recombinant human growth hormone (rhGH) therapy, which was well-tolerated without drug-related adverse events. At age 14 years, she was hospitalized with nausea, abdominal pain, dizziness, fatigue, and weight loss, and was diagnosed with secondary adrenal insufficiency. Comprehensive evaluation ruled out TS and prior rhGH therapy as causes for secondary adrenal insufficiency, prompting consideration of other inherited metabolic disorders. Ultimately, the multidisciplinary team conducted an evaluation confirming KD through genetic testing and detection of below-normal galactocerebrosidase enzyme activity (40.6 nmol/17h/mg protein). Since her height improvement was satisfactory, rhGH therapy was temporarily discontinued. After evaluation, she was deemed ineligible for hematopoietic stem cell transplantation. We initiated hydrocortisone replacement therapy to address her adrenal insufficiency symptoms. Conclusions: Overall, this case highlighted that secondary adrenal insufficiency could serve as an atypical clinical manifestation of KD. Furthermore, rhGH demonstrated satisfactory efficacy and safety in improving short stature in patient with 45,X TS.

OBJECTIVES:The study compares the efficacy, adherence, and cost-effectiveness of three recombinant human growth hormone (rhGH) regimens in children with idiopathic short stature (ISS) to optimize treatments. METHODS:This retrospective cohort study involved 105 children with ISS who were divided into three groups: short-acting rhGH for 48 weeks (Group 1), PEG-rhGH for 48 weeks (Group 2), and sequential therapy (PEG-rhGH for 24 weeks + short-acting rhGH for 24 weeks) (Group 3). The primary endpoints were the annual changes in the height standard deviation score (ΔHtSDS) and height velocity (HV). Adherence was measured by the missed injection rate (%), and the cost-effectiveness analysis employed the cost-effectiveness ratio. RESULTS:After one year, all regimens improved HtSDS and HV (p<0.05), with Groups 2 and 3 showing better HV and ΔHtSDS than Group 1. Group 2 had the highest adherence (0 % missed rate), followed by Group 3 (0.14 %) and Group 1 (0.27 %). Missed injections were the only significant predictor of ΔHtSDS (β=-0.196, p=0.048). Financially, Group 3 had lower costs (¥64,730) and a better cost-effectiveness ratio than Group 2 (¥67,479). No serious adverse events occurred. CONCLUSIONS:Sequential therapy offers efficacy and compliance benefits for long-acting rhGH while lowering costs, thus making it suitable for ISS treatment. Long-acting therapy is ideal for individuals with the financial means to support such treatment, whereas short-acting therapy is an option for individuals facing budgetary constraints. Future research should include longer follow-up and quality-of-life (QoL) assessments to improve the cost-benefit analysis.

OBJECTIVES:Oliver-McFarlane syndrome (OMS) is an extremely rare autosomal recessive disorder primarily characterized by the triad of trichomegaly, congenital hypopituitarism, and chorioretinal degeneration. This study aims to report the clinical and genetic characteristics of the first identified Chinese sibling pair with OMS and to expand the known phenotypic spectrum by documenting a novel clinical feature. CASE PRESENTATION:We report two Chinese siblings with OMS harboring identical compound heterozygous PNPLA6 variants: c.2990C>T (p.Ser997Leu) and c.3367G>A (p.Gly1123Arg). Both presented with growth hormone deficiency (GHD), short stature, retinitis pigmentosa, and characteristic hair anomalies. Notably, the elder brother exhibited intellectual disability and secondary adrenocortical insufficiency - a feature not previously documented in OMS. In contrast, the younger sister had normal adrenal function and higher cognitive levels. Both patients showed a significant positive growth response to recombinant human growth hormone (rhGH) therapy. CONCLUSIONS:This study expands the phenotypic spectrum of PNPLA6-associated OMS to include adrenocortical insufficiency and highlights significant intrafamilial variability.

Pediatric growth hormone deficiency (GHD) typically requires daily injections of recombinant human growth hormone (rhGH). Long-acting PEGylated recombinant human growth hormone (PEG-rhGH) formulations have been developed to reduce injection frequency and improve adherence and quality of life. However, guidance on switching between short-acting and long-acting regimens during treatment and biomarker-driven precision dose-conversion strategies remains lacking in real-world clinical practice. Therefore, this study analyzed data from two populations comprising healthy adult male subjects (n = 39) and pediatric patients with GHD (n = 408). The analysis used population pharmacokinetic (PopPK) and population pharmacokinetic/pharmacodynamic (PopPK/PD) models. The models showed adequate fit and external predictability. Biomarker-clinical growth endpoint relationship analysis linked changes in insulin-like growth factor-1 standard deviation score (IGF-1 SDS) to growth outcomes, and simulations assessed subgroup responses, missed-dose scenarios, and IGF-1 SDS-guided switching. Simulations enabled subgroup-specific efficacy projections. Missed doses caused a greater loss of benefit with rhGH than with PEG-rhGH. Switching simulations supported IGF-1 SDS-guided conversion within accepted safety limits. The integrated framework provides concise, clinically interpretable rules for individualized titration, adherence-aware care, and safer switching in pediatric GHD. This study supports precision dosing, missed-dose management, and switching between daily rhGH and weekly PEG-rhGH in pediatric GHD.

OBJECTIVES:To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS:A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS:All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS:This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.

This study aims to validate the auxiliary effect of a commercially available AI-powered X-ray bone age analyzer for physicians and to evaluate its impact on the accuracy, consistency, and time efficiency of bone age assessment in Chinese children and adolescents. We conducted a multicenter, prospective study involving 1000 children aged 1 to 18 years across five centers in China. Radiographs were independently assessed for TW3-RUS and TW3-Carpal bone age by five physicians—three juniors and two seniors—both without and with AI assistance. An additional AI group was included, relying solely on the AI analyzer. With AI assistance, the mean absolute error for TW3-RUS ranged from 0.34 to 0.49 for different raters, while for TW3-Carpal, it ranged from 0.32 to 0.46. The mean squared error was between 0.20 and 0.40 for TW3-RUS and between 0.18 and 0.36 for TW3-Carpal. The accuracy varied from 88.20 to 96.80

Background The increasing incidence of precocious puberty is a major health challenge for Chinese children, while related risk factors remain less well explored. Exposure to ambient fine particulate matter (PM2.5) is a leading environmental hazard in China. Although certain components of PM2.5 have been reported to be endocrine disruptors for sex hormones, population-based evidence is still lacking on the association between PM2.5 exposure and precocious puberty in China. Objective Based on a cross-sectional survey covering 30 cities in 2017 to 2019, this study was designed to explore the association between long-term exposure to PM2.5 and its 5 major components with precocious puberty in China and to check the potential modifying effects of family-related and personal factors. Methods We included 34,105 children aged 6 to 9 years. We collected the 5-year average concentrations of PM2.5 and its 5 major components (sulfate, nitrate, ammonium, organic matter, and black carbon) in the area (at a spatial resolution of 0.1° × 0.1°) where each school was located. We used mixed effect logistic regression to estimate the effect sizes of the total mass of PM2.5 and each of its components on precocious puberty, and we examined the modifying effects of family-related and personal factors using an additional interactive term. A weighted quantile sum (WQS) regression model was applied to identify the weights of each component in explaining the effect size of the total mass of PM2.5. Results We found that the odds ratio (OR) for precocious puberty per IQR increase in the concentration of total PM2.5 mass was 1.27 (95% CI 0.92-1.75) for the whole population, 2.12 (95% CI 1.27-3.55) for girls, and 0.90 (95% CI 0.62-1.30) for boys. Similarly, the effect sizes of the 5 major components were all substantial for girls but minimal for boys. Results of the WQS analysis showed that organic matter could explain the highest proportion of the effect of PM2.5, with the weight of its contribution being 0.71. Modification effects of family income and dietary habits were only observed in certain population subgroups. Conclusions Long-term exposure to total PM2.5 mass was significantly associated with precocious puberty in girls, with organic matter identified as the major effect contributor. The results add evidence on the detrimental effects of PM2.5 on children’s development and growth.

Mucopolysaccharidosis type I (MPS I) is a lysosomal storage disorder caused by deficiency of the enzyme α-L-iduronidase. Laronidase (Aldurazyme®) stands as the sole FDA-approved enzyme replacement therapy (ERT) for MPS I to date. In June 2020, a concentrated solution of laronidase for injection received approval for a Chinese bioproduct license, exempted from clinical trials. Compliance with approval requirements mandates post-marketing surveillance (PMS) for laronidase. The objective of this study was to evaluate the safety and efficacy of laronidase treatment at a dosage of 100 U/kg body weight weekly in Chinese patients with MPS I. From October 2021 to July 2023, 12 MPS I patients at four institutions in China received weekly intravenous injections of laronidase at a dose of 100 U/kg of body weight once a week for 26 weeks. The primary efficacy endpoint was the percentage change in urinary glycosaminoglycans (uGAGs) levels at week 26 relative to baseline. Safety endpoints included the incidence of adverse events (AEs), serious adverse events (SAEs), and adverse events of special interest (AESIs, including infusion-related reactions) during the treatment period (TE). Laronidase consistently reduced uGAGs levels from baseline to week 26, with a percentage change of -64.61 https://clinicaltrials.gov/search?term=NCT05134571

Background Familial partial lipodystrophy type 3 (FPLD3) is a rare genetic disorder caused by mutations in peroxisome activator receptor gamma (PPARG). Patients with familial partial lipodystrophy often have abnormal fat distribution and severe metabolic abnormalities. In this study, we identified a familial genetic defect in PPARG in a Chinese family and functionally validated this gene. Methods Three family members were screened for mutations in PPARG via direct sequencing. Physical examination and laboratory tests were performed on the affected individuals. The functions of the mutant genes were analyzed in transfected cell lines by measuring the transcriptional activity and interference with the wild-type protein and software-based prediction of the mutant protein structure. Results We identified a novel missense mutation in PPARG (i.e., PPARG2 c.634C > T; p.Arg212Trp). Bioinformatics analysis revealed that the mutation of PPARG changed the three-dimensional structure and hydrophilic properties of the protein, and that the mutation was pathogenic. In vitro experiments reveal that the transcriptional activity of the mutant receptor was significantly reduced. Family members affected by the mutation were diagnosed with diabetes and hyperlipidemia. Genetic testing was performed to further confirm the diagnosis and classification of monogenic diabetes mellitus. After the diagnosis, each patient was treated with insulin aspart injection, metformin, and Lipitor, and the symptoms of hyperglycemia and hyperlipidemia improved. Conclusions We report familial partial lipodystrophy syndrome type 3 caused by a novel mutation in PPARG. Our data extend the spectrum of known PPARG mutations responsible for FPLD3 and highlight the importance of identifying FPLD syndrome and the early classification and management of diabetes.

Objectives To analyze and summarize the clinical characteristics and treatment of juvenile patients with type 1 diabetes mellitus (T1DM) complicated by early cataract.Case presentation This retrospective study collected clinical data from 210 children and adolescents newly diagnosed with T1DM who were admitted to the Department of Pediatrics, Tongji Hospital (Wuhan) between 2015 and 2022. Among 210 patients with T1DM, early cataract developed within 3 months before diabetes onset and 12 months thereafter in 2 (0.95 %) patients. The two patients were both females, aged 13 and 9 years, respectively. In both cases, cataracts in both eyes appeared in the early stages of T1DM, showing a short course and rapid development. After intensive insulin treatment for stringent and stable blood glucose control, one patient underwent cataract extraction with significant improvement, and her visual acuity returned to normal. The other patient received intensive insulin therapy and insulin pump therapy for 8 years. Subsequently, she underwent cataract surgery after achieving stable blood glucose levels, without complete recovery of vision.Conclusions Cataract is a rare complication in the early stages of T1DM in children and adolescents. Ophthalmic surgery is the preferred treatment for patients with diabetic cataract after achieving stable glycemic control, which may help prevent visual impairment.

Rationale:Glycogen storage disease type 0a (GSD0a) is a rare autosomal recessive disorder caused by glycogen synthase deficiency. Short stature is a characteristic feature in 29% of GSD0a patients, but isolated short stature as the only presenting symptom is exceedingly rare, with only 2 cases reported worldwide.Patient concerns:A 4-year-old girl presented with persistent growth retardation despite previous treatment for renal tubular acidosis.Diagnoses:Based on clinical presentation and whole exome sequencing results, the patient was diagnosed with GSD0a.Interventions:Uncooked cornstarch therapy was initiated at 2 g/kg every 6 hours.Outcomes:After 3 years of treatment, the patient's height SDS improved from -2.24 to -1.06, with enhanced glycemic control and no complications.Lessons:This case emphasizes considering GSD0a in unexplained short stature and the value of continuous glucose monitoring. Early diagnosis and treatment can optimize growth in GSD0a patients.

Objective: To investigate the clinical characteristics and management status of children with Turner syndrome (TS) in China. Methods: As a cross-sectional study, 1 089 TS patients were included in the database of the National Collaborative Alliance for the Diagnosis and Treatment of Turner Syndrome from August 2019 to November 2023. Clinical characteristics (growth development, sexual development, organ anomalies, etc.), karyotypes, auxiliary examinations, and treatments were collected and analyzed. Results: Among the 1 089 TS cases, 809 were recorded karyotypes. The karyotype distribution was as follows: 45, X in 317 cases (39.2%), X chromosome structural variants (including partial deletions of p or q arm, ring chromosome, and marker chromosome) in 89 cases (11.0%), 45, X/46, XX mosaicism in 158 cases (19.5%), mosaicism with X chromosome structural variants in 209 cases (25.8%), and presence of Y chromosome material in 36 cases (4.4%). Among the 824 TS cases, the age of diagnosis was 9.7(6.4, 12.2) years, with a height standard deviation score (HtSDS) of -3.1±1.2. Five hundred and fifty three cases underwent growth hormone (GH) stimulation test, and 352 cases (63.7%) had GH peak values <10 μg/L and 75.9% (577/760) had low IGF1 levels, with IGF1 SDS ≤-2 accounting for 38.2% (290 cases). Among 471 cases aged ≥8 years, 132 cases (28.0%) showed spontaneous sexual development (mean bone age (11.0±1.7) years), 10 cases had spontaneous menarche (mean bone age (12.0±2.2) years), and 2 cases had regular menstrual cycles. Common physical features included cubitus valgus (311 cases (28.5%)), neck webbing (188 cases (17.2%)), low posterior hairline (185 cases (17.0%)), shield chest (153 cases (14.0%)), high arched palate (127 cases (11.6%)), short fourth metacarpal (43 cases (3.9%)), and spinal abnormalities (38 cases (3.5%)). Congenital cardiovascular and urogenital anomalies occurred in 91 cases (19.4%) and 66 cases (12.0%)respectively. Abdominal ultrasound in 33 cases (7.2%) indicated fatty liver, hepatomegaly, intrahepatic bile duct stones, and splenomegaly. Among 23 cases undergoing oral glucose tolerance test (OGTT) test, 2 were diagnosed with diabetes mellitus and 4 with impaired glucose tolerance. Following diagnosis, 669 cases (80.7%) received rhGH treatment at a chronological age of (9±4) years and bone age of (8.3±3.2) years. Additionally, 112 cases (19.4%) received sex hormone replacement therapy starting at the age of (14±4) years and bone age of (12.6±1.2) years. Conclusions: The karyotypes of 45, X and mosaicism were most common in Chinese children with TS. The clinical manifestations were mainly short stature and gonadal dysplasia. However, a few TS children could be in the normal range of height, and some cases among those aged of ≥8 years old had spontaneous sexual development. Some exhibited physical features, congenital cardiovascular and urogenital anomalies, and dysfunction of the hypothalamic-pituitary-IGF1 axis. Moreover, a few of them developed impaired glucose tolerance and diabetes mellitus. Following diagnosis, most of the patients received rhGH treatment, and a few of them received sex hormone replacement therapy.

Background Carboxylesterase 1(CES1) is expressed mainly in the liver and adipose tissue and is highly hypothesized to play an essential role in metabolism. Our study aimed to investigate the association between CES1 and metabolic syndrome (MetS) and metabolic dysfunction associated steatotic liver disease (MASLD) in children with obesity in China. Methods This study included 72 children with obesity aged 6-13years (including 25(35%) diagnosed as MetS and 36(50%) diagnosed as MASLD). All subjects were measured in anthropometry, serum level of biochemical parameters related to obesity, circumstance levels of insulin-like growth factor1, adipokines (adiponectin, leptin and growth differentiation factor 15) and CES1. Results Higher serum CES1 level were found in the MetS group (P = 0.004) and the MASLD group (P < 0.001) of children with obesity. Serum CES1 levels were positively correlated with alanine aminotransferase, aspartate aminotransferase, triglyceride, cholesterol, low-density lipoprotein cholesterol, GDF15, Leptin and negatively correlated with high-density lipoprotein cholesterol, adiponectin and IGF1. We also found a multivariable logistic regression analysis of MASLD and MetS predicted by CES1 significantly (MASLD P < 0.01, MetS P < 0.05). The combination of CES1, sex, age and BMI Z-score showed a sensitivity and specificity of 92.7% for the identification of MASLD and 78.6% for the identification of MetS. The cutoff for CES1 of MASLD is 56.30 ng/mL and of MetS is 97.79 ng/mL. Conclusions CES1 is associated with an increasing risk of MetS and MASLD and can be established as a biomarker for metabolic syndrome and MASLD of children with obesity.

Background：Growth hormone deficiency (GHD) is the most prevalent form of pituitary hormone insufficiency.Genetic factors are increasingly recognized to play a significant role in the etiology of GHD.Deletions involving the long arm of chromosome 1 are rare, with only approximately 40 reported cases featuring detailed molecular characterization of deletion size and merely four instances involving deletions within region 1q25. and no related treatment has been reported Case presentation：The identical twin boys were evaluated at the pediatric endocrinology clinic of Tongji Hospital due to a prolonged history (over 5 years) of short stature and cognitive delays. Upon diagnosis of GHD, hematuria, and intellectual disability, genome-wide CNV analysis revealed deletions at 1q25.2q25.3 and microduplications at 4q35.2 involving genes such as LHX4 and FAT1. These overlapping genomic alterations spanned 6.557 Mb and 141 Kb in these regions respectively, aligning with their clinical phenotypes.Furthermore, comprehensive exomic screening of 97 glomerular disease-associated genes showed no variations. Following diagnosis, the twins underwent over three years of rhGH therapy which led to significant catch-up growth and increased levels of IGF-1 and IGFBP3 without any adverse endocrine reactions or exacerbation of renal pathology. Conclusions：This investigation delineates a novel syndromic manifestation in twin boys characterized by GHD, thin basement membrane nephropathy (TBMN),and intellectual disability associated with specific genetic alterations at 1q25.2-q25.3 and 4q35.2.The treatment with rhGH over an extended period was efficacious in promoting growth without discernible adverse effects underscoring its safety & effectiveness in this unique context.

OBJECTIVE:To investigate the clinical features and genetic variant of a child with West syndrome due to a variant of NEXMIF gene.METHODS:A child who was admitted to the First Medical Center of Chinese PLA General Hospital in March 2021 was selected as the study subject. Clinical data of the patient was collected. The child and his parents were subjected to whole exome sequencing. Candidate variant was verified by Sanger sequencing and pathogenicity analysis.RESULTS:The child, a 4-month-old boy, had presented with spastic seizures with no obvious cause. Abnormal EEG, severe hypsarrhythmia, and multiple spastic seizures were discovered. Cranial MRI revealed widening of the extracerebral space at the top of the frontal lobe. Physical examination revealed that the child could not hold his head up, and could not respond to sounds or follow objects with his eyes. He also has microcephaly, with height < 1 s. The child was diagnosed with West syndrome at a local hospital, and was given prednisone orally for 3 months, with seizures under control. Topiramate tablets were taken orally for maintenance treatment, and he has been seizure-free for 7 months. DNA sequencing revealed that he has harbored a de novo nonsense variant of c.982_c.983delTT (p.L328Dfs*23) in the NEXMIF gene.CONCLUSION:For children with West syndrome with severe developmental delay or even regression as the first symptoms, uncontrollable seizures and abnormal facial appearance, mutations of the NEXMIF gene should be suspected, and genetic testing can facilitate early diagnosis and treatment.

Automated bone age assessment (BAA) is of growing interest because of its accuracy and time efficiency in daily practice. In this study, we validated the clinical applicability of a commercially available artificial intelligence (AI)-powered X-ray bone age analyzer equipped with a deep learning-based automated BAA system and compared its performance with that of the Tanner–Whitehouse 3 (TW-3) method. Radiographs prospectively collected from 30 centers across various regions in China, including 900 Chinese children and adolescents, were assessed independently by six doctors (three experts and three residents) and an AI analyzer for TW3 radius, ulna, and short bones (RUS) and TW3 carpal bone age. The experts’ mean estimates were accepted as the gold standard. The performance of the AI analyzer was compared with that of each resident. For the estimation of TW3-RUS, the AI analyzer had a mean absolute error (MAE) of 0.48 ± 0.42. The percentage of patients with an absolute error of < 1.0 years was 86.78

Background Recombinant human GH(rhGH)was first approved to treat children with growth hormone deficiency(GHD)by Food and Drug Administration(FDA)in the United States in 1985.The indications subsequently expanded to growth failure secondary to chronic renal failure,Turner syndrome,Prader-Willi syndrome,small for gestational age(SGA)without catch-up growth,idiopathic short stature(ISS),SHOX deficiency,Noonan syndrome and so on[1].The effi-cacy and the safety of rhGH have been proven in randomized controlled trials(RCTs),which are considered the highest level of evidences in clinical practice.However,due to the strict criteria and short observational time,RCTs could not fully reflect the reality of rhGH,especially in terms of safety[2].