Rapid methods for the determination of the nucleotide sequence of DNA by base-specific chemical cleavage I and chain termination by dideoxynucleotides are in wide use. Similar techniques have been developed for RNA sequence analysis using base specific cleavage by both chemical and enzymic methods as well as chain termination with dideoxynucleotides using reverse transcriptase. While these procedures have proved to be sufficient for the determination of the primary structure of messenger and ribosomal RNAs, they have not been sufficient in the sequencing of RNAs that are rich in modified residues, such as tRNAs. These techniques cannot distinguish the numerous modified nucleotides present in tRNAs. A method has been developed by Stanley and Vassilenko that is particularly well-suited for the sequence analysis of tRNAs and other RNAs rich in modified residues. This method requires as little as 1μg of a purified tRNA. Partial digestion of the tRNA, under conditions that on an average yieldone break per molecule, generates fragments with newly produced 5´-hydroxyl ends, which can then be radioactively labeled with [γ-32P]ATP and T4 polynucleotide kinase. The labeled fragments are then separated by gel electrophoresis, excised, eluted, digested to [5´-32p]nucleoside diphosphates, and analyzed by thin-layer chromatography. This procedure usually yields between 80 and 100% of the entire sequence of the molecule. The remainder of the sequence, as well as confirmation of the entire sequence, can be determined by mobility shift analysis and base-specific cleavage of 32P-end labeled tRNA and tRNA fragments.

An unusual minor species of bovine liver serine tRNA has previously been isolated, sequenced, and found to suppress the UGA termination codon in protein synthesis in vitro [Diamond, A., Dudock, B. & Hatfield, D. (1981) Cell 25, 497-506]. We have now found that this tRNA can be a substrate in a specific phosphorylation reaction in which phosphoseryl-tRNA is formed. Moreover, bovine liver contains a second UGA suppressor serine tRNA (tRNASerNCA; N is a modified nucleoside) which also forms phosphoseryl-tRNA. The nucleotide sequence and coding properties of tRNASerNCA are presented.

The nucleotide sequence of the cytoplasmic 5 S ribosomal RNA from Spinacia oleracea has been determined. A secondary structural model possessing four base-paired regions can be constructed from the primary structure. This RNA shows 90 to 93% nucleotide sequence homology with other higher plant cytoplasmic 5 S RNAs and 73% homology with that of the lower eukaryote Chlorella. The spinach 5 S RNA has the nucleotide sequence identical with that of Chlorella in two important single-stranded regions, the sequence C10 AUACC and the dodecanucleotide sequence at positions 33 to 44. A nucleotide sequence similar or identical with C10 AUACC is found in most other eukaryotic 5 S RNAs, including the 5 S RNA from human KB cells. In addition, a single-stranded loop of 12 residues corresponding to positions 33 to 44 in the spinach 5 S RNA sequence may be a general feature of eukaryotic cytoplasmic 5 S RNAs, while prokaryotic 5 S RNAs have a 13-member loop for the corresponding residues. Several other important homologies in primary and secondary structure have also been observed in comparing spinach 5 S RNA to other 5 S RNAs.

A bovine liver serine tRNA with a variety of unusual features has been sequenced and characterized. This tRNA is aminoacylated with serine, although it has a tryptophan anticodon CmCA. In ribosome binding assays, this tRNA (tRNASERCmCA) binds to the termination codon UGA and shows little or no binding in response to a variety of other codons including those for tryptophan and serine. The unusual codon recognition properties of this molecule were confirmed in an in vitro assay where this tRNA suppressed UGA termination. This is the first naturally occurring eucaryotic suppressor tRNA to be so characterized. Other unusual features, possibly related to the ability of this tRNA to read UGA, are the presence of two extra nucleotides, compared to all other tRNAs, between the universal residues U at position 8 and A at position 14 and the presence of an extra unpaired nucleotide within the double-stranded loop IV stem. This tRNA is also the largest eucaryotic tRNA sequenced to date (90 nucleotides). Despite its size, however, it contains only six modified residues, tRNASerCmCA shows extremely low homology to other mammalian serine (47-52% homology) or tryptophan (49% homology) tRNAs.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.

The nucleotide sequence of spinach chloroplast methionine elongator tRNA (sp. chl. tRNAm Met) has been determined. This tRNA is considerably more homologous to E. coli tRNAm Met (67% homology) than to the three known eukaryotic tRNAm Met (50-55% homology). Sp. chl. tRNAm Met, like the eight other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihydrouridine loop and lacks unusual structural features which have been found in several mitochondrial tRNAs.

The tRNA-modifying enzyme, S-adenosylmethionine: tRNA (uridine-5)-methyltransferase, has been purified essentially to homogeneity from an Escherichia coli strain containing an elevated level of this enzyme. A rapid, efficient method has been developed for the purification, consisting of polyethyleneimine precipitation to remove nucleic acids, followed by phosphocellulose and Blue Sepharose affinity chromatography. The enzyme is a single polypeptide chain of molecular weight 42,000. It has a pH optimum of 8.4, a Km of 12.5 microM for S-adenyosyl-L-methionine, and a Km of 1.1 microM for wheat germ tRNAGly1. The ability of the enzyme to methylate a variety of tRNA substrates including prokaryotic, eukaryotic, mitochondrial, and chloroplastic tRNAs has been characterized.

In a previous comparison of tRNAs from vegetative and developing cells of Dictyostelium discoideum, displacements of chromatographic peaks were observed for a number of aminoacyl-tRNAs (Palatnik, C.M., Katz, E.R. and Brenner, M. (1977) J. Biol. Chem. 252, 694-703). Since the development peak eluted ahead of the vegetative peak in all but one case, and since levels of amino acid acceptance and tRNA chromatographic profiles were otherwise quite similar, it was suggested that a common change or a very small number of changes in base modification were occurring during development. We have threfore compared tRNAs from both stages with respect particularly to their minor base composition. Of the minor bases which we have analyzed no reproducible differences between the two stages have been detected. Moreover, we have been unable to confirm a recent report (Dingermann, T., Schmidt, W. and Kersten, H. (1977) FEBS Lett. 80, 205-208) that a significant change occurs in the ribothymidine content of tRNA during Dictyostelium discoideum development.

Through the use of a variety of post-labeling techniques, the nucleotide sequence of a major species of leucine tRNA from bovine liver was determined to be pG-G-U-A-G-C-G-U-G-m-G-C-ac-C-G-A-G-C-G-G-D-C-psi-A-A-G-G-C-m-G-C-U-G-G-A-psim- U-I-A-G-m-G-C-psi-C-C-A-G-U-C-psi-C-psi-U-C-G-G-G-G-G-m-C-G-U-G-G-G-T-psi-C-G-m -A-A-U-C-C-C-A-C-C-G-C-U-G-C-C-A-C-C-AOH. A comparison of known sequences of leucine tRNAs shows a consistent set of features which clearly distinguish prokaryotic and eukaryotic leucine tRNAs from each other.

An unusual class of wheat germ tRNAs has been isolated which completely lacks ribothymidine (rT) and contains an unmodified uridine in its place. We discuss here the isolation, identification and properties of these tRNAs. The rT-lacking tRNAs of wheat germ are essentially limited to the glycine isoacceptors (a minimum of five identifiable species), three threonine and at least, one tyrosine tRNA. All tRNAs were obtained 70-100% pure by chromatographic methods, and were detected by their ability to be methylated by E. coli rT-forming uracil methyltransferase with methyl-labeled S-adenosyl-L-methionine (SAM) as the methyl donor. In vitro methylation of each of the tRNAs resulted in the formation of 1 mole of rT per mole of tRNA. In the one case analyzed in detail (tRNA1Gly), all of the rT was found to be located at the 23rd position from the 3' end of the tRNA molecule. Following complete digestion of four highly purified glycine isoacceptors (tRNAGly1,4,5,6) to nucleosides and subsequent periodate oxidation and 3H potassium borohydride reduction, all were found to contain an unusually high level of 5-methylcytidine (m5C) (3-4 residues per molecule), and all contained no rT. The possible correlation between the presence of m5C and the absence of rT is discussed. All of the chromatographically purified glycine tRNAs function in a wheat germ cell-free protein synthesizing system and polymerize glycine in response to either poly G or poly (G, U).

A novel method has been developed for the detection and study of tRNA-like moieties in viral RNAs. Tobacco mosaic virus RNA is an acceptable substrate for crude Escherichia coli ribothymidine-forming tRNA methyltransferase. Under optimum reaction conditions at least 85% of the methylation product is ribothymidine (rT). The reaction is essentially quantitative, 1 mol of rT being formed per mol of tobacco mosaic virus RNA. The optimum reaction conditions include the presence of 6.6 μM S-adenosyl-l-[Me-3H]methionine, 25 μM spermine, 25 mM ammonium acetate, and 50 mM HEPES, pH 8.0. Sequence analysis of (Me-3H)-labeled tobacco mosaic virus RNA shows that all of the methylation occurs at a single site and strongly suggests that this site is the 32nd residue from the 3′-end of tobacco mosaic virus RNA. This site closely resembles the normal position of rT in transfer RNA.

Although ribothymidine (rT) is the most common methylated nucleoside in tRNA, a wide variety of bovine tissues have now been found to contain a class of tRNAs which totally lack rT and have an unmodified uridine in its place. The tissues studied include bovine brain, kidney, liver, thymus and testicles from adult, newborn and fetal stages. This class of tRNA was detected by its ability to be methylated with Escherichia coli rT-forming uracil methylase with radioactive S-adenosyl-l-methionine as the methyl donor. In each case rT was shown to account for at least 95% of the methylated products produced. In vitro methylated tRNA populations were compared by fractionation of double-labeled tRNAs on RPC-5 columns. Three major methyl-accepting tRNA peaks were found for all mammalian tissues studied. The level of methyl acceptance in these peaks was found to vary considerably between tRNAs of different tissues. A major difference in the methyl-accepting tRNA populations of bovine liver and calf thymus was observed. Little similarity was found in the rT-lacking class of tRNAs of bovine liver and wheat germ.

Mammalian cells contain a large number of iso-acceptor transfer RNAs, some of which are present in very small amounts as compared to the major species, and until now the function of these minor tRNA species has not been clarified. We have found that extracts from mouse cells treated by interferon require specifically the addition of some minor species of tRNA to allow proper translation of exogenous messenger RNA. By a series of chromatographic steps, we have purified minor Leu-tRNA species required for Mengo virus RNA translation from the other Leu-tRNAs, and identified their cognate codons. Globin mRNA and Mengo RNA require different minor Leu-tRNA species. This represents the first system in which translation of different mRNA is shown to be completely dependent on the addition of minor iso-acceptor tRNA which cannot be replaced by major species, even if these recognize the same codons.