Light quantity and quality promotes ecological-niche differentiation of photosynthetic organisms. The existence of cyanobacteria capable of performing photosynthesis using red-shifted chlorophylls, chlorophyll d and f, reduces competition between species in light-limiting environments, and permits them to thrive in niches enriched in far-red light. We examined global transcriptome changes due to changing the culture light conditions in Acaryochloris marina, a chlorophyll d-containing cyanobacterium. We identified the functional category of 'photosynthesis' as the most down-regulated and the category of 'cell wall/membrane biogenesis' as the most up-regulated through a functional enrichment analysis of genes differentially expressed. Within the category of 'cell wall/membrane biogenesis', genes encoding glycosysltransferases accumulated the most in response to far-red light. Further experimental results confirmed that cells grown under far-red light form biofilms with a significantly increased adherence compared to cells grown under white light. Taken together, these results indicate that Acaryochloris marina shifts its lifestyle from a planktonic state under white light to an immobilized state under far-red light.

Current Bayesian microarray models that pool multiple studies assume gene expression is independent of other genes. However, in prokaryotic organisms, genes are arranged in units that are co-regulated (called operons). Here, we introduce a new Bayesian model for pooling gene expression studies that incorporates operon information into the model. Our Bayesian model borrows information from other genes within the same operon to improve estimation of gene expression. The model produces the gene-specific posterior probability of differential expression, which is the basis for inference. We found in simulations and in biological studies that incorporating co-regulation information improves upon the independence model. We assume that each study contains two experimental conditions: a treatment and control. We note that there exist environmental conditions for which genes that are supposed to be transcribed together lose their operon structure, and that our model is best carried out for known operon structures.

BACKGROUND:The role of the RNA polymerase sigma factor RpoN in regulation of gene expression in Geobacter sulfurreducens was investigated to better understand transcriptional regulatory networks as part of an effort to develop regulatory modules for genome-scale in silico models, which can predict the physiological responses of Geobacter species during groundwater bioremediation or electricity production.RESULTS:An rpoN deletion mutant could not be obtained under all conditions tested. In order to investigate the regulon of the G. sulfurreducens RpoN, an RpoN over-expression strain was made in which an extra copy of the rpoN gene was under the control of a taclac promoter. Combining both the microarray transcriptome analysis and the computational prediction revealed that the G. sulfurreducens RpoN controls genes involved in a wide range of cellular functions. Most importantly, RpoN controls the expression of the dcuB gene encoding the fumarate/succinate exchanger, which is essential for cell growth with fumarate as the terminal electron acceptor in G. sulfurreducens. RpoN also controls genes, which encode enzymes for both pathways of ammonia assimilation that is predicted to be essential under all growth conditions in G. sulfurreducens. Other genes that were identified as part of the RpoN regulon using either the computational prediction or the microarray transcriptome analysis included genes involved in flagella biosynthesis, pili biosynthesis and genes involved in central metabolism enzymes and cytochromes involved in extracellular electron transfer to Fe(III), which are known to be important for growth in subsurface environment or electricity production in microbial fuel cells. The consensus sequence for the predicted RpoN-regulated promoter elements is TTGGCACGGTTTTTGCT.CONCLUSION:The G. sulfurreducens RpoN is an essential sigma factor and a global regulator involved in a complex transcriptional network controlling a variety of cellular processes.

Geobacter species are among the most effective microorganisms known for the bioremediation of radioactive and toxic metals in contaminated subsurface environments and for converting organic compounds to electricity in microbial fuel cells. However, faster rates of electron transfer could aid in optimizing these processes. Therefore, the Optknock strain design methodology was applied in an iterative manner to the constraint-based, in silico model of Geobacter sulfurreducens to identify gene deletions predicted to increase respiration rates. The common factor in the Optknock predictions was that each resulted in a predicted increase in the cellular ATP demand, either by creating ATP-consuming futile cycles or decreasing the availability of reducing equivalents and inorganic phosphate for ATP biosynthesis. The in silico model predicted that increasing the ATP demand would result in higher fluxes of acetate through the TCA cycle and higher rates of NADPH oxidation coupled with decreases in flux in reactions that funnel acetate toward biosynthetic pathways. A strain of G. sulfurreducens was constructed in which the hydrolytic, F(1) portion of the membrane-bound F(0)F(1) (H(+))-ATP synthase complex was expressed when IPTG was added to the medium. Induction of the ATP drain decreased the ATP content of the cell by more than half. The cells with the ATP drain had higher rates of respiration, slower growth rates, and a lower cell yield. Genome-wide analysis of gene transcript levels indicated that when the higher rate of respiration was induced transcript levels were higher for genes involved in energy metabolism, especially in those encoding TCA cycle enzymes, subunits of the NADH dehydrogenase, and proteins involved in electron acceptor reduction. This was accompanied by lower transcript levels for genes encoding proteins involved in amino acid biosynthesis, cell growth, and motility. Several changes in gene expression that involve processes not included in the in silico model were also detected, including increased expression of a number of redox-active proteins, such as c-type cytochromes and a putative multicopper outer-surface protein. The results demonstrate that it is possible to genetically engineer increased respiration rates in G. sulfurreducens in accordance with predictions from in silico metabolic modeling. To our knowledge, this is the first report of metabolic engineering to increase the respiratory rate of a microorganism.

ABSTRACT Although Pelobacter species are closely related to Geobacter species, recent studies suggested that Pelobacter carbinolicus may reduce Fe(III) via a different mechanism because it lacks the outer-surface c-type cytochromes that are required for Fe(III) reduction by Geobacter sulfurreducens. Investigation into the mechanisms for Fe(III) reduction demonstrated that P. carbinolicus had growth yields on both soluble and insoluble Fe(III) consistent with those of other Fe(III)-reducing bacteria. Comparison of whole-genome transcript levels during growth on Fe(III) versus fermentative growth demonstrated that the greatest apparent change in gene expression was an increase in transcript levels for four contiguous genes. These genes encode two putative periplasmic thioredoxins; a putative outer-membrane transport protein; and a putative NAD(FAD)-dependent dehydrogenase with homology to disulfide oxidoreductases in the N terminus, rhodanese (sulfurtransferase) in the center, and uncharacterized conserved proteins in the C terminus. Unlike G. sulfurreducens, transcript levels for cytochrome genes did not increase in P. carbinolicus during growth on Fe(III). P. carbinolicus could use sulfate as the sole source of sulfur during fermentative growth, but required elemental sulfur or sulfide for growth on Fe(III). The increased expression of genes potentially involved in sulfur reduction, coupled with the requirement for sulfur or sulfide during growth on Fe(III), suggests that P. carbinolicus reduces Fe(III) via an indirect mechanism in which (i) elemental sulfur is reduced to sulfide and (ii) the sulfide reduces Fe(III) with the regeneration of elemental sulfur. This contrasts with the direct reduction of Fe(III) that has been proposed for Geobacter species.

Geobacter sulfurreducens effectively produces electricity in microbial fuel cells by oxidizing acetate with an electrode serving as the sole electron acceptor. Deletion of the gene encoding OmcF, a monoheme outer membrane c-type cytochrome, substantially decreased current production. Previous studies demonstrated that inhibition of Fe(III) reduction in the OmcF-deficient mutant could be attributed to poor transcription of the gene for OmcB, an outer membrane c-type cytochrome that is required for Fe(III) reduction. However, a mutant in which omcB was deleted produced electricity as well as wild type. Microarray analysis of the OmcF-deficient mutant versus the wild type revealed that many of the genes with the greatest decreases in transcript levels were genes whose expression was previously reported to be upregulated in cells grown with an electrode as the sole electron acceptor. These included genes with putative functions related to metal efflux and/or type I secretion and two hypothetical proteins. The outer membrane cytochromes, OmcS and OmcE, which previous studies have demonstrated are required for optimal current generation, were not detected on the outer surface of the OmcF-deficient mutant even though the omcS and omcE genes were still transcribed, suggesting that the putative secretion system could be involved in the export of outer membrane proteins necessary for electron transfer to the fuel cell anode. These results suggest that the requirement for OmcF for optimal current production is not because OmcF is directly involved in extracellular electron transfer but because OmcF is required for the appropriate transcription of other genes either directly or indirectly involved in electricity production.

Organisms from the metal-reducing family Geobacteraceae participate in bioremediation of contaminated environments and in energy harvesting. We have developed a database and an accompanying online query system, GSEL, for Geobacter Sequence Elements (available from http://www.geobacter.org/research/gsel/). It compiles information on predicted transcription regulatory elements in the genome of G sulfurreducens. These elements were derived from analyses that employed genome-wide transcription profiling, comparative genomics, and similarity searches. Clustering was employed to group overlapping sequence elements with similar genome locations. Subsequent scoring and sorting allowed us to identify individual sequence elements and regulatory clusters that were predicted by the highest number of independent microarray gene expression and sequence comparison data sets. These sequence elements and genome regions are likely to be involved in gene regulation under a variety of conditions or in multiple biological pathways.

The authors regret that some errors occurred in Tables 1 and 2 of their paper. In Table 1. The sequence of 3410QR (CAGCATCTCGCACTCTTTGG) is incorrect. The correct is GTCGGCAACGCCTTTGG. In Table 2. The sequence of 3410F (ATGAAAACCACAGCCATCGC) is incorrect. The correct sequence is ATGAAAGCGAACGTTGCAGC. The sequence for 3410R (GTGAGTCGTGGCTCCTTCTT) is incorrect. The correct sequence is GTTCTTCGCCTCCGCCTTG. The length of amplicon of GSU3410 should be 228 and not 225. The authors apologise for any inconvenience caused.

Although the genome sequences of many microorganisms are now known, whole-genome DNA microarray platforms consisting of PCR amplicon, or oligonucleotide elements printed onto glass slides have been readily available for only a relatively few, highly studied microorganisms. For those microorganisms more recently cultured or studied by fewer investigators it has been difficult to justify the initial time and expense of developing such array platforms especially if only a limited number of gene expression studies are envisioned. However, in-situ synthesized oligonucleotide (ISO) arrays can be inexpensively fabricated on an 'as needed' basis with a reduced initial investment in time, personnel, resources, and costs. To evaluate the performance of one ISO array platform, gene expression patterns in Geobacter sulfurreducens under nitrogen-fixing conditions were compared with results from quantitative reverse transcriptase PCR (qRT-PCR) and previously published data from a similar experiment using spotted PCR amplicon arrays. There were strong correlations between the results of the ISO arrays and the results from qRT-PCR (r(2)=0.762) and spotted array (r(2)=0.744) analyses. After initial use the ISO arrays could be successfully stripped and reused. The increased flexibility in array design and reusability coupled with a lower initial investment in terms of fabrication time and cost for the ISO arrays suggest that they may be the preferred approach when investigating gene expression in microorganisms, especially when only a few expression studies are required.

ABSTRACT A sensor histidine kinase of Synechococcus sp. strain PCC7942, designated nblS, was previously identified and shown to be critical for the acclimation of cells to high-light and nutrient limitation conditions and to influence the expression of a number of light-responsive genes. The nblS orthologue in Synechocystis sp. strain PCC6803 is designated dspA (also called hik33). We have generated a dspA null mutant and analyzed global gene expression in both the mutant and wild-type strains under high- and low-light conditions. The mutant is aberrant for the expression of many genes encoding proteins critical for photosynthesis, phosphate and carbon acquisition, and the amelioration of stress conditions. Furthermore, transcripts from a number of genes normally detected only during exposure of wild-type cells to high-light conditions become partially constitutive in the low-light-grown dspA mutant. Other genes for which transcripts decline upon exposure of wild-type cells to high light are already lower in the mutant during growth in low light. These results suggest that DspA may influence gene expression in both a positive and a negative manner and that the dspA mutant behaves as if it were experiencing stress conditions (e.g., high-light exposure) even when maintained at near-optimal growth conditions for wild-type cells. This is discussed with respect to the importance of DspA for regulating the responses of the cell to environmental cues.

The cyanobacterium Synechocystis sp. PCC 6803 possesses multiple inorganic carbon (Ci) uptake systems that are regulated by Ci availability. The control mechanisms of these systems and their integration with other cell functions remain to be clarified. An analysis of the changes in global gene expression in response to Ci downshift and the inactivation of ndhR (sll1594), a LysR family regulator of Ci uptake is presented in this report. Mild Ci limitation (3% CO2 (v/v) in air to air alone) induced a dramatic up-regulation of genes encoding both inducible CO2 and HCO3- uptake systems. An induction of ndhD5/ndhD6 and other genes in a probable transcriptional unit was observed, suggesting a function in inducible Ci uptake. The expression of slr1513 and sll1735, physically clustered with sbtA and ndhF3/ndhD3/cupA, respectively, were also coordinated with upstream genes encoding the essential components for HCO3- and CO2 uptake. Ci limitation induced the regulatory genes slr1214, sll1292, slr1594, sigD, sigG, and sigH, among which slr1214, a two-component response regulator, showed the earliest induction, implying a role for the early response to Ci limitation. Opposite regulation of genes encoding the assimilation of carbon and nitrogen demonstrated a striking coordination of expression to balance C- and N-fluxes. The analyses revealed that ndhR inactivation up-regulated the expression of sbtA/sbtB, ndhF3/ndhD3/cupA/sll1735, and slr2006-13 including ndhD5 and ndhD6, indicating a vital role of this regulatory gene in both CO2 and HCO3- acquisition of the cyanobacterium. We therefore suggest that ndhR be renamed ccmR to better represent its broader regulatory characteristics.

BACKGROUND:DNA microarrays are a powerful tool with important applications such as global gene expression profiling. Construction of bacterial DNA microarrays from genomic sequence data using a two-stage PCR amplification approach for the production of arrayed DNA is attractive because it allows, in principal, the continued re-amplification of DNA fragments and facilitates further utilization of the DNA fragments for additional uses (e.g. over-expression of protein). We describe the successful construction and use of DNA microarrays by the two-stage amplification approach and discuss the technical challenges that were met and resolved during the project.RESULTS:Chimeric primers that contained both gene-specific and shared, universal sequence allowed the two-stage amplification of the 3,168 genes identified on the genome of Synechocystis sp. PCC6803, an important prokaryotic model organism for the study of oxygenic photosynthesis. The gene-specific component of the primer was of variable length to maintain uniform annealing temperatures during the 1st round of PCR synthesis, and situated to preserve full-length ORFs. Genes were truncated at 2 kb for efficient amplification, so that about 92% of the PCR fragments were full-length genes. The two-stage amplification had the additional advantage of normalizing the yield of PCR products and this improved the uniformity of DNA features robotically deposited onto the microarray surface. We also describe the techniques utilized to optimize hybridization conditions and signal-to-noise ratio of the transcription profile. The inter-lab transportability was demonstrated by the virtual error-free amplification of the entire genome complement of 3,168 genes using the universal primers in partner labs. The printed slides have been successfully used to identify differentially expressed genes in response to a number of environmental conditions, including salt stress.CONCLUSIONS:The technique detailed here minimizes the cost and effort to replicate a PCR-generated DNA gene fragment library and facilitates several downstream processes (e.g. directional cloning of fragments and gene expression as affinity-tagged fusion proteins) beyond the primary objective of producing DNA microarrays for global gene expression profiling.

BioTechniquesVol. 33, No. 1 BenchmarksOpen AccessOptimization of Fusion PCR for In Vitro Construction of Gene Knockout FragmentsHong-Liang Wang, Bradley L. Postier & Robert L. BurnapHong-Liang WangOklahoma State University, Stillwater, OK, USA, Bradley L. PostierOklahoma State University, Stillwater, OK, USA & Robert L. Burnap*Address correspondence to: Robert L. Burnap, Department of Microbiology & Molecular Genetics, 307 Life Sciences East, Oklahoma State University, OK 74075, USA. e-mail: E-mail Address: burnap@biochem.okstate.eduOklahoma State University, Stillwater, OK, USAPublished Online:17 Sep 2018https://doi.org/10.2144/02331bm02AboutSectionsPDF/EPUB ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinkedInReddit FiguresReferencesRelatedDetailsCited ByTowards understanding the mechanism of n-hexane tolerance in Synechocystis sp. PCC 6803Chinese Journal of Chemical Engineering, Vol. 11Deletion of the waaf gene affects O antigen synthesis and pathogenicity in Vibrio parahaemolyticus from shellfishFood Science and Human Wellness, Vol. 11, No. 2Germination-Arrest Bacillus subtilis Spores as An Oral Delivery Vehicle of Grass Carp Reovirus (GCRV) Vp7 Antigen Augment Protective Immunity in Grass Carp (Ctenopharyngodon idella)14 November 2020 | Genes, Vol. 11, No. 11Fusion-PCR generates attL recombination site adaptors and allows Rapid One-Step Gateway (ROG) cloningBiochimie, Vol. 174Establishment of Transgenesis in the Demosponge Suberites domuncula16 August 2018 | Genetics, Vol. 210, No. 2Gibson Assembly facilitates bacterial allelic exchange mutagenesisJournal of Microbiological Methods, Vol. 144FabG can function as PhaB for poly-3-hydroxybutyrate biosynthesis in photosynthetic cyanobacteria Synechocystis sp. PCC 680319 May 2017 | Bioengineered, Vol. 8, No. 6The Response Regulator Slr1588 Regulates spsA But Is Not Crucial for Salt Acclimation of Synechocystis sp. PCC 680326 June 2017 | Frontiers in Microbiology, Vol. 8Staphylococcus epidermidis ΔSortase A strain elicits protective immunity against Staphylococcus aureus infection18 October 2016 | Antonie van Leeuwenhoek, Vol. 110, No. 1Slr1909, a Novel two-component Response Regulator Involved in Acid Tolerance in Synechocystis sp. PCC 680312 August 2016Identification of a transporter Slr0982 involved in ethanol tolerance in cyanobacterium Synechocystis sp. PCC 680318 May 2015 | Frontiers in Microbiology, Vol. 6Elucidating butanol tolerance mediated by a response regulator Sll0039 in Synechocystis sp. PCC 6803 using a metabolomic approach21 January 2015 | Applied Microbiology and Biotechnology, Vol. 99, No. 4A Transcriptional Regulator Sll0794 Regulates Tolerance to Biofuel Ethanol in Photosynthetic Synechocystis sp. PCC 6803Molecular & Cellular Proteomics, Vol. 13, No. 12Butanol tolerance regulated by a two-component response regulator Slr1037 in photosynthetic Synechocystis sp. PCC 680311 June 2014 | Biotechnology for Biofuels, Vol. 7, No. 1Construction of a Streptococcus iniae sortase A mutant and evaluation of its potential as an attenuated modified live vaccine in Nile tilapia (Oreochromis niloticus)Fish & Shellfish Immunology, Vol. 40, No. 2Integrated proteomic and metabolomic characterization of a novel two-component response regulator Slr1909 involved in acid tolerance in Synechocystis sp. PCC 6803Journal of Proteomics, Vol. 109An orphan response regulator Sll0649 involved in cadmium tolerance and metal homeostasis in photosynthetic Synechocystis sp. PCC 6803Journal of Proteomics, Vol. 103An orphan two-component response regulator Slr1588 involves salt tolerance by directly regulating synthesis of compatible solutes in photosynthetic Synechocystis sp. PCC 68031 January 2014 | Mol. BioSyst., Vol. 10, No. 7Cell Growth Defect Factor1/CHAPERONE-LIKE PROTEIN OF POR1 Plays a Role in Stabilization of Light-Dependent Protochlorophyllide Oxidoreductase in Nicotiana benthamiana and Arabidopsis 22 October 2013 | The Plant Cell, Vol. 25, No. 10Integrated proteomic and transcriptomic analysis reveals novel genes and regulatory mechanisms involved in salt stress responses in Synechocystis sp. PCC 68038 August 2013 | Applied Microbiology and Biotechnology, Vol. 97, No. 18Development of a simple and rapid protocol for the production of customized intertypic recombinant poliovirusesJournal of Virological Methods, Vol. 186, No. 1-2RNA-seq based identification and mutant validation of gene targets related to ethanol resistance in cyanobacterial Synechocystis sp. PCC 680321 December 2012 | Biotechnology for Biofuels, Vol. 5, No. 1A synthetic DNA and fusion PCR approach to the ectopic expression of high levels of the D1 protein of photosystem II in Synechocystis sp. PCC 6803Journal of Photochemistry and Photobiology B: Biology, Vol. 104, No. 1-2One-step plasmid construction for generation of knock-out mutants in cyanobacteria: studies of glycogen metabolism in Synechococcus sp. PCC 700211 January 2011 | Photosynthesis Research, Vol. 107, No. 2Cyanobacterial hybrid kinase Sll0043 regulates phototaxis by suppressing pilin and twitching motility protein5 July 2008 | The Journal of Microbiology, Vol. 46, No. 3The Psb27 Protein Facilitates Manganese Cluster Assembly in Photosystem IIJournal of Biological Chemistry, Vol. 283, No. 7Engineered ectopic expression of the psbA gene encoding the photosystem II D1 protein in Synechocystis sp. PCC680326 May 2007 | Photosynthesis Research, Vol. 92, No. 3Streptococcus iniae Capsule Impairs Phagocytic Clearance and Contributes to Virulence in FishJournal of Bacteriology, Vol. 189, No. 4Alterations in Global Patterns of Gene Expression in Synechocystis sp. PCC 6803 in Response to Inorganic Carbon Limitation and the Inactivation of ndhR, a LysR Family RegulatorJournal of Biological Chemistry, Vol. 279, No. 7 Vol. 33, No. 1 Follow us on social media for the latest updates Metrics Downloaded 351 times History Published online 17 September 2018 Published in print July 2002 Information© 2018 Author(s)PDF download

Primary ion pumps and antiporters exist as multigene families in the Synechocystis sp. PCC 6803 genome and show very strong homologies to those found in higher plants. The gene knock-outs of five putative Na (+) /H (+) antiporters (slr1727 , sll0273 , sll0689 , slr1595 and slr0415 ) and seven cation ATPases (sll1614 , sll1920 , slr0671-72 , slr0822 , slr1507-08-09 , slr1728- 29 and slr1950 ) in the model cyanobacterium (http://www.kazusa.or.jp/cyano/cyano.html) were performed in this study relying on homologous recombination with mutagenenic fragments constructed using a fusion polymerase chain reaction (PCR) approach. The impacts of these gene knock-outs were evaluated in terms of Na (+) and pH, and light-induced acidification and alkalization that are asso-ciated with inorganic carbon uptake. Two of the five putative antiporter mutants exhibit a characteristic interplay between the pH and Na (+) dependence of growth, but only one of the antiporters appears to be necessary for high NaCl tolerance. On the other hand, the mutation of one of the two copper-trafficking ATPases produces a cell line that shows acute NaCl sensitivity. Additionally, disruptions of a putative Ca2+ -ATPase and a gene cluster encoding a putative Na (+) -ATPase subunit also cause high NaCl sensitivity. The findings and possible mechanisms are discussed in relation to the potential roles of these transporters in Synechocystis sp. PCC 6803.