Potatoes (Solanum tuberosum) are an economically valuable crop that entails significant soil disturbance in production. Disease and other quality characteristics are important components of potato price determination and can be influenced by practices meant to improve soil health. We examine whether several such practices (lengthened potato rotations, conventional fumigation, mustard biofumigation, and manure application) are associated with changes in potato quality. Using trial data from four locations in the midwestern and Pacific northwestern regions of the United States, we perform a series of pairwise comparisons tests, group analyses, and regressions to evaluate disease-related and other quality differences across treatments with varying soil health practices. We find that extending rotation length is associated with quality benefits that could contribute to greater economic returns. We generally do not find evidence that any of the practices contribute to declines in tuber quality.

Potato production typically entails both greater soil disturbance and higher profits than alternative crops in the regions in which they are grown. This article provides an analysis of economically relevant outcomes from soil health practice trials conducted in potato production systems in four locations across the continental United States from 2019 to 2022. We compare revenue and profit estimates over several soil health-related practices: rotation duration, chemical fumigation, mustard biofumigation, and application of organic amendments. We find that longer rotations are positively correlated with revenues and profits. This finding is robust across a range of tests and several regression specifications, although we do observe some variation across locations. While in our data, 3-year rotations consistently produced better economic outcomes than 2-year rotations, over time periods longer than the 4 years in this study, at least some of the gains associated with longer rotations will be offset by the implied decreased frequency of potato years. We did not find consistent evidence of differences in revenue or profits corresponding to chemical fumigation, mustard biofumigation, or the application of organic amendments.

Highlights Three methods were used to measure soil aggregate stability in the calcareous silty loam soils of Idaho’s Magic Valley. No treatment differences were found using traditional wet sieving or SLAKES methods. Cornell Sprinkle Infiltrometer was more sensitive to the treatments compared to the other two methods. Abstract. Idaho’s Magic Valley is a highly productive agricultural region in the United States due to irrigation. The soils in this region are prone to crusting, have low organic matter, and are high in calcium carbonates, making them susceptible to erosion and water runoff. Soils need to be better managed to enhance aggregate stability to enable increased infiltration of irrigation water and decreased soil erosion in nearby waterways. However, to make management recommendations, the identification of appropriate measurements of aggregate stability needs to be identified, and few relevant studies exist. Thus, the overall goal of this project was to identify appropriate methods for the assessment of soil aggregate stability in the study region. The study sites were located in Southern Idaho and set up using common cropping rotations and agricultural management practices for the region using a variety of nutrient sources, tillage types, and cover cropping. Three methods were used to measure soil aggregate stability: wet sieving, simulated rainfall using a Cornell Sprinkle Infiltrometer (sprinkler height: 30, 90, and 150 cm), and the SLAKES mobile application. No differences in soil aggregate stability were found when the wet sieving or SLAKES methods were used at the three study sites, either due to the method or a general lack of differences between treatments. When using the Cornell Sprinkle Infiltrometer, no treatment differences were found at LT-Manure or GRACEnet; however, differences were observed between treatments at the Cover Crop study site at sprinkler heights of 30 and 90 cm. At a sprinkler height of 30 cm, the average mean weight diameter was the highest when winter forage crops (WFC) and solid dairy manure (SDM) were applied (3.73 mm) and the lowest in the control (3.12 mm). At a sprinkler height of 90 cm, the average mean weight diameter was the highest when WFC and SDM were applied (3.54 mm) and the lowest in the WFC Only treatment (2.46 mm). These results not only have implications for which methods are best for assessing progress but also for what management practices can be utilized to decrease soil erosion from irrigated cropland. This study highlighted that under these soils and management practices, simply increasing soil carbon does not increase aggregate stability, especially when root crops are included in the crop rotation with intensive tillage. In arid and semi-arid regions, the Cornell Sprinkle Infiltrometer may be a more sensitive method of measuring soil aggregate stability compared to traditional wet sieving. Keywords: Agricultural management practices, Calcareous soils, Mean weight diameter, Slake test, Soil aggregate stability.

Time to degree completion is an important metric of academic progress and success for doctoral students. It is also a common way for educational stakeholders to compare programs even if the content of the degree programs varies. But what types of behaviors and experiences are associated with faster times to degree? In this study, we examine the relationship between receiving competitive research awards (e.g., grant writing) and time to degree for PhD students. We organize our analyses by student identities, specifically gender and underrepresented racial minority (URM) status, to examine differences in time to degree based on student demographics. Our dataset included students that graduated between academic years 2008 to 2009 through 2018 to 2019. We also interviewed students currently enrolled in these same programs. We find that underrepresented minority women who won competitive research awards graduate faster than all other students who also won awards but also report lower levels of advisor support. Underrepresented minority women and all underrepresented minority students who won research awards tended to graduate faster compared to other groups of students who did not win awards. Students who reported feeling supported by their advisors, most of which reflected hands-on guidance through the writing process, in the interviews were more likely to apply for grants. Combined, these results highlight that writing grants and specific types of advisor support may influence faster times to degree for biosciences PhD students. This study suggests similar introspective analyses at other institutions and databases are needed.

Soil microbiomes play crucial roles in pathogen suppression, nutrient mobilization, and maintenance of plant health. Their complexity and variability across spatial and temporal scales provide challenges for identifying common targets—microbial taxa or assemblages—for management in agricultural systems. To understand how microbiomes in potato production soils vary across growing regions and identify commonly distributed taxa among them, we compiled a continental-scale bacterial and eukaryotic amplicon dataset of over 1,300 communities with corresponding edaphic measurements from nine U.S. field sites. Field site explained most of the variance across bacterial and eukaryotic (predominantly fungal) communities, while pH and organic matter as well as nitrate, phosphate, and potassium concentrations also varied with community structure. Bacterial and eukaryotic potato soil microbiomes showed consistent phylum-level composition across locations at the continental scale, with regional-scale differences evident among genera and amplicon sequence variants (ASVs). Core community analysis identified 606 bacterial and 74 eukaryotic ASVs, which were present, but unequally distributed, across all nine field sites. Many of these core ASVs belonged to common soil genera, such as Bacillus and Mortierella, which may reveal the functional potential involved in maintaining soil health across regionally variable soil systems.

Biological indicators are often used to evaluate the effect of management practices on soil health. However, determining which indicators can detect changes in soil health after implementation of conservation practices and how these indicators relate to plant growth in grass seed production systems remains unclear. The goal of this study was to explore the relationships between management practice history, soil health metrics, plant growth, and soil microbial communities in annual ryegrass grown under greenhouse conditions. Soils were collected from 12 annual ryegrass [Lolium multiflorum (L.) Husnot] fields managed under conventional (till/bale) or conservation (no-till/full straw) management practices, with three silt loams and three silty clay loams collected for each practice. Annual ryegrass was grown for 5 months on each of the 12 soils in a greenhouse. Soils with a history of conservation management improved the majority of the carbon cycling-related metrics for the silt loam soils. Management practices had no effect on seed yield, however, conservation management significantly improved aboveground biomass in silty clay loam soils. Contrasting management practices resulted in distinct microbial communities, making them sensitive indicators of changes in soil conditions. Soil health and plant metrics were positively associated with the microbial communities in soils under conservation management. Total C and organic matter were positively correlated to plant parameters in silt loams, while few indicators were correlated to plant metrics in silty clay loams. These results highlight the complex interplay between microbial communities, soil health, and plant growth and the importance of considering inherent soil properties like texture. The relationship between management practices and soil health and yield outcomes were influenced by soil texture.Biological soil health indicators and yield metrics were positively correlated in silt loam soils.Microbial communities were a sensitive indicator of changes in management practices.Microbial communities in no-till were positively correlated to yield and soil health metrics.

Continuous application of dairy manure to soils can lead to excessive phosphorus (P) accumulation (legacy P), which requires understanding for managing nutrient availability and leaching. This study was conducted in Kimberly, ID, where dairy manure or conventional fertilizer was applied to calcareous soil plots under continuous crop rotations for 8 years (2013-2020), followed by 2 years with no amendment. To understand legacy P behavior in the soils, total P, organic/inorganic P, and plant-available Olsen bicarbonate P and Truog extraction measurements were made from surface and subsurface samples. Additionally, P in soluble and less soluble calcium phosphate (Ca-P) minerals was estimated using selective extractions, and P desorption was measured in a flow-through reactor. Manure amendments resulted in increased total soil P and plant-available P, particularly in the initial 5 years. In the 0- to 30-cm depth, 54%-65% of the soil P added from manure amendments was readily soluble by the Truog P test. Phosphorus released from the 2022 manure-amended soil in the desorption experiments was about five times greater than the fertilizer-amended soil, suggesting high leaching potential. After 8 years of manure amendment, subsurface Olsen-P levels exceeded the 40 mg kg-1 management threshold, suggesting P adsorption potential of the surface had become saturated, allowing for P leaching. In the manure-amended surface soils, calcium phosphate minerals increased compared to the controls. Even after 2 years without manure amendment, soluble Ca-P mineral phases persisted in the soils, which can be a long-term source of P leaching.

Dairy manure applications are a common practice in Idaho potato (Solanum tuberosum L.) production, however the impacts on tuber yield and quality are not well understood. Our objectives were to determine (1) how repeated dairy manure applications impact soil properties and plant nutrient uptake, and (2) how these changes influence plant nutrient interactions, tuber yield, and quality. Stockpiled dairy manure was fall-applied over a 6-year period to two adjacent potato production fields in Kimberly, ID. Eight treatments included application frequency (annual and biennial), manure application rate (18, 36, and 52 Mg ha-1 application-1 [dry weight basis]), fertilizer-only, and a non-amended control. Manure treatments were supplemented with fertilizer to prevent nutrient-limiting conditions. Compared to fertilizer treatments, mean soil organic matter, total N, and K were greater for annual manure by 53%, 47%, and 426%, and biennial manure by 24%, 23%, and 199%, respectively. For annual applications only, mean soil nitrate, P, and electrical conductivity were greater than fertilizer treatments by 247%, 431%, and 222%, respectively. Manure promoted P and K luxury consumption with increasing application rate and frequency. Foliage Ca, Mg, Zn, Mn, and Cu correlated negatively against foliage K, potentially due to cation competition and translocation disruption. Annual applications decreased mean tuber specific gravity from 1.078 to 1.073, which may be attributed to saline-sodic conditions and delayed maturity from late-season N mineralization. Our findings suggest that biennial manure applications may prevent specific gravity issues. Agronomic parameters related to N, K, and soluble salts should be closely monitored in these systems. Soil organic matter, total N, K, B, and sodium adsorption ratio were greater for annual and biennial manure compared to fertilizer. Soil electrical conductivity, NO3, P, SO4, Mg, Na, Cl, Zn, Cu, and Mn were greater for annual manure only compared to fertilizer. Manure increased P and K but lowered Ca, Mg, Zn, Cu, Mn, and Cl foliage concentrations compared to fertilizer. Tuber specific gravity declined with manure rate and frequency, while total tuber yield was unaffected. Soil salt accumulations and delayed maturity may be primary factors for lowered specific gravity.

Approximately 37% of US milk production occurs in semiarid regions, providing an opportunity to recycle manure nutrients through a variety of cropping systems. Accurate prediction of nitrogen (N) mineralization is critical to determine manure application suitability in intensive irrigated agriculture as many crops in the region have quality parameters that are sensitive to N. Research was conducted in southcentral Idaho to evaluate N mineralization via a buried bag methodology to develop a predictive N-mineralization model. The study was arranged in a randomized complete block design with manure application rates of 18, 36, and 52 Mg center dot ha-1 (dry weight basis) both annually and biennially with synthetic fertilizer and untreated check treatments. The crop rotation included small-grain and broadleaf crops. In the final year of the study, preplant soil organic carbon, total nitrogen, and NO3-N concentrations were positively linearly correlated with manure application rate. Nearly five times as much N was mineralized annually in the 0- to 30-cm depth as compared to the 30- to 60-cm depth. Increased rates of N mineralization for each kilogram of added N occurred in years when residue from broadleaf crops (slope = 0.17) was applied as compared to years with manure only application (slope = 0.07). Stepwise modeling determined that the most predictive model for seasonal N mineralization (R2 = 0.79) included manure N, residue N, soil organic matter, and electrical conductivity. These results allow preplant N mineralization estimation and will prove critical for managing manure in semiarid regions for agronomic, economic, and environmentally sound crop production. Tools are needed to estimate nitrogen (N) mineralization from applications of dairy manure in semiarid irrigated soils.N mineralization was affected by manure application rate, timing, and broadleaf residue N.Average manure N mineralization was 27% and 18% of N applied in the first and second years, respectively, following application.The incorporation of broadleaf residue with manure increased N mineralized to 41% of N applied.The best predictors of N mineralization were soil organic matter, soil electrical conductivity, manure N, and broadleaf N residue.

Alfalfa (Medicago sativa L.) is a commonly grown forage crop in Oregon and California harvested on 350,000 and 480,000 acres, respectively, in 2023 (USDA-NASS 2023). Forage alfalfa is grown as a perennial crop for about four years in the same field and each season, the crop is cut 3-4 times for hay production. Consequently, each plant is exposed to a variety of biotic stresses including virus infections, with pathogens accumulating in the crop over years. Alfalfa was recognized in the past as a reservoir of legume viruses posing threats to peas and other legumes in the Pacific Northwest (PNW) of the United States (Hampton and Weber 1983; Kaiser et al. 1993). The most common viruses found in alfalfa in PNW are aphid-transmitted alfalfa mosaic virus (AMV), bean leafroll virus (BLRV), and pea streak virus (PeSV) (Hampton and Weber 1983; Kaiser et al. 1993; Larsen 2015; Dahan et al. 2022; Postnikova et al. 2023). Recently, a new virus, Snake River alfalfa virus (SRAV) was described from alfalfa in Idaho (Dahan et al. 2022), in Washington (Postnikova et al. 2023), and in Europe (Meseguer et al. 2024). Within PNW, surveys of alfalfa viruses in Oregon were not conducted for the past 30 years, and to fill in this knowledge gap on alfalfa viruses in the State of Oregon, a survey was initiated in the summer 2023. One-hundred thirty-nine leaf samples were collected from 13 alfalfa fields across Oregon, from four fields in Southern Idaho, and from four fields in Northern California between July 15 to September 5, 2023. Five to seven individual samples per field, exhibiting various virus-like symptoms, such as mosaic, chlorotic spots, leaf deformations, and yellowing, were collected randomly, placed in paper bags and shipped to the laboratory at the University of Idaho. Total nucleic acids were extracted from leaf tissue within 3-5 days after the field collections using the Dellaporta methodology (Dellaporta et al. 1983). Reverse transcription (RT) PCR was conducted according to the previously described protocol with specific primers for AMV, BLRV, and SRAV described by Dahan et al. (2022). For PeSV detection, two specific primers, PeSV_2F: TCACTGGATCATGGCYTTTG and PeSV_2R: AACCTTGAATCCTGACGCAA were designed and used in RT-PCR. In virus-positive samples, PCR fragments were treated with Exosap-It (Thermo Fisher Scientific, Waltham, MA), submitted for Sanger sequencing to Elim Biopharmaceuticals, Inc. (Hayward, CA), and confirmed to be virus-specific. The partial sequences of the alfalfa viruses found in Oregon, Idaho, and California were deposited in GenBank under the accession numbers PQ451070 to PQ451075 (PeSV), PQ451076 to PQ451087 (BLRV), PQ451088 to PQ451108 (AMV), and PQ467775 to PQ467806 (SRAV). Out of 139 samples tested, 61 were AMV-positive, 51 were BLRV-positive, 81 were SRAV-positive, and 6 were PeSV-positive. In-field prevalence varied between the four viruses, ranging for PeSV from 0% (1 field in CA, 4 fields in ID, and 8 fields in OR) to 43% (1 field in CA); for BLRV from 0% (2 fields in CA, 2 fields in ID, and 3 fields in OR) to 100% (2 fields in CA); for AMV from 0% (2 fields in CA and 4 fields in ID) to 100% (1 field in OR); for SRAV from 0% (2 fields in CA) to 100% (1 field in OR). Multiple samples had mixed infections of 2, 3, and even 4 viruses (1 sample from CA and 1 sample from OR). The role of each of these viruses in observed alfalfa virus-like symptoms and in an overall effect on productivity awaits further investigation. While SRAV was found before in alfalfa fields in Idaho (Dahan et al. 2022) and Washington (Postnikova et al. 2023), this is the first report of the virus presence in alfalfa crops in Oregon and in Northern California.

We determined the characteristics that render organic matter responsive to dilute permanganate oxidation to find a mechanistic explanation for the frequently observed responsiveness of permanganate oxidizable carbon (PoxC) to changes in soil health. We conclude that PoxC is primarily a measurement of phenolic and polyphenolic structures rather than of compounds traditionally viewed as preferred microbial food. Upon subjecting pure compounds to the PoxC method, we found that the susceptibility of organic molecules to permanganate oxidation was determined by the presence of specific structural features abundant in phenolic compounds, which were highly reactive (3-98 mg PoxC & BULL;g(-1) C), and in a subset of low-molecular-weight organic acids (0-180 mg PoxC & BULL;g(-1) C). In comparison, proteins were minimally reactive (0-13 mg PoxC & BULL;g(-1) C) and carbohydrates were unreactive when subjected to the PoxC method. Permanganate reactivity was not found to be a predictor of decomposability in biosolids through the mirroring of C:N ratio. However, permanganate reactivity increased up to 27% throughout the decomposition process. We suggest a reinterpretation of the mechanisms that render PoxC useful as a soil health indicator. Rather than representing a preferred microbial food source, PoxC measures a carbon fraction with unique molecular properties that may be an indicator of plant-mediated soil processes. Our research corroborates the usefulness of PoxC as a soil health indicator, albeit for entirely different reasons than previously assumed. This opens exciting avenues of further inquiry and sets the stage for intensified investigations into the general role of polyphenolic compounds in soil health.

Dairy manure is used in semiarid southern Idaho to improve soil fertility, but campaigns to measure resulting nitrous oxide (N2O) emissions over the complete year have not been conducted to date. The objective of this study was to measure N2O fluxes throughout the growing (April to Sept) and non-growing (Oct to Mar) seasons in 2020 (sugarbeet) and 2021 (silage corn and triticale) in a field that received inorganic N fertilizer or was pre-viously treated with dairy manure solids on an annual and biennial basis for 8 years. Gas fluxes were measured daily using automated chambers that were connected to a gas chromatograph for in situ analysis of N2O. The N2O emissions were found to be highly episodic and major pulses were associated with irrigation during the growing season, warming events in the winter, and soil disturbance at harvest. Emissions were greatest from soil that had received manure at the highest annual application rate of 52 Mg ha-1 (dry wt.), with cumulative totals of 3.6 and 3.0 kg N2O-N ha-1 in 2020 and 2021, respectively. These cumulative totals were about 3-fold greater than emissions from plots treated with inorganic fertilizer or manure at 17 Mg ha-1 annually or 35 Mg ha-1 bien-nially. This outcome can be attributed to high concentrations of nitrate produced through mineralization of organic N in manure. Emission factors indicated that up to 1.2% of the total N applied was lost as N2O-N, with the greatest loss from inorganic fertilizer treated soil. When breaking down the emissions by season, anywhere from 49%-63% (2020) and 37-58% (2021) of the N2O-N emissions occurred during the non-growing season. Growing and non-growing season N2O emissions were found to be statistically equivalent for each of the respective fertilizer or manure treatments. This finding stresses the need to also measure N2O emissions during the non-growing season as a way to improve the accuracy of annual emission estimates.

Soil organic carbon (SOC) is closely tied to soil health. However, additional biological indicators may also provide insight about C dynamics and microbial activity. We used SOC and the other C indicators (potential C mineralization, permanganate oxidizable C, water extractable organic C, and beta-glucosidase enzyme activity) from the North American Project to Evaluate Soil Health Measurements to examine the continental-scale drivers of these indicators, the relationships among indicators, and the effects of soil health practices on indicator values. All indicators had greater values at cooler temperatures, and most were greater with increased precipitation and clay content. The indicators were strongly correlated with each other at the site-level, with the strongest relationship between SOC and permanganate oxidizable C. The indicator values responded positively to decreased tillage, inclusion of cover crops, application of organic nutrients, and retention of crop residue, but not the number of harvested crops in a rotation. The effect of decreased tillage on the C indicators was generally greater at sites with higher precipitation. The magnitude and direction of the response to soil health practices was consistent across indicators within a site but measuring at least two indicators would provide additional confi-dence of the effects of management, especially for tillage. All C indicators responded to management, an essential criterion for evaluating soil health. Balancing the cost, sensitivity, interpretability, and availability at commercial labs, a 24-hr potential C mineralization assay could deliver the most benefit to measure in conjunction with SOC.

Specialists share how to make the experience more enjoyable and foster a sense of belonging. Specialists share how to make the experience more enjoyable and foster a sense of belonging.

Understanding the sulfur (S) value of biosolids produced by various processing methods is important for growers who routinely apply biosolids to crop production fields and rely on the S to support optimal plant growth and crop yields. It can be challenging to determine though since S is typically bound in organic and mineral compounds that are either mineralized or dissolved over a period of several months or longer after coming in contact with the soil. The goal of the research described in this article was to determine how processing method and biosolid properties influence S availability and fertilizer value through lab incubation. Earn 0.5 CEUs in Nutrient Management by reading this article and taking the quiz at https://web.sciencesocieties.org/Learning‐Center/Courses .

Farmers, scientists, and other soil health stakeholders require interpretable indicators of soil hydraulic function. Determining which indicators to use has been difficult because of measurement disconformity, spatial and temporal variability, recently established treatments, and the effect of site characteristics on management practice differences. The North American Project to Evaluate Soil Health Measurements includes 124 sites uniformly sampled across a range of soil health management practices in North America in 2019. We compare and recommend indicators of hydraulic function that best characterize soil health. We assessed the relationship of each indicator to a suite of soil inherent properties and climate variables, the response of each indicator to soil health management practices, the effect that soil inherent properties (clay content, sand content, and pH) and climatic variables (10-yr mean annual precipitation and temperature) had on response to management practices, and the relationship among the responses of the indicators to soil health management practices. Field capacity measured on intact cores (theta(FC_INTACT)) was the best measure of soil hydraulic function, because it responded to management, represents a direct measure of soil hydraulic function, is proximal to stakeholder values, and its response to management was not significantly influenced by inherent and climatic variables. Other suitable indicators are bulk density, soil organic carbon (SOC), and aggregate stability, which are not direct measures of soil hydraulic function but do respond to management and may be practical in situations in which measuring theta(FC_INTACT) is not. This study informs selection of soil health indicators to measure soil hydraulic function.

Across academic fields and disciplines, we’re hearing more and more buzz around the importance of sense of belonging. However, two important elements are missing from these conversations. First, we need to have a grounded understanding of what sense of belonging is, and how it can be cultivated. Secondly, these conversations tend to apply to a typical classroom context but what about the sense of belonging in research and lab spaces? Sense of belonging is generally defined as the experience of positive personal relationships with others in a given environment [1]. It is an important predictor of well-being [2] and retention in science, technology, engineering, and mathematics (STEM) [3]. There are many benefits associated with developing a strong sense of belonging including improvements in academic performance, mental health, self-esteem, sense of purpose, and connectedness [4,5,6,7]. On the other hand, there are many significant consequences of having a low sense of belonging such as increased risk of stress, anxiety, depression, health problems, feelings of loneliness, rejection, and low self-esteem [2,5,8,9]. Creating environments that are conducive to well-being and belonging not only serve the principal investigator (PI) and the trainee, but also has the potential to increase research integrity, increase and retain the diversity among scientific leaders, and transform academia. Research labs, whether wet or dry, academic or field-based, are important learning environments where many graduate students, trainees, technicians, and postdocs spend a significant amount of time. Yet, despite the amount of time spent in the lab, trainees do not always feel that they belong there [10]. This paper addresses this lack of belonging by proposing ten simple rules for creating a sense of belonging in your research group. These rules (S1 Fig) are grounded in evidence-based practices that have increased the retention of systemically and historically excluded groups [11,12,13,14,15], and improved the mental health crisis in graduate and postdoc education, as belonging is strongly tied to mental health and well-being [16,17,18,19,20]. Because an individual’s sense of belonging can change and evolve over time, PIs and senior lab members can use these rules to establish and maintain a culture where individuals feel valued, heard, and appreciated. Sense of belonging impacts workplace performance [21]; therefore, having a strong sense of belonging within your research group positions lab members to not only have a higher quality of life, but also produce higher-quality research and successfully progress in their research careers. This model can then be emulated by emerging scientists who will become leaders and effective mentors themselves, allowing the cycle to repeat. In this article, we draw from research on sense of belonging and educational psychology to inform best practices for fostering a sense of belonging in the lab. This paper is informed by our experiences as former lab members (graduate students/postdocs), current PIs PLOS COMPUTATIONAL BIOLOGY

Currently accepted pedotransfer functions show negligible effect of management-induced changes to soil organic carbon (SOC) on plant available water holding capacity (theta(AWHC)), while some studies show the ability to substantially increase theta(AWHC) through management. The Soil Health Institute's North America Project to Evaluate Soil Health Measurements measured water content at field capacity using intact soil cores across 124 long-term research sites that contained increases in SOC as a result of management treatments such as reduced tillage and cover cropping. Pedotransfer functions were created for volumetric water content at field capacity (theta(FC)) and permanent wilting point (theta(PWP)). New pedotransfer functions had predictions of theta(AWHC) that were similarly accurate compared with Saxton and Rawls when tested on samples from the National Soil Characterization database. Further, the new pedotransfer functions showed substantial effects of soil calcareousness and SOC on theta(AWHC). For an increase in SOC of 10 g kg(-1) (1%) in noncalcareous soils, an average increase in theta(AWHC) of 3.0 mm 100 mm(-1) soil (0.03 m(3) m(-3)) on average across all soil texture classes was found. This SOC related increase in theta(AWHC) is about double previous estimates. Calcareous soils had an increase in theta(AWHC) of 1.2 mm 100 mm(-1) soil associated with a 10 g kg(-1) increase in SOC, across all soil texture classes. New equations can aid in quantifying benefits of soil management practices that increase SOC and can be used to model the effect of changes in management on drought resilience.

Accurate predictions of the short-term reactivity of liming products are needed for situations where rapid soil pH adjustment is desired. Lime efficiency (LE) describes the capacity of a liming material to neutralize soil acidity in comparison with a finely ground CaCO3 standard (LE = 100%). Our objectives were to evaluate LE for calcitic liming materials varying in particle size at 1-12 months after soil incorporation using pH change (LEpH) and CO2 evolution (LECO2) as response indicators, and to evaluate a 15-min citric acid (CA) test as a predictor of LE. We evaluated LE for lime particle size separates from 10 to 200 USA mesh (< 2000 mu m to 75 mu m) and for three commercial liming products (65, 25 and 11 mu m average particle size) in a sandy loam soil. In field microplots, it took 6 months to achieve LE of > 80% with lime particles of <60 mesh (< 250 mu m). LEpH was linearly related to LECO2 at one month following lime incorporation into soil. Both LEpH and LECO2 increased as a function of CA test values, as described by logarithmic equations. Lime particle size, CO2 evolution, and CA test values were all useful indicators of short-term LE.

Potential carbon mineralization (Cmin) is a commonly used indicator of soil health, with greater Cmin values interpreted as healthier soil. While Cmin values are typically greater in agricultural soils managed with minimal physical disturbance, the mechanisms driving the increases remain poorly understood. This study assessed bacterial and archaeal community structure and potential microbial drivers of Cmin in soils maintained under various degrees of physical disturbance. Potential carbon mineralization, 16S rRNA sequences, and soil characterization data were collected as part of the North American Project to Evaluate Soil Health Measurements (NAPESHM). Results showed that type of cropping system, intensity of physical disturbance, and soil pH influenced microbial sensitivity to physical disturbance. Furthermore, 28% of amplicon sequence variants (ASVs), which were important in modeling Cmin, were enriched under soils managed with minimal physical disturbance. Sequences identified as enriched under minimal disturbance and important for modeling Cmin, were linked to organisms which could produce extracellular polymeric substances and contained metabolic strategies suited for tolerating environmental stressors. Understanding how physical disturbance shapes microbial communities across climates and inherent soil properties and drives changes in Cmin provides the context necessary to evaluate management impacts on standardized measures of soil microbial activity.