Correction to: Leukemia (2014) 28, 182–185; doi: 10.1038/leu.2013.282; published online 18 October 2013 There is an incorrect sequence for the primer ‘reverse 2’ in Supplementary Information (Methods, page 2, row 44). The original sequence ‘CATCTCAGATGTCTTGCTAGGGGACTC’ needs to be corrected as follows: ‘TGTAGATTCTCTTGCAGGGATGTACACTG’.

Aim: To assess the association of host genetic variation and early response to treatment as measured by minimal residual disease (MRD) in ETV6-RUNX1 fusion gene-positive childhood acute lymphoblastic leukemia (ALL) treated on protocol ALL-BFM 2000.

Acute lymphoblastic leukemia (ALL) is a malignant disease of the white blood cells. The etiology of ALL is believed to be multifactorial and likely to involve an interplay of environmental and genetic variables. We performed a genome-wide association study of 355 750 single-nucleotide polymorphisms (SNPs) in 474 controls and 419 childhood ALL cases characterized by a t(12;21)(p13;q22) — the most common chromosomal translocation observed in childhood ALL — which leads to an ETV6–RUNX1 gene fusion. The eight most strongly associated SNPs were followed-up in 951 ETV6-RUNX1-positive cases and 3061 controls from Germany/Austria and Italy, respectively. We identified a novel, genome-wide significant risk locus at 3q28 (TP63, rs17505102, PCMH=8.94 × 10−9, OR=0.65). The separate analysis of the combined German/Austrian sample only, revealed additional genome-wide significant associations at 11q11 (OR8U8, rs1945213, P=9.14 × 10−11, OR=0.69) and 8p21.3 (near INTS10, rs920590, P=6.12 × 10−9, OR=1.36). These associations and another association at 11p11.2 (PTPRJ, rs3942852, P=4.95 × 10−7, OR=0.72) remained significant in the German/Austrian replication panel after correction for multiple testing. Our findings demonstrate that germline genetic variation can specifically contribute to the risk of ETV6–RUNX1-positive childhood ALL. The identification of TP63 and PTPRJ as susceptibility genes emphasize the role of the TP53 gene family and the importance of proteins regulating cellular processes in connection with tumorigenesis.

To gain insight into the spectrum of molecular aberrations associated with childhood leukemia we performed 100k Affymetrix SNP-array analysis in 20 ALL samples. The results were validated by high-resolution custom-made CGH array analysis. Recurrent lesions (prevalence >10%) not previously described in association with specific biological subgroups were further characterized by PCR in a large representative patient cohort. In 5 of 20 patients a deletion was seen in the 5'region of C20orf94. Deletions were stable at initial diagnosis and relapse and sequences of breakpoint junctions indicated involvement of illegitimate V(D)J recombination. Screening in a cohort of 513 patients led to detection of C20orf94 deletion in 162 patients (31,6%) of initial tumor samples. No association was seen regarding treatment outcome or treatment response. The deletion was detected in 99 (90%) of 110 TEL/AML1 positive patients, indicating a potential involvement of this alteration in the pathomechanism of TEL/AML1 positive ALL and, in addition, supporting a role of illegitimate V(D)J recombination for this specific subgroup.

Therapy-related malignant myeloid neoplasms (t-AML/t-MDS) are a devastating late effect of treatment for childhood acute lymphoblastic leukemia (ALL). To gain insights into the etiology of t-AML/t-MDS, we performed a systematic three-step analysis: step 1) We identified all patients from the ALL-BFM database, being registered with a t-AML/t-MDS as an event; step 2) Based on the availability of biological specimens and completeness of clinical data, we established a cohort representing the incident population of t-AML and t-MDS for a 10 year interval (1996–2005); step 3) for a subset of this incident cohort, high-resolution copy-number analysis was performed using Affymetrix SNP 6.0 arrays to find distinctive structural variations or rare copy number alterations. In step 2, children with t-AML/t-MDS showed a significantly higher incidence of hyperdiploid ALL compared to a reference population suggesting a non-random mechanism of disease. In step 3, only a single rare copy number alteration was found performing germline DNA analysis. Therefore, additional SNP arrays including t-AML/t-MDS samples as well as whole exome sequencing are underway. Further results from all three steps will be presented at the meeting.

Within therapy optimization trial ALL-BFM 2000, extended minimal residual disease (MRD) analysis is able to identify a group of patients displaying molecular persistance of leukemia cells on a high level throughout conventional treatment (VHRL, very high-risk leukemia). A persisting MRD load of 10-3 or more after four intensive high-risk therapy blocks seems to indicate a critical prognostic threshold. Although MRD is a strong prognostic tool, it can provide this information only weeks after diagnosis and, in addition, does not yield any insights into the mechanism of treatment response or resistance. Therefore, we currently collect genome-wide information at different levels. Gene expression data derived from cDNA microarray analyses will be combined with information from genome-wide fine mapping arrays (SNP chips), methylation profiling and microRNA analysis to find a minimal set of markers to develop an integrated tool for the early diagnosis of VHRL patients. Furthermore, the enormous amount of molecular information will be used to identify and characterize possible target genes and pathways in order to facilitate the application of novel targeted treatments.

Hurler's syndrome is an inborn error of mucopolysaccharide metabolism leading to premature death in childhood. Allogeneic hematopoietic SCT can achieve long-term survival by correcting the enzymatic deficiency. In an attempt to improve long-term engraftment and to reduce regimen-related toxicity (RRT), a prospective multicenter approach was initiated in Germany using a fludarabine-based radiation-free preparative regimen. Between 2001 and 2008, 12 children were enrolled. Median age at SCT was 14 months (range, 4–31 months). The conditioning regimen contained fludarabine, BU, melphalan and antithymocyte globulin. CD34 positively selected PBSC were used in 10 children with a matched unrelated donor. Median cell dose was 24.6 × 106 CD34+ cells per kg (range 10.0–54.8). Two children with a matched sibling donor received non-manipulated BM. Donor lymphocyte infusions were given in 6/12 children for mixed hematopoietic chimerism. At a median follow-up of 29 months (range 2–85 months), all children engrafted and have either stabilized or improved neurological function. In total, 12/12 patients showed donor-derived engraftment with 9/12 having full and 3/12 having mixed hematopoiesis. One developed acute GVHD ⩾grade II. RRT ⩾grade II was observed in two patients.

Severe graft failure presumably due to phenytoin-induced hypersensitivity syndrome in two patients after bone marrow transplantation

Allogeneic hematopoietic stem cell transplantation (HSCT) is the only definitive treatment for severe bone marrow dysfunction and clonal disorders in patients diagnosed with Shwachman–Diamond syndrome (SDS). In an attempt to minimize regimen-related toxicity (RRT), we have initiated a fludarabine/treosulfan/melphalan-based pilot protocol avoiding the combination of busulfan and cyclophosphamide. Median age at transplantation was 9.6 years (range 1.5–17 years). All three patients received conditioning with fludarabine (30 mg/m2/day × 6), treosulfan (12 g/m2/day × 3) and melphalan (140 mg/m2/day × 1). CAMPATH-1H (0.1 mg/kg × 2) was added in two cases, while rabbit ATG (Genzyme; 3 × 2.5 mg/kg) was given to the cord blood recipient. One patient was transplanted with a non-manipulated marrow graft from an HLA-identical sibling, one with a marrow graft from a 10/10 matched unrelated donor, and one with a 9/10 matched unrelated umbilical cord blood (UCB) unit. Mean cell doses given were 3.6 × 108 nucleated cells/kg BW for the bone marrow recipients and 4.2 × 107 nucleated cells/kg BW for UCB recipient. Overall, two of three patients are alive and display 100% donor chimerism. Acute graft-versus-host disease grade II was seen in one patient, while no GVHD exceeding grade I occurred in the remaining two.

We report a retrospective analysis of 11 children with Down syndrome (DS) treated by SCT in eight German/ Austrian SCT centres. Indications for transplantation were acute lymphoblastic leukaemia (N = 8) and acute myeloid leukaemia (N = 3). A reduced intensity conditioning (RIC) containing 2 Gy TBI was given to two patients, another five received a myeloablative regimen with 12 Gy TBI. Treosulphan or busulphan was used in the remaining four children. Four of eleven (36%) patients are alive. All of them were treated with a myeloablative regimen. One of the four surviving children relapsed 9 months after SCT and is currently receiving palliative outpatient treatment. The main cause of death was relapse (5/11). Two children died of regimen-related toxicity (RRT), one from severe exfoliative dermatitis and multiorgan failure after a treosulphan-containing regimen, the other from GvHD-related infections after RIC. Acute GvHD of the skin was observed in 10 of 10 evaluable patients, and chronic GvHD in 4 of 8. Our data show that DS patients can tolerate commonly used, fully myeloablative preparative regimens. The major cause of death is relapse rather than RRT resulting in an event-free survival of 18% and over all survival of 36%.