Hyperphosphatemic familial tumoral calcinosis (HFTC) is a rare autosomal recessive disorder characterized by hyperphosphatemia and ectopic calcifications. Mutations in GALNT3, which encodes a key enzyme responsible for O-glycosylation of FGF23, represent a major genetic cause of HFTC. This modification is essential for the stability and secretion of FGF23. We investigated a 4-year and 6-month-old Chinese girl with HFTC to characterize the clinical features, identify the causative variants, and explore the underlying pathogenic mechanism. Whole-exome sequencing followed by Sanger validation identified novel compound heterozygous variants in GALNT3 (c.659T>A, p.Ile220Asn and c.1850C>A, p.Ser617*). The patient exhibited hyperphosphatemia with a biochemical profile consistent with FGF23 deficiency, including extremely low intact FGF23 and elevated C-terminal fragments. Functional studies using Western blotting and wheat germ agglutinin affinity chromatography demonstrated that the mutant GALNT3 caused a severe defect in FGF23 O-glycosylation, leading to impaired secretion of intact FGF23. Glycosylated FGF23 was detected only in the medium of cells expressing wild-type GALNT3. These findings indicate that defective O-glycosylation results in failure of FGF23 secretion and functional inactivation. This study expands the mutational spectrum of GALNT3 and provides mechanistic insight into the role of GALNT3 in phosphate homeostasis.

Introduction: ACTH-secreting pituitary microadenomas are associated with insidious onset in children and atypical early clinical manifestations, making them highly susceptible to misdiagnosis and underdiagnosis. They are characterized by elevated ACTH and cortisol levels with a disrupted circadian rhythm. We reported two pediatric cases that showed significant elevation of Dehydroepiandrosterone Sulfate (DHEAS) and Androstenedione (Ad) in the early stage, while ACTH and cortisol were in the normal range or mildly abnormal. Case Presentation: Case 1, a 13-year-old male, was admitted to the hospital with two years of growth retardation. The initial pituitary Magnetic Resonance Imaging (MRI) was normal. After one year, the patient developed Cushing's Syndrome (CS), and a repeat MRI suggested a pituitary microadenoma. Case 2, a 13.1-year-old female who had experienced excessive weight gain for two years and amenorrhea for 11 months. The child presented with CS initially, and the MRI revealed a pituitary microadenoma. Both of them were pathologically confirmed as ACTH-secreting pituitary microadenomas after Transsphenoidal Surgery (TSS). Conclusion: This report demonstrates that in cases with a significant DHEAS elevation, even with near-normal ACTH/cortisol levels and negative pituitary MRI, high clinical suspicion for ACTH- secreting microadenomas should be maintained, warranting close follow-up and further evaluation.

INTRODUCTION:Idiopathic short stature (ISS) is characterized by short stature without identifiable underlying disorders. Long-acting PEGylated recombinant human growth hormone (PEG-rhGH) has emerged as a promising treatment option for ISS children. The objective of this study was to evaluate the long-term efficacy and safety of weekly PEG-rhGH in ISS children. METHODS:This multicenter, open-label, uncontrolled extension study (extension phase) followed the initial 52-week trial (main phase). All subjects received once-weekly PEG-rhGH at 0.2 mg/kg/week with dose adjustment (up to 0.4 mg/kg/week) based on height velocity (HV) and insulin-like growth factor-1 (IGF-1) standard deviation score (SDS). The primary endpoint was change in height SDS (ΔHT SDS) from baseline; secondary endpoints mainly included HV, changes in bone age/chronological age ratio, IGF-1 SDS, and average annual prescribed dose. Safety was evaluated through adverse events and clinical findings. RESULTS:Of 280 children enrolled in extension study, 268 completed 52-week treatment. This analysis included results up to week 104, representing 52-week extension phase following the 52-week main phase. At week 104, the least squares means of ΔHT SDS were 1.52, 1.24, and 1.07 for PEG-rhGH 0.2/0.2 mg/kg/week, 0.1/0.2 mg/kg/week, and 0/0.2 mg/kg/week groups, respectively. The 0.2/0.2 mg/kg/week group maintained significantly greater height improvements. HV was highest in the 0/0.2 mg/kg/week group (9.16 ± 1.33 cm/year), reflecting typical first-year catch-up growth. Mean IGF-1 SDS remained within 2SDS during 2 years. CONCLUSION:Once-weekly PEG-rhGH in children with ISS showed sustained efficacy over 2 years in all assessed height-based outcomes. Treatment remained safe and well tolerated with no new safety signals.

It is unknown whether the glucagon-like peptide-1 (GLP-1) receptor agonists have a significant protective effect against acute islet injury. High mobility group box 1 (HMGB1) is a damage-associated molecular pattern (DAMP) molecule released from stressed or injured pancreatic β-cells, which triggers inflammatory responses through toll-like receptor 4 (TLR4) signaling. This study investigated the protective effect and mechanism of liraglutide on acute islet injury induced by low doses of streptozotocin (STZ). The results showed that liraglutide pretreatment preserved the structural integrity of pancreatic islets, improved insulin levels and glucose tolerance, and significantly reduced the incidence of diabetes in STZ-treated mice. Liraglutide was also found to inhibit STZ-induced release of HMGB1 and reduce the expression of TLR4 and inflammatory factors IFN-γ, IL-1β, and CXCL10. Moreover, administration of exogenous HMGB1 or antagonism of the GLP-1 receptor diminished liraglutide’s protective effects. These findings suggest that liraglutide has a strong protective effect on STZ-induced acute islet injury, most likely through the inhibition of HMGB1 release, which provides an experimental basis for the application of liraglutide as a protective agent for acute islet injury.

Pediatric growth hormone deficiency (GHD) typically requires daily injections of recombinant human growth hormone (rhGH). Long-acting PEGylated recombinant human growth hormone (PEG-rhGH) formulations have been developed to reduce injection frequency and improve adherence and quality of life. However, guidance on switching between short-acting and long-acting regimens during treatment and biomarker-driven precision dose-conversion strategies remains lacking in real-world clinical practice. Therefore, this study analyzed data from two populations comprising healthy adult male subjects (n = 39) and pediatric patients with GHD (n = 408). The analysis used population pharmacokinetic (PopPK) and population pharmacokinetic/pharmacodynamic (PopPK/PD) models. The models showed adequate fit and external predictability. Biomarker-clinical growth endpoint relationship analysis linked changes in insulin-like growth factor-1 standard deviation score (IGF-1 SDS) to growth outcomes, and simulations assessed subgroup responses, missed-dose scenarios, and IGF-1 SDS-guided switching. Simulations enabled subgroup-specific efficacy projections. Missed doses caused a greater loss of benefit with rhGH than with PEG-rhGH. Switching simulations supported IGF-1 SDS-guided conversion within accepted safety limits. The integrated framework provides concise, clinically interpretable rules for individualized titration, adherence-aware care, and safer switching in pediatric GHD. This study supports precision dosing, missed-dose management, and switching between daily rhGH and weekly PEG-rhGH in pediatric GHD.

OBJECTIVES:To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS:A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS:All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS:This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.

To investigate the long‐term efficacy and safety of gonadotropin‐releasing hormone analog (GnRHa) treatment in children with idiopathic central precocious puberty (CPP).

OBJECTIVE:To evaluate the efficacy and safety in adolescent boys with idiopathic short stature (ISS) when treated with third-generation aromatase inhibitors (AIs), the combination of letrozole or anastrozole with recombinant human GH (rhGH), and compare adult height (AHt) augmentation following the treatment with rhGH combined with AIs or GnRH analog (GnRHa) in male adolescents with ISS. METHOD:We collected data from adolescent boys with ISS and a bone age ≥ 13 years who received treatment at Tongji Hospital, Huazhong University of Science and Technology from May 2017 to June 2023. Patients were allocated into the combined letrozole and rhGH group, the combined anastrozole and rhGH group, and the combined GnRHa and rhGH group based on their treatment. Three groups were matched by propensity score matching. There were 32 cases in each group. Follow-up was conducted every 3 months until AHt. Adverse events were monitored throughout. RESULTS:The SD scores of AHt adjusted for target height in the letrozole, anastrozole, and GnRHa groups were 0.60 ± 0.28, 0.81 ± 0.34, and 0.48 ± 0.17, respectively. Compared with the letrozole and GnRHa groups, the anastrazole and rhGH combination group showed the most significant increase in AHt (P < .01). The abnormal monitoring indicators of the AIs group gradually returned to normal following the termination of treatment. CONCLUSION:For adolescent males with ISS and a bone age ≥ 13 years, the combination of AI and rhGH significantly increased the AHt. Finally, our analyses showed that anastrozole exerts more significant effects with regard to augmenting AHt with fewer adverse reactions.

Bartter syndrome type II is an autosomal recessive salt-losing tubulopathy caused by variants in the KCNJ1 gene, with a typical clinical phenotype of hypokalemia. In this study, we identified a 3-year-old child exhibiting hypokalemia and lower limb weakness. Genetic analysis identified a novel compound heterozygous mutation in the KCNJ1 gene (c.640A>G, p.Thr214Ala; c.1017C>A, p.Cys339Ter) in the patient, whereas each of the unaffected parents carried only one of these heterozygous mutations. Structural analysis indicated that the p.Thr214Ala variant impairs the stability of ROMK protein. Our findings expand the phenotypic and genetic spectrum associated with the KCNJ1 gene, which would facilitate genetic counselling and prenatal genetic diagnosis.

Metabolic inflammation is an important link in exacerbating obesity and insulin resistance, and the M1 polarization of macrophages is the key to the generation and maintenance of metabolic inflammation. As an inflammatory regulator, the toll-like receptor 4 (TLR4) / myeloid differentiation factor 88 (MyD88) signaling pathway plays an important role in the M1 polarization of macrophages. We previously proved that TJ-M2010-5 is a novel MyD88 inhibitor. However, the protective effect and underlying mechanisms of the MyD88 inhibitor TJ-M2010-5 against obesity induced by high fat diet (HFD) have not been reported. This study revealed that TJ-M2010-5 significantly improved the body weight, blood glucose and lipid levels of HFD mice. Histologically, TJ-M2010-5 alleviated lipid deposition in liver and adipose tissue. The proportion of M1 macrophages and the protein levels of TLR4, MyD88 and the phosphorylation ratio of nuclear factor-κB (NF-κB) in liver and epididymis adipose tissue of HFD mice were decreased after TJ-M2010-5 intervention. In vitro, TJ-M2010-5 inhibited the activation of TLR4 and MyD88 in bone marrow-derived macrophage (BMDM), significantly reduced the proportion of M1 polarization of BMDM. TJ-M2010-5 can improve obesity and its related glucose and lipid metabolism abnormalities induced by HFD through alleviating M1 polarization of macrophages and metabolic inflammation via inhibiting TLR4/MyD88 pathway.

Objective This study investigated the characteristics of newly diagnosed type 1 diabetes mellitus (T1DM) related to autoimmunity and the frequency of diabetic ketoacidosis (DKA) in children and adolescents from 2017–2022 in China. Research design and methods Single-center regional data from the Department of Pediatric Endocrinology, Tongji Hospital, were used to compare 88 children and adolescents newly diagnosed with T1DM from 2020 to 2022 (i.e. during the COVID-19 pandemic in China) and 76 children and adolescents diagnosed with T1DM from 2017 to 2019. Auto-antibodies, including glutamic acid decarboxylase-65 and insulin auto-antibodies, were detected by enzyme-linked immunoassays. DKA was defined as a pH < 7.3 and/or a bicarbonate level < 15 mmol/L. Results The median age of the 164 children and adolescents newly diagnosed with T1DM from 2017 to 2022 was 7.0 years (interquartile range [IQR]: 3.8–10.0 years; 51.83% male). The mean annual incidence of T1DM was 2.98 per 1,000,000 child years. The estimated frequency of auto-antibody positivity was 51.22% ( n = 84), and there was no difference between the 2020–2022 group and 2017–2019 group (55.68% [ n = 49] vs. 46.5% [ n = 35]; p = 0.219). The frequency of DKA among the entire cohort was 57.93% ( n = 95), and peaked in 2020 at 78.9% (15/19 patients). The frequency of DKA was not significantly higher in the 2020–2022 group compared with the 2017–2019 group (60.23% [ n = 53] vs. 55.26% [ n = 42]; p = 0.521). We found no significant difference in the frequency of DKA between patients who were negative vs. positive for auto-antibodies in the 2020–2022 group (64.10% [ n = 25] vs. 57.14% [ n = 28], p > 0.05). The C-peptide level and HbA1c (%) were positively correlated with onset age (R1 = 0.389, p < 0.01; R2 = 0.371, p < 0.01), and the estimated mean C-peptide level was 0.26 ng/ml (IQR: 0.2–0.4 ng/ml) in patients with DKA and 0.370 ng/ml (IQR: 0.2–0.6 ng/ml) in patients without DKA ( p = 0.044). Conclusions This study showed the annual incidence of T1DM was 2.98 per 1,000,000 child years, gradually increased over the study period, and there was no significant increase in T1DM with auto-antibody positivity in children and adolescents newly diagnosed from 2020–2022 in China compared with the previous 3 years. Furthermore, the frequency of DKA was peaked in 2020, and were not significantly different between patients who were negative vs. positive for auto-antibodies.

Abstract Disclosure: X. Luo: Advisory Board Member; Self; Takeda. L. Hou: Advisory Board Member; Self; Takeda. Y. Li: Advisory Board Member; Self; Takeda. Y. Sun: Advisory Board Member; Self; Takeda. X.K. Jin: Employee; Self; Takeda. Background: Central precocious puberty (CPP) due to early activation of the hypothalamic-pituitary-gonadal axis leads to early puberty. CPP has a negative impact on adult height. Leuprolide acetate (LA), a gonadotropin-releasing hormone agonist (GnRHa) is the standard treatment for CPP. As CPP requires prolonged treatment, a 3-month (3M) depot formulation would increase patient compliance and reduce the injection burden. This interim analysis presents the effect of LA 3M depot on the gonadotropic axis and assesses safety in children with CPP. Methods: In this open-label, multicenter, single-arm, and prospective study, 31 children with CPP were included. Key inclusion criteria were the appearance of secondary sexual characteristics below the age of eight years in girls and nine years in boys with a confirmed diagnosis of CPP. Children treated with prior GnRHa and/or having underlying medical conditions were excluded. Eligible children were treated with LA 11.25 mg subcutaneously every 12 weeks. The primary endpoint of this interim analysis was the proportion of children achieving inhibition of peak LH defined as peak LH ≤ 3.0 IU/L in the GnRH stimulation test at weeks 24. The secondary endpoint was safety analysis in the children receiving at least one dose of LA 3M depot. Results: At baseline, 30 girls and one boy were enrolled. The median (95% CI) chronological age (CA) of the girls was 8.0 (7.0, 9.0) years and the boy was 10 years old. Girls had a median height of 136.95 (131.5, 139.7) cm, weight of 30 (27, 34) kg, and BMI of 16.4 (15.1, 17.9) kg/m2. Baseline bone (BA) age was 11 (10, 11) years, and BA/CA was 1.24 (1.2, 1.3). Boy’s characteristics at baseline differed in CA (10 years), height (144 cm), and BMI (17.4 kg/m2) from girls of this cohort. Due to the data collection time points for the interim analysis, 8 out of the 31 enrolled subjects had a visit at week 24, and 30 subjects reached the week 12 visit time point and had a visit at week 12. The percentage of children achieving inhibition of peak LH (≤ 3.0 IU/L) in the GnRH stimulation test at week 12 was 100 (88.4, 100) %. At week 24, all of them achieved inhibition of LH in the GnRH stimulation test 100 (63, 100) %. Decreases in BA/CA from baseline at weeks 12 and 24 are 93 (77.9, 99.2) % and 50 (15.7, 84.3) % respectively. No progression of the Tanner stage was observed in 96.7 (82.8, 99.9) % and 100 (63, 100) % at weeks 12 and 24. At the data cut-off, 4 (13.33%) patients experienced a total of 5 treatment-emergent adverse events (TEAEs) in the safety population of 30 subjects. No grade ≥3 AE or serious AE was reported. The incidence of injection site reaction was 3.33%. Conclusion: LA at 11.25mg/3M depot effectively suppresses the gonadotropic axis at weeks 12 and 24, normalizing growth and reversibly slowing the early onset of puberty in children with CPP. LA in a 3-month injecting frequency is a safe and convenient treatment option to improve patient compliance. Presentation: 6/3/2024

BACKGROUND:Recently, numerous studies have addressed the long-term effects of treatment with gonadotropin-releasing hormone analog (GnRHa) in patients with central precocious puberty (CPP). However, the effects of GnRHa treatment on body mass index (BMI) in patients with CPP remain controversial. OBJECTIVE:This systematic review and meta-analysis aimed to evaluate the association between GnRHa treatment and BMI in patients with CPP. METHODS:A systematic search of databases, PubMed, EMBASE, and Web of Science published before August 2021 identified relevant studies. The overall effect analysis was performed using STATA version statistical software 15.0. RESULTS:The study included a total of 28 studies. At the end of GnRHa treatment, the BMI-standard deviation score (BMI-SDS) was greater than baseline BMI-SDS (weighted mean difference (WMD) = 0.14, 95% CI: 0.04-0.23; p = 0.004), especially in girls with CPP (WMD = 0.15, 95% CI: 0.05-0.25; p = 0.005) and in patients with normal weight (WMD = 0.34, 95% CI: 0.19-0.48, p &lt; 0.001). After reaching adult height, BMI-SDS returned to baseline, suggesting that the effect of GnRHa treatment on BMI would disappear as the child grew (WMD = -0.03, 95% CI: -0.39 to 0.32; p = 0.815). CONCLUSION:For patients with CPP, while treatment with GnRHa may increase the BMI in the short term after treatment, the BMI is likely to return to normal when the patients reach adult height.

OBJECTIVE:Children born small for gestational age (SGA) are at increased risk of health issues. This study evaluated the efficacy, safety and optimal dose of PEGylated-recombinant human growth hormone (PEG-rhGH) in these children. DESIGN:In this multicentre, randomised, open-label, Phase 2 trial conducted at nine clinical sites in China, patients were randomised 1:1 to receive subcutaneous injections of PEG-rhGH at 0.1 mg/kg/week (low dose) or 0.2 mg/kg/week (high dose) for 52 weeks. PATIENTS:Ninety-six children were born SGA. MEASUREMENTS:The primary endpoint was the change in height standard deviation score (HT-SDS) at Week 52. RESULTS:At Week 52, the change in HT-SDS in the high- and low-dose groups was 0.923 ± 0.352 (p < 0.0001) and 0.511 ± 0.336 (p < 0.0001), respectively (least-squares means difference, 0.410; 95% confidence interval 0.270-0.551; p < 0.0001). Height velocity (9.94 ± 1.55 vs. 8.37 ± 1.50 cm/year) was also significantly higher in the high-dose than in the low-dose group (p < 0.0001). Change in insulin-like growth factor (IGF)-1 SDS was 1.867 ± 1.747 and 1.168 ± 1.193 in the high- and low-dose groups, respectively (p = 0.0189). IGF-1/IGF binding protein-3 and bone maturity were improved in both groups at Week 52. Most treatment-emergent adverse events were mild to moderate; the safety profile was similar in both groups. CONCLUSIONS:PEG-rhGH at either dose for 52 weeks was effective and well tolerated in children born SGA. Patients in the high-dose group achieved greater improvement in HT-SDS than in the low-dose group. TRIAL REGISTRATION:ClinicalTrials. gov identifier: NCT02375620.

Background Carboxylesterase 1(CES1) is expressed mainly in the liver and adipose tissue and is highly hypothesized to play an essential role in metabolism. Our study aimed to investigate the association between CES1 and metabolic syndrome (MetS) and metabolic dysfunction associated steatotic liver disease (MASLD) in children with obesity in China. Methods This study included 72 children with obesity aged 6-13years (including 25(35%) diagnosed as MetS and 36(50%) diagnosed as MASLD). All subjects were measured in anthropometry, serum level of biochemical parameters related to obesity, circumstance levels of insulin-like growth factor1, adipokines (adiponectin, leptin and growth differentiation factor 15) and CES1. Results Higher serum CES1 level were found in the MetS group (P = 0.004) and the MASLD group (P < 0.001) of children with obesity. Serum CES1 levels were positively correlated with alanine aminotransferase, aspartate aminotransferase, triglyceride, cholesterol, low-density lipoprotein cholesterol, GDF15, Leptin and negatively correlated with high-density lipoprotein cholesterol, adiponectin and IGF1. We also found a multivariable logistic regression analysis of MASLD and MetS predicted by CES1 significantly (MASLD P < 0.01, MetS P < 0.05). The combination of CES1, sex, age and BMI Z-score showed a sensitivity and specificity of 92.7% for the identification of MASLD and 78.6% for the identification of MetS. The cutoff for CES1 of MASLD is 56.30 ng/mL and of MetS is 97.79 ng/mL. Conclusions CES1 is associated with an increasing risk of MetS and MASLD and can be established as a biomarker for metabolic syndrome and MASLD of children with obesity.