Overexpression of the cytokine receptor-like factor 2 (CRLF2) gene in acute lymphoblastic leukemia (ALL) is caused by different aberrations like a deletion juxtaposing CRLF2 with the P2RY8 promoter, by a translocation involving the immunoglobulin heavy chain locus (IGH@), by supernumerary copies of the CRLF2 locus or by not yet identified causes. Several retrospective studies showed that only the presence of the P2RY8-CRLF2 rearrangement is associated with a high incidence of relapse in CRLF2-overexpressing precursor B-cell ALL (pB-ALL) in children; however, prospectively assessed data are missing.

Correction to: Leukemia (2014) 28, 182–185; doi: 10.1038/leu.2013.282; published online 18 October 2013 There is an incorrect sequence for the primer ‘reverse 2’ in Supplementary Information (Methods, page 2, row 44). The original sequence ‘CATCTCAGATGTCTTGCTAGGGGACTC’ needs to be corrected as follows: ‘TGTAGATTCTCTTGCAGGGATGTACACTG’.

Despite risk-adapted treatment, survival of children with relapse of acute lymphoblastic leukemia (ALL) remains poor compared with that of patients with initial diagnosis of ALL. Leukemia-associated genetic alterations may provide novel prognostic factors to refine present relapse treatment strategies. Therefore, we investigated the clinical relevance of 13 recurrent genetic alterations in 204 children treated uniformly for relapsed B-cell precursor ALL according to the ALL-REZ BFM 2002 protocol. The most common alterations were deletions of CDKN2A/2B , IKZF1 , PAX5 , ETV6 , fusion of ETV6-RUNX1 and deletions and/or mutations of TP53 . Multivariate analysis identified IKZF1 deletion and TP53 alteration as independent predictors of inferior outcome ( P =0.002 and P =0.001). Next, we investigated how both alterations can improve the established risk stratification in relapsed ALL. Intermediate-risk relapse patients with low minimal residual disease are currently considered to have a good prognosis. In this group, deletion of IKZF1 and alteration of TP53 identify patients with significantly inferior outcome ( P <0.001). In high-risk relapse patients, deletion of IKZF1 is strongly predictive of a second relapse after stem cell transplantation ( P <0.001). We conclude that IKZF1 and TP53 represent relevant prognostic factors that should be considered in future risk assessment of children with relapsed ALL to indicate treatment intensification or intervention.