Potato virus Y (PVY), potato mop-top virus (PMTV), potato virus S (PVS), and tobacco rattle virus (TRV) can be difficult to identify based on visual foliar symptoms. Using tuber samples collected from seven locations and 12 cultivars during 2017 to 2019, we developed a molecular assay using customized Whatman Flinders Technology Associates Plantsaver cards (FTA cards) and a reverse-transcription PCR (RT-PCR) for efficient sample collection and nucleic acid extraction. PMTV and PVY were detected more frequently on the stem end, TRV on the rose end, and PVS was evenly detected across the stem-end to rose-end axis of the tubers. Differences were seen in virus species localization within a tuber, thereby a composite of samples taken from multiple locations on a tuber improved virus detection. Regardless of sampling location on the tuber, tissue excised from the surface to 0.5 cm deep provided the best detection for all four viruses. For PVY, PMTV, and TRV, the proportion of tubers with viruses detected from field samples was highest at 100, 150, and 175 days after harvest, respectively. However, the probability of detecting PMTV and PVY 25 days after harvest was not different than the probability of detection at their peak detection times after harvest. The probability of TRV detection was lower at 25 days after harvest than at 175 days after harvest (P < 0.05).

Bactericera maculipennis (Crawford) and Bactericera cockerelli (Šulc) (Hemiptera: Triozidae) share hosts within the Solanaceae and Convolvulaceae (Solanales), and both are associated with "Candidatus Liberibacter solanacearum" (Lso). Lso, transmitted by B. cockerelli, causes diseases in solanaceous crops including zebra chip disease of potato. Up to 50% of B. maculipennis adults also harbor Lso, but transmission of Lso to plants by this psyllid has not been confirmed yet. The only documented field host of B. maculipennis in the Pacific Northwest is Convolvulus arvensis L. (Convolvulaceae) but diagnostic methods fail to detect Lso in leaves of this plant. It is therefore unclear how Lso persists within B. maculipennis populations. We surveyed species of Convolvulaceae and Solanaceae for B. maculipennis and report a widespread association between B. maculipennis and Lso throughout the western United States. Diagnostic polymerase chain reaction failed to detect Lso from leaves of C. arvensis yet readily detected Lso from stems where B. maculipennis nymphs tend to feed. Bactericera maculipennis transmitted Lso to species of Convolvulaceae in greenhouse experiments, confirming vector competency. We report high rates of Lso infection in populations of both B. maculipennis and B. cockerelli occurring on C. arvensis, but occurrence of B. cockerelli on C. arvensis was limited to autumn months only and with very low populations. Results suggest C. arvensis is a non-crop reservoir of Lso but do not suggest that B. maculipennis is a direct threat to solanaceous crops or that C. arvensis is a major source of Lso-infected B. cockerelli colonizing potato fields.

A novel barna-like virus was found to be associated with field-collected Afrina sporoboliae plant-parasitic nematodes. The positive-sense, single-stranded RNA genome of this virus, named Afrina barna-like virus (AfBLV), comprises 4020 nucleotides encoding four open reading frames (ORFs). ORF 1 encodes a protein product spanning a transmembrane, a peptidase, and VPg domains, whereas an overlapping ORF 2 encodes an RNA-dependent RNA polymerase (RdRP). ORF2 may be expressed via a −1 translational frameshift. In phylogenetic reconstructions, the RdRP of AfBLV was placed inside a separate clade of barna and barna-like viruses related to but distinct from the genera in the Solemoviridae and Alvernaviridae families, within the overall lineage of Sobelivirales. ORF 3 of AfBLV encodes a protein product of 206 amino acids (aa) long with homology to a putative protein encoded by a similarly positioned gene of an uncharacterized virus sequence identified previously as Barnaviridae sp. ORF 4 encodes a 161 aa protein with no significant similarities to sequences in the GenBank databases. AfBLV is the first barnavirus found in a nematode. Sequence comparisons of the AfBLV genome and genomes of other barna-like viruses suggested that a recombination event was involved in the evolution of AfBLV. Analyses of the phylogeny of RdRPs and genome organizations of barna-like and solemo-like viruses support the re-classification of Barnavirus and Dinornavirus genera as members of the Solemoviridae family.

A new negative-strand RNA virus was identified in grapevines from a 38-year-old ‘Chardonnay’ block in Idaho through high-throughput sequencing (HTS) of total RNA. This virus was tentatively named grapevine-associated cogu-like Idaho virus (GaCLIdV). GaCLIdV has three negative-sense, single-stranded RNA genome segments of ca. 7 kb, 1.9 kb, and 1.3 kb, encoding L protein (RNA-dependent RNA polymerase, RdRP), a movement protein (MP), and a nucleocapsid protein (NC), respectively, identified based on pair-wise comparisons with other cogu- and cogu-like viruses. In phylogenetic analysis based on the RdRP, GaCLIdV grouped within the family Phenuiviridae and was placed in a lineage of plant-infecting phenuiviruses as a sister clade of the genus Laulavirus, clustering most closely with switchgrass phenui-like virus 1 (SgPLV-1) and more distantly related to grapevine-associated cogu-like viruses from the Laulavirus and Coguvirus clades. Both GaCLIdV and SgPhLV-1 are proposed to form a new genus, Switvirus, within the family Phenuiviridae. The presence of GaCLIdV in the original ‘Chardonnay’ samples was confirmed by RT-PCR amplification and Sanger sequencing. This new virus was found in five wine grape cultivars and in six vineyards sampled in Idaho and in Oregon during the 2020–2024 seasons. GaCLIdV may have contributed to the decline observed in the old ‘Chardonnay’ block, although the role of the virus in symptom development awaits further investigation.

To reduce reliance on time consuming postharvest seed potato grow outs, a Whatman Flinders Technology Associates Plantsaver Cards (FTA)-based pathogen detection protocol based on dormant tubers was developed for four potato viruses. Viruses tested included potato virus Y (PVY), potato virus S (PVS), potato mop-top virus (PMTV), and tobacco rattle virus (TRV). Viruses were also detected from potato tubers, sprouts, and leaves using different experimental test methods and sample collection timings (harvest-FTA, storage-FTA, sprouting-FTA, sprout-enzyme-linked immunosorbent assay [ELISA], sprout-recombinase polymerase amplification [RPA], leaf-RPA, and leaf-ELISA). When compared with the leaf-ELISA, accuracy of the harvest-FTA was 92.9% (PVY) and 93.8% (PVS), and test results were available 90-days earlier than leaf-ELISA. Results from the leaf-ELISA for PMTV and leaf-FTA for TRV grossly underreport detection of these two viruses compared with results obtained using multiple tuber and sprout test methods (harvest-FTA, storage-FTA, sprouting-FTA, sprout-ELISA, and sprout-RPA). In 2020, an on-farm collaboration resulted in field implementation of the FTA card-based tuber test for detecting PVY, PMTV, and TRV from eight seed lots. Accuracy, sensitivity, and specificity for detecting PVY from these eight seed lots using the farm-FTA test method were 89, 92, and 87%, respectively, and the results were provided approximately 3 months earlier than the official results from the state seed potato certification programs. Cost analysis of the FTA card-based detection protocols showed that this approach reduced testing costs for multiple pathogens and allowed growers to use a single sampling pipeline to measure and manage multiple pathogen risks at lower costs.

Three potato cultivars, Payette Russet, Dark Red Norland, and Chieftain were challenged with four strains of potato virus Y (PVY), PVY O , PVY Eu−N , PVY N−Wi , and PVY NTN . Cultivars Dark Red Norland and Chieftain exhibited strain-specific, hypersensitive resistance to PVY O and PVY NTN strains.. These same two cultivars, Dark Red Norland and Chieftain, appeared to have an additional resistance source in their genomes providing partial resistance against PVY N−Wi but were found fully susceptible to the non-recombinant PVY Eu−N strain. Payette Russet was found immune to the same four strains of PVY; PVY O , PVY Eu−N , PVY N−Wi , and PVY NTN , and was additionally challenged with the total of 18 isolates of PVY representing 12 genetic variants of the virus from potato and non-potato solanaceous hosts. None of the 18 isolates of the virus was found able to replicate in the inoculated or upper non-inoculated leaves of Payette Russet, confirming the broad specificity of the Ry sto gene present in the Payette Russet genome.

Grapevine yellow speckle viroid 2 (GYSVd-2; Pospiviroidae, Apscaviroid) causes yellow speckle disease in grapevine (Koltunow et al. 1989) and was found in Australia, Iran, Italy, China, and Nigeria (Koltunow et al. 1989; Habili 2017; Zongoma et al. 2018). In the U.S., GYSVd-2 was found in the State of Washington (Vitis vinifera L. cv. Merlot; Alabi et al., 2012). Australian grapevine viroid (AGVd; Pospiviroidae, Apscaviroid) was reported in Australia, Italy, China, Tunisia, Iran, and in the U.S. wine grapes (V. vinifera) (Habili 2017). In the U.S., AGVd was reported from California (Al Rwahnih et al. 2009), from Washington State (V. vinifera cv. Syrah; GU327604), and from the State of New York (an unknown cv. of V. vinifera; KY081960). In Idaho, two other viroids, hop stunt viroid (HSVd; Pospiviroidae, Hostuviroid) and grapevine yellow speckle viroid 1 (GYSVd-1; Pospiviroidae, Apscaviroid), common in grapevines were previously found in wine grapes (Thompson et al. 2019) but neither GYSVd-2 nor AGVd were identified in the same high-throughput sequencing (HTS) outputs. In September 2020, 16 leaf and petiole samples were collected from six vineyards in Canyon and Nez Perce counties of Idaho, representing six different wine grape cultivars and an unknown table grape cultivar, and subjected to HTS analysis. One of the samples was from a table grape plant at the edge of a declining 'Chardonnay' wine grape block that was grown next to a wine tasting room deck for aesthetic, ornamental purposes; the table grape and 'Chardonnay' plants were own-rooted and planted in 1981. Ribodepleted total RNAs prepared from these samples, as described previously, were subjected to a HTS analysis on a NovaSeq platform (Dahan et al. 2023), producing 15,095,042 to 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the V. vinifera, reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Fifteen samples were found infected with HSVd and with GYSVd-1, while one was infected with GYSVd-2 and AGVd; in particular, the table grape plant (arbitrarily designated RBTG) was found infected with all four viroid species. The HTS-derived, 490-nt GYSVd-2-specific contig from the table grape sample represented ∼1.35 genome of the Idaho isolate of GYSVd-2 (GYSVd-2-RBTG) and was 100% identical to the GYSVd-2 sequence JQ686716 from Iran. The HTS-derived, 488-nt AGVd-specific contig represented ∼1.32 genome of the Idaho isolate of AGVd (AGVd-RBTG) and was 100% identical to the AGVd sequence KF876037 from Iran. To validate the HTS data and confirm the presence of the four viroids in the original 16 samples, all of them were subjected to RT-PCR using the viroid-specific primers described by Gambino et al. (2014); all 16 samples were found positive for HSVd and GYSVd-1, and one found positive for AGVd. The RBTG sample was confirmed to be infected with HSVd, GYSVd-1, and AGVd by RT-PCR. GYSVd-2 sequence was not amplified, although primers designed by Gambino et al. (2014) matched the HTS-derived GYSVd-2-RBTG sequence; this may be related to a lower concentration of this viroid in the sample and to properties of the primers. The sampled table grape plant was asymptomatic; all four viroids were apparently not associated with any visible abnormalities in this table grape plant, consistent with the findings that viroids found in grapevines typically do not seem to be associated with visible diseases (Habili 2017).

The ability to initiate sprouting soon after harvest to enable direct tuber testing for potato virus Y (PVY) could aid in acquiring more rapid results compared to the traditional winter grow out tests currently used. Methods to break dormancy for PVY detection using laboratory direct tuber testing by ELISA in commercially produced Ranger Russet, Clearwater Russet, and Umatilla Russet seed lots were tested over two years and compared to leaf testing results obtained from the winter grow out and spring grow out. At harvest, three 400 tuber samples from each cultivar were obtained for the trial and included (1) untreated control (UTC), (2) application of cold aerosol smoke, or (3) application of Rindite. Tuber samples were held at 18.3 C and sprout development was monitored weekly. Treatments were direct tuber tested for PVY when one treatment of that cultivar achieved three sprouts elongating to six millimeters. A fourth 400 tuber sample was collected, treated with Rindite, and included in the Idaho winter grow out plots in Waialua, Hawaii and leaves were sampled and evaluated for PVY using ELISA. Laboratory tested seed was stored and planted in a spring grow out (Kimberly, Idaho) and leaf samples were analyzed for PVY by ELISA. Rindite treated tubers had greater sprout rating and number of sprouts elongating compared to UTC tubers and tubers receiving the smoke treatment at time of PVY testing. Smoke had a greater sprout rating but did not always significantly differ in the number of sprouts elongating compared to the untreated tubers. Overall, estimates of PVY prevalence from direct tuber testing showed limited significant differences to those obtained in the winter grow out for each cultivar, year, and PVY incidence. However, in year two, the incidence of PVY in the winter grow out (7% PVY) significantly differed from direct tuber testing (16% PVY) in Ranger Russet. In both years, the spring grow out PVY results for all cultivars were not significantly different than the direct tuber testing, except in year one the Ranger Russet direct tuber tested UTC showed 10% lower PVY detection compared to the spring grow out. This study identified a novel dormancy breaking treatment to promote earlier and accurate PVY detection by direct tuber testing using ELISA and provided data to support direct tuber testing for post-harvest evaluation of PVY in seed certification.

Bean common mosaic virus (BCMV) is causing economically important diseases in leguminous crops worldwide. In this study, BCMV isolates from country bean (CB; Lablab purpureus), yard-long bean (YLB; Vigna unguiculata), and rajma bean (RB; Phaseolus vulgaris) collected from Bangladesh, Nepal, and Cambodia were characterized. Samples that tested positive for BCMV in serological assays were subjected to high-throughput sequencing to generate near-full-length genome sequences. In pairwise comparisons of the polyprotein open reading frame, 13 BCMV isolates from Bangladesh, Cambodia, and Nepal showed sequence identity of 92.1 to 98.8% at the nucleotide and 94.2 to 99% at the amino acid level among themselves and with corresponding sequences of BCMV reported previously. In phylogenetic analyses using the global BCMV sequences, they segregated into five distinct lineages, with RB isolates from Nepal clustering with US1/NL1-clade of common bean isolates from different countries, YLB isolates aligning with blackeye cowpea strain sequences reported from China, and CB isolates from Nepal and Bangladesh clustering with soybean isolates from China. One YLB isolate from Nepal was identified as a putative recombinant. None of the BCMV sequences aligned with isolates representing the RU1 or PStV clades. In grow-out tests, seed samples from local markets showed a 14.3 to 38.1% transmission efficiency rate of BCMV with CB seed lots and 9.5 to 33.3% with YLB seed lots.

A novel totivirus, named "birch toti-like virus" (BTLV), was discovered in European white birch (Betula pendula) plants. The genome of BTLV is 4,967 nucleotides long and contains two overlapping open reading frames (ORFs) coding for the capsid protein (CP) and an RNA-dependent RNA-polymerase (RdRP). The encoded CP and RdRP proteins shared 46.9% and 60.2% amino acid sequence identity, respectively, with those of Panax notoginseng virus B. The presence of a putative slippery heptamer signal 82 nt upstream of the stop codon of ORF1 suggests that a -1 translational frameshifting strategy is involved in the expression of ORF2, like in other totiviruses. Phylogenetic analysis based on the CP and RdRP amino acid sequences placed this virus within a clade of plant-associated totiviruses, with taro-associated virus as its closest relative. Hence, based on its distinct host and the amino acid sequence similarity between BTLV and its relatives, we conclude that birch toti-like virus is a new member of the genus Totivirus.

Country bean (Lablab purpureus, family Fabaceae) is grown in subsistence agriculture in Bangladesh as a multipurpose crop for food, animal feed, and green manure. This study was undertaken to investigate the genetic diversity of bean common mosaic necrosis virus (BCMNV, genus Potyvirus, family Potyviridae) in country beans. Leaf samples from country beans showing yellowing, vein banding, and mosaic symptoms were collected during field surveys between 2015 and 2019 cropping seasons from farmers' fields in different geographic regions. These samples were tested by serological and molecular diagnostic assays for the presence of BCMNV. Virus-positive samples were subjected to high-throughput Illumina sequencing to generate near-complete genomes of BCMNV isolates. In pairwise comparisons, the polyprotein sequences of BCMNV isolates from Bangladesh showed greater than 98% identities among themselves and shared less than 84% sequence identity at the nucleotide level with virus isolates reported from other countries. In the phylogenetic analysis, BCMNV isolates from Bangladeshi country beans formed a separate clade from virus isolates reported from common beans in other countries in the Americas, Africa, Europe, and from East Timor. Grow-out studies showed seed-to-seedling transmission of BCMNV, implying a possible seedborne nature of the virus in country beans.

Alfalfa (Medicago sativa L.) is a commonly grown forage crop in Oregon and California harvested on 350,000 and 480,000 acres, respectively, in 2023 (USDA-NASS 2023). Forage alfalfa is grown as a perennial crop for about four years in the same field and each season, the crop is cut 3-4 times for hay production. Consequently, each plant is exposed to a variety of biotic stresses including virus infections, with pathogens accumulating in the crop over years. Alfalfa was recognized in the past as a reservoir of legume viruses posing threats to peas and other legumes in the Pacific Northwest (PNW) of the United States (Hampton and Weber 1983; Kaiser et al. 1993). The most common viruses found in alfalfa in PNW are aphid-transmitted alfalfa mosaic virus (AMV), bean leafroll virus (BLRV), and pea streak virus (PeSV) (Hampton and Weber 1983; Kaiser et al. 1993; Larsen 2015; Dahan et al. 2022; Postnikova et al. 2023). Recently, a new virus, Snake River alfalfa virus (SRAV) was described from alfalfa in Idaho (Dahan et al. 2022), in Washington (Postnikova et al. 2023), and in Europe (Meseguer et al. 2024). Within PNW, surveys of alfalfa viruses in Oregon were not conducted for the past 30 years, and to fill in this knowledge gap on alfalfa viruses in the State of Oregon, a survey was initiated in the summer 2023. One-hundred thirty-nine leaf samples were collected from 13 alfalfa fields across Oregon, from four fields in Southern Idaho, and from four fields in Northern California between July 15 to September 5, 2023. Five to seven individual samples per field, exhibiting various virus-like symptoms, such as mosaic, chlorotic spots, leaf deformations, and yellowing, were collected randomly, placed in paper bags and shipped to the laboratory at the University of Idaho. Total nucleic acids were extracted from leaf tissue within 3-5 days after the field collections using the Dellaporta methodology (Dellaporta et al. 1983). Reverse transcription (RT) PCR was conducted according to the previously described protocol with specific primers for AMV, BLRV, and SRAV described by Dahan et al. (2022). For PeSV detection, two specific primers, PeSV_2F: TCACTGGATCATGGCYTTTG and PeSV_2R: AACCTTGAATCCTGACGCAA were designed and used in RT-PCR. In virus-positive samples, PCR fragments were treated with Exosap-It (Thermo Fisher Scientific, Waltham, MA), submitted for Sanger sequencing to Elim Biopharmaceuticals, Inc. (Hayward, CA), and confirmed to be virus-specific. The partial sequences of the alfalfa viruses found in Oregon, Idaho, and California were deposited in GenBank under the accession numbers PQ451070 to PQ451075 (PeSV), PQ451076 to PQ451087 (BLRV), PQ451088 to PQ451108 (AMV), and PQ467775 to PQ467806 (SRAV). Out of 139 samples tested, 61 were AMV-positive, 51 were BLRV-positive, 81 were SRAV-positive, and 6 were PeSV-positive. In-field prevalence varied between the four viruses, ranging for PeSV from 0% (1 field in CA, 4 fields in ID, and 8 fields in OR) to 43% (1 field in CA); for BLRV from 0% (2 fields in CA, 2 fields in ID, and 3 fields in OR) to 100% (2 fields in CA); for AMV from 0% (2 fields in CA and 4 fields in ID) to 100% (1 field in OR); for SRAV from 0% (2 fields in CA) to 100% (1 field in OR). Multiple samples had mixed infections of 2, 3, and even 4 viruses (1 sample from CA and 1 sample from OR). The role of each of these viruses in observed alfalfa virus-like symptoms and in an overall effect on productivity awaits further investigation. While SRAV was found before in alfalfa fields in Idaho (Dahan et al. 2022) and Washington (Postnikova et al. 2023), this is the first report of the virus presence in alfalfa crops in Oregon and in Northern California.

We report the genome sequences of two genetic variants of grapevine rupestris stem pitting-associated virus (GRSPaV) from Idaho, USA. The coding-complete, positive-strand RNA genome of 8,700 nucleotides contains six open reading frames characteristic of foveaviruses. The two Idaho genetic variants belong to GRSPaV phylogroup 1.

Five virus genomes, ranging between 12.0 and 12.3 kb in length and identified as endornaviruses, were discovered through a high-throughput sequencing (HTS) analysis of the total RNA samples extracted from two wine grape cultivars collected in the State of Idaho. One was found in a declining Chardonnay vine and was determined to be a local isolate of grapevine endophyte endornavirus (GEEV), and four others represented two novel endornaviruses named grapevine endornavirus 1 (GEV1) and grapevine endornavirus 2 (GEV2). All three virus genomes span a large, single open reading frame encoding polyproteins with easily identifiable helicase (HEL) and RNA-dependent RNA polymerase (RdRP) domains, while the GEV2 polyprotein also contains a glycosyltransferase domain. The GEV1 genome found in an asymptomatic Cabernet franc vine was related to, but distinct from, GEEV: the 5′-proximal, 4.7 kb segment of the GEV1 genome had a 72% identical nucleotide sequence to that of GEEV, while the rest of the genome displayed no significant similarity to the GEEV nucleotide sequence. Nevertheless, the amino acid sequence of the RdRP domain of GEV1 exhibited the closest affinity to the RdRP of GEEV. GEV2 was found in declining Chardonnay and asymptomatic Cabernet franc vines as three genetic variants exhibiting a 91.9–99.8% nucleotide sequence identity among each other; its RdRP had the closest affinity to the Shahe endorna-like virus 1 found in termites. In phylogenetic analyses, the RdRP and HEL domains of the GEV1 and GEV2 polyproteins were placed in two separate clades inside the large lineage of alphaendornaviruses, showing an affinity to GEEV and Phaseolus vulgaris endornavirus 1, respectively.

This is the first report of how grapevine leafroll-associated virus 3 (GLRaV-3) infected vines impact Idaho grown ‘Cabernet Sauvignon’ grape quality. A single block of plants selected based on molecular testing, with pairs of healthy and GLRaV-3 infected vines, was examined for grape quality for three consecutive growing seasons. Grapes from GLRaV-3 infected vines had significantly higher concentrations of total organic acids (both tartaric acid and malic acid were elevated), and were significantly lower in total anthocyanins (10 mg/100 g difference), total phenolics (40 mg/100 g difference), total tannins (63 mg/100 g difference), and total free amino acids (43 mg/kg difference; nine free amino acids) compared to healthy vines. Cluster weights and concentrations of total sugars (glucose and fructose), and yeast assimilable nitrogen content, were not different between healthy and infected vines. Based on these findings, some quality elements of Idaho ‘Cabernet Sauvignon’ grapes important in wine production were negatively impacted by GLRaV-3 infection.

Globodera pallida, a potato cyst nematode (PCN), is a quarantine endoparasitic pest of potato (Solanum tuberosum) in the US due to its effects on yield and quality of potato tubers. A new rhabdovirus, named potato cyst nematode rhabdovirus (PcRV), was revealed and characterized in the G. pallida populations collected in Idaho through use of high-throughput sequencing (HTS) and RT-PCR and found to be most closely related to soybean cyst nematode rhabdovirus (ScRV). PcRV has a 13,604 bp long, single-stranded RNA genome encoding five open reading frames, including four rhabdovirus-specific genes, N, P, G, and L, and one unknown gene. PcRV was found present in eggs, invasive second-stage juveniles, and parasitic females of G. pallida, implying a vertical transmission mode. RT-PCR and partial sequencing of PcRV in laboratory-reared G. pallida populations maintained over five years suggested that the virus is highly persistent and genetically stable. Two other Globodera spp. reproducing on potato and reported in the US, G. rostochiensis and G. ellingtonae, tested negative for PcRV presence. To the best of our knowledge, PcRV is the first virus experimentally found infecting G. pallida. Based on their similar genome organizations, the phylogeny of their RNA-dependent RNA polymerase domains (L gene), and relatively high identity levels in their protein products, PcRV and ScRV are proposed to form a new genus, provisionally named "Gammanemrhavirus", within the family Rhabdoviridae.

Litchi tomato (LT) (Solanum sisymbriifolium) is a solanaceous weed that is considered a biological control tool to manage potato cyst nematode (PCN) in Europe and is being explored for use in Idaho. Two Several LT lines were clonally maintained as stocks in the university greenhouse since 2013 and were also established in tissue culture at the same time. In 2018, tomato (Solanum lycopersicum cv. Alisa Craig) scions were grafted onto two LT rootstocks originating either from healthy-looking greenhouse stocks or from tissue culture-maintained plants. Unexpectedly, tomatoes grafted onto the greenhouse-maintained rootstocks of LT displayed severe symptoms of stunting, foliar deformation, and chlorosis, while grafts onto the same LT lines from tissue culture produced healthy-looking tomato plants. Tests for the presence of several viruses known to infect solanaceous plants were conducted on symptomatic tomato scion tissues using ImmunoStrips (Agdia, Elkhard, IN) and RT-PCR (Elwan et al. 2017) but yielded negative results. High throughput sequencing (HTS) was then used to identify possible pathogens that could have been responsible for the symptoms observed in tomato scions. Samples from two symptomatic tomato scions, two asymptomatic scions grafted onto the tissue culture-derived plants, and two greenhouse-maintained rootstocks were subjected to HTS. Total RNA from the four tomato and two LT samples was depleted of ribosomal RNA and subjected to HTS on an Illumina MiSeq platform producing 300-bp paired-end reads and raw reads were adapter and quality cleaned. For the tomato samples, the clean reads were mapped against the S. lycopersicum L. reference genome, and unmapped paired reads were assembled producing between 4,368 and 8,645 contigs. For the LT samples, all clean reads were directly assembled, producing 13,982 and 18,595 contigs. In the symptomatic tomato scions and the two LT rootstock samples, a 487-nt contig was found, comprising an ~1.35 tomato chlorotic dwarf viroid (TCDVd) genome and exhibiting 99.7% identity with it (GenBank accession AF162131; Singh et al. 1999). No other virus-related or viroid contigs were identified. RT-PCR analysis using a pospiviroid primer set Pospi1-FW/RE (Verhoeven et al. 2004), and a TCDVd-specific primer set TCDVd-Fw/TCDVd-Rev (Olmedo-Velarde et al. 2019) produced 198-nt and 218-nt bands, respectively, thus confirming the presence of TCDVd in tomato and LT samples. These PCR products were Sanger sequenced and confirmed to be TCDVd-specific; the complete sequence of the Idaho isolate of TCDVd was deposited in GenBank under the accession number OQ679776. Presence of TCDVd in LT plant tissue was confirmed by the APHIS PPQ Laboratory in Laurel, MD. Asymptomatic tomatoes and LT plants from tissue culture were found negative for TCDVd. Previously, TCDVd was reported to affect greenhouse tomatoes in Arizona and Hawaii (Ling et al. et al. 2009; Olmedo-Velarde et al. 2019), however, this is the first report of TCDVd infecting litchi tomato (S. sisymbriifolium). Five additional greenhouse-maintained LT lines were found TCDVd-positive using RT-PCR and Sanger sequencing. Given the very mild or asymptomatic infection of TCDVd in this host, molecular diagnostic methods should be used to screen LT lines for the presence of this viroid to avoid inadvertent spread of TCDVd. Another viroid, potato spindle tuber viroid, was reported to be transmitted through LT seed (Fowkes et al. 2021), and transmission of TCDVd through LT seed may also be responsible for this TCDVd outbreak in the university greenhouse, although no direct evidence was collected. To the best of our knowledge, this is the first report of TCDVd infection in S. sisymbriifolium and also the first report of the TCDVd occurrence in Idaho.

Potato (Solanum tuberosum) is the third most important crop worldwide in terms of consumption after rice and wheat. The vegetative propagation and the global trade of seed potatoes along with the significant impact of potato viruses on potato crops have imposed many potato viruses as universal challenges to potato production worldwide. In many countries, the great efforts to study potato viruses and develop effective management programs, including certification schemes, have been rewarding. However, the lack of effective control of potato viruses has minimized the profit margin of potato production in most potato-producing areas. In the current chapter, we summarize major potato viruses of a global significance to potato production focusing on the epidemiology, detection, and possible management practices. This chapter does not replace previous reviews on potato virus diseases available, but we intended to provide a thorough review of applied knowledge relevant to potato growers and researchers involved in management programs of potato virus diseases.

Six genome sequences for potato virus Y (PVY) recombinants are reported from two North American potato cultivars grown in China. The coding complete sequences encode a single open reading frame characteristic of potyviruses. The six sequenced PVY isolates represent three distinct recombinants of PVY, namely N-Wi, SYR-I, and SYR-II.

Papaya sticky disease (PSD) is a major virus disorder of papaya (Carica papaya). The disease is characterized by fruit damage caused by the oxidation of spontaneously exuded latex. In Brazil, PSD is caused by the coinfection of two viruses, papaya meleira virus (PMeV), a toti-like virus, and papaya meleira virus-2 (PMeV-2), an umbra-like virus. The disorder has also been reported in Mexico and, more recently, in Australia, but the presence of both PMeV and PMeV-2 in symptomatic plants has been documented only in Brazil. In 2021, 2-year-old papaya plants (cultivar Passion Red) exhibiting PSD-like symptoms were observed in Santa Elena Province, Ecuador. Molecular tests of leaf tissue and fruit latex from symptomatic plants failed to detect PMeV. However, papaya virus Q (PpVQ), an umbra-like virus related to but distinct from PMeV-2, and a novel virus, tentatively named papaya sticky fruit-associated virus (PSFaV), were found in the symptomatic samples. PSFaV shares 56% nucleotide identity with the genome of PMeV, suggesting that PSD symptoms can be caused by “couples” of viruses related to but distinct from PMeV (a toti-like virus) and PMeV-2 (an umbra-like virus). This review discusses the history and epidemiology of PSD and the genomic features of newly discovered virus couples involved in this syndrome. Given the unusual etiology of PSD, which involves distinct virus species, the importance of implementing proper diagnostic approaches for PSD is highlighted.