The process of developing a socioenvironmental report card through transdisciplinary collaboration can be used in any system and can provide the foundation for collaborative solutions for sustainable resource management by creating a holistic assessment that balances environmental, economic, and social concerns that incorporates multiple perspectives from multisectoral actors. We demonstrated this in the Mississippi River watershed, USA with the ultimate goal of promoting holistic management of the region's natural resources. But working at the scale of the Mississippi River watershed presents the challenge of working across geographical, organizational, and disciplinary boundaries. The development of a socioenvironmental report card served as the focus for efforts to foster a shared vision among diverse stakeholders in the watershed and to promote transdisciplinary collaboration. The process engaged more than 700 participants from environment, flood control, transportation, water supply, economy, and recreation sectors, from more than 400 organizations representing local, state, and federal government agencies, businesses and trade associations, and private, nonprofit, and academic institutions. This broad engagement in the selection of important themes, indicators, measures, and assessment methods as part of the cocreation of boundary objects aimed to foster social and mutual learning and to develop common understanding and shared visioning among stakeholders with differing perspectives. The process was facilitated by boundary-spanning organizations, creating an atmosphere of trust by utilizing "third places" for knowledge exchange and integration. This transdisciplinary process also led to collective action through collaboration and selection of restoration and management activities that could improve conditions for multiple sectors simultaneously and/or recognize potential tradeoffs for informed decision making. Integr Environ Assess Manag 2020;16:494-507. © 2020 The Authors. Integrated Environmental Assessment and Management published by Wiley Periodicals, Inc. on behalf of Society of Environmental Toxicology & Chemistry (SETAC).

Coprological examination was used to determine prevalence of gastrointestinal helminthes in a sample of 231 dogs (117 females and 114 males) during the summer of 2009 at a veterinary clinic in south central West Virginia, USA. Clinical signs (e.g., diarrhea, vomiting, weight gain or loss) were noted in addition to a history of anthelmintic usage. A total of 79 dogs (33.6%) were infected with one or more intestinal nematodes. Most dogs (58) were parasitized with a single species, 19 were parasitized with 2 species, and 2 were parasitized by 3 species. There was no significant difference (i.e., X(2)<3.84; P>0.05) in prevalence of infection between female and male dogs for any of the identified nematode species. The chi-square test for equality of proportions was used to determine prevalence of infection in 3 age categories of dogs (females and males combined): young dogs (≤12 months of age); mature dogs (13-83 months); and old dogs >83 months. Prevalences of infection for Ancylostoma caninum and Toxocara canis were significantly (P<0.005) higher in young dogs, whereas there was no significant difference (P>0.05) in prevalence by age category for Trichuris vulpis. Dogs exhibiting clinical signs were no more likely to harbor intestinal nematodes than dogs that were asymptomatic. Additionally, dogs receiving heartworm treatment were significantly less likely to be parasitized than dogs receiving no heartworm prophylaxis.

The large reservoir of antibiotic resistant bacteria in raw and treated water supplies is a matter of public health concern. Currently, the National Antimicrobial Resistance Monitoring Systems, a collaborative effort of the Centers for Disease Control, the US Department of Agriculture, and the US Food and Drug Administration, does not monitor antimicrobial resistance in surface waters. Given the serious nature of antibiotic resistance in clinical settings, and the likelihood that antibiotic resistant bacteria can be transmitted to humans from large environmental reservoirs via drinking water, explanations for the distribution of antibiotic resistant bacteria and tools for studying this distribution must be found. Here we focus on mathematical modeling of cultivable bacteria in a river, which will be used to study the distribution of antibiotic resistant bacteria in the environment. We consider both antibiotic resistant and non-antibiotic resistant bacteria in the model, and, taking into account the strong correlation between land use and antibiotic resistant bacteria in rivers, we include a function for the influx of bacteria into the river from the shore. We simulate the model for two different time scales and show that if there is too many bacteria from the land entering the river, the river entirely fills with antibiotic resistant bacteria, while less frequent influxes allows time for the bacteria to lose the antibiotic resistant gene. This mathematically verifies that reduction in antibiotic use near the banks of rivers, will reduce the counts of antibiotic resistant bacteria in rivers.

Abstract : This report summarizes research conducted from 04/01/01 to 08/31/04 with support from the US Army Research Office DoD-EPSCoR program. The goal of the research was to study the biodegradation of chloroethenes under serial anaerobic/aerobic conditions. In the system used water flowed through a contact chamber containing chloroethenes. Contaminated water was then pumped through a sediment column. From the sediment column the water flowed into an aerated chamber. Chloroethenes concentrations were determined in samples from the contact chamber the sediment column and the aerobic chamber. We tested means for establishing anaerobiosis in the sediment column two sparging gas mixtures addition of lactate as a growth substrate control of conditions in the aerobic chamber and the presence of a hydrocarbon fuel mixture as a co-contaminant. Results indicated that a N2:H2 gas mixture stimulated POE degradation. We also found that the addition of exogenous lactic acid (2 mM) and the presence of petroleum hydrocarbons in reactor feed water resulted in 99.6% removal of PCE and 99.2% reduction in the total molar concentration of chloroethenes. In the last year of the research we established mixed microbial cultures in which vinyl chloride disappearance was concomitant with an increase in chloride concentration and biomass accumulation.

ABSTRACT Pseudomonas pseudoalcaligenes JS45 grows on nitrobenzene by a partially reductive pathway in which the intermediate hydroxylaminobenzene is enzymatically rearranged to 2-aminophenol by hydroxylaminobenzene mutase (HAB mutase). The properties of the enzyme, the reaction mechanism, and the evolutionary origin of the gene(s) encoding the enzyme are unknown. In this study, two open reading frames ( habA and habB ), each encoding an HAB mutase enzyme, were cloned from a P. pseudoalcaligenes JS45 genomic library and sequenced. The open reading frames encoding HabA and HabB are separated by 2.5 kb and are divergently transcribed. The deduced amino acid sequences of HabA and HabB are 44% identical. The HAB mutase specific activities in crude extracts of Escherichia coli clones synthesizing either HabA or HabB were similar to the specific activities of extracts of strain JS45 grown on nitrobenzene. HAB mutase activity in E. coli extracts containing HabB withstood heating at 85°C for 10 min, but extracts containing HabA were inactivated when they were heated at temperatures above 60°C. HAB mutase activity in extracts of P. pseudoalcaligenes JS45 grown on nitrobenzene exhibited intermediate temperature stability. Although both the habA gene and the habB gene conferred HAB mutase activity when they were separately cloned and expressed in E. coli , reverse transcriptase PCR analysis indicated that only habA is transcribed in P. pseudoalcaligenes JS45. A mutant strain derived from strain JS45 in which the habA gene was disrupted was unable to grow on nitrobenzene, which provided physiological evidence that HabA is involved in the degradation of nitrobenzene. A strain in which habB was disrupted grew on nitrobenzene. Gene Rv3078 of Mycobacterium tuberculosis H37Rv encodes a protein whose deduced amino acid sequence is 52% identical to the HabB amino acid sequence. E. coli containing M. tuberculosis gene Rv3078 cloned into pUC18 exhibited low levels of HAB mutase activity. Sequences that exhibit similarity to transposable element sequences are present between habA and habB , as well as downstream of habB , which suggests that horizontal gene transfer resulted in acquisition of one or both of the hab genes.

Pseudomonas pseudoalcaligenes JS45 grows on nitrobenzene as a sole source of carbon, nitrogen, and energy. The catabolic pathway involves reduction to hydroxylaminobenzene followed by rearrangement to o-amino-phenol and ring fission (S. F. Nishino and J. C. Spain, Appl. Environ. Microbiol. 59:2520, 1993). A nitrobenzene-inducible, oxygen-insensitive nitroreductase was purified from extracts of JS45 by ammonium sulfate precipitation followed by anion-exchange and gel filtration chromatography. A single 33-kDa polypeptide was detected by denaturing gel electrophoresis. The size of the native protein was estimated to be 30 kDa by gel filtration. The enzyme is a flavoprotein with a tightly bound flavin mononucleotide cofactor in a ratio of 2 mol of flavin per mol of protein. The Km for nitrobenzene is 5 microM at an initial NADPH concentration of 0.5 mM. The Km for NADPH at an initial nitrobenzene concentration of 0.1 mM is 183 microM. Nitrosobenzene was not detected as an intermediate of nitrobenzene reduction, but nitrosobenzene is a substrate for the enzyme, and the specific activity for nitrosobenzene is higher than that for nitrobenzene. These results suggest that nitrosobenzene is formed but is immediately reduced to hydroxylaminobenzene. Hydroxylaminobenzene was the only product detected after incubation of the purified enzyme with nitrobenzene and NADPH. Hydroxylaminobenzene does not serve as a substrate for further reduction by this enzyme. The products and intermediates are consistent with two two-electron reductions of the parent compound. Furthermore, the low Km and the inducible control of enzyme synthesis suggest that nitrobenzene is the physiological substrate for this enzyme.

DNA cloned from the marine bacterium Vibrio vulnificus into Escherichia coli HB101 can hydrolyze chitin oligomer analogs in the recipient. The nucleotide sequence of the cloned DNA was determined and a single long open reading frame of 2541 base pairs (initiation codon through termination codon) was found. The nucleotide sequence predicts a gene product of 847 amino acids and a molecular mass of 94.3 kDa. In vitro transcription and translation analyses indicated a single protein of 94 kDa encoded by the cloned DNA. The gene product hydrolyzes methylumbelliferyl beta-D conjugates of chitotriose, chitobiose, N-acetylglucosamine, and N-acetylgalactosamine and has, therefore, been termed a beta-N-acetylhexosaminidase. The predicted protein shares a high degree of sequence similarity with the chitobiase of Vibrio harveyi and limited similarity with the alpha chain of human beta-hexosaminidase. Cluster analyses suggest a common evolutionary ancestor for all known hexosaminidase enzymes, with no detectable relationship to known chitinases.

The entire nucleotide sequence of a 23S rRNA gene from the brown alga Pylaiella littoralis (L.) Kjellm has been determined. The predicted length of the 23S rRNA is 2948 nucleotides, including the 4.5S rRNA-like region at the 3' end of the molecule. The putative transcript has been folded into a secondary structure by comparison to existing structure models, and the predicted helical regions were inspected by identifying compensatory downstream base changes. The 23S rRNA secondary structure presented here has features that are unique to P. littoralis (no other chromophyte or red algal 23S rRNA sequences are yet available), but has none of the features specific to the chloroplast rRNAs of green plants and green algae. The Pylaiella sequence was aligned with analogous plastidial and eubacterial gene sequences, and the alignment was used to construct a phylogenetic tree. The plastidial sequences formed a coherent cluster closely associated with the 23S rRNA of the cyanobacterium Anacystis nidulans. Within the plastid group, the P. littoralis sequence was most closely related to that of Euglena gracilis confirming earlier analyses based upon 16S rRNA sequences.

An overview of recent molecular analyses regarding origins of plastids in algal lineages is presented. Since different phylogenetic analyses can yield contradictory views of algal plastid origins, we have examined the effect of two distance measurement methods and two distance matrix tree-building methods upon topologies for the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit nucleotide sequence data set. These results are contrasted to those from bootstrap parsimony analysis of nucleotide sequence data subsets. It is shown that the phylogenetic information contained within nucleotide sequences for the chloroplastencoded gene for the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, integral to photosynthesis, indicates an independent origin for this plastid gene in different plant taxa. This finding is contrasted to contrary results derived from 16S rRNA sequences. Possible explanations for discrepancies observed for these two different molecules are put forth. Other molecular sequence data which address questions of early plant evolution and the eubacterial origins of algal organelles are discussed.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.

The algae have long been classified into three main groups based on their plastidial pigments (Christensen, 1964). In this scheme all three groups have the same primary pigment, chlorophyll a, and the different taxa are defined by their secondary pigments; the green algae having chlorophyll b, the red algae having phycobilins, and the chromophytes (which include the brown algae), having chlorophyll c. Today, plastidial characters are still viewed as important in defining the relationships among the algae, and between the algae and higher plants. In this light, some of the most intriguing questions about the chromophytes concern the different morphologies, origins, and evolutionary histories of their plastids. One way to study these organelles is to examine them at the genomic level and to compare both the gross organization and fine structure of their genes with those of other plastids (not only green plastids) and prokaryotes (not only cyanobacteria). For this purpose, we have begun an extensive investigation of the plastidial genome of a simple brown alga, Pylaiella littoralis (L.) Kjellm. Herein we describe progress to date in characterizing the ribosomal operons, genes and pseudogenes found on this genome, and we discuss the phylogenetic implications of these results.

As part of an interdisciplinary study of hydrothermal vents on the Endeavour Segment of the Juan de Fuca Ridge, we used the submersible ALVIN to collect 57 fluid samples in titanium syringes and Go Flo Niskin bottles from 17 different hot vents (smokers and flanges) and their environs for the purpose of extracting particulate DNA. The relative purity of the vent fluids collected was determined by Mg content as an indicator of seawater entrainment. Particulate material concentrated from these samples was lysed enzymatically (enz) and by a combination of enzyme and French press treatment (fp). Concentrations of partially purified DNA recovered from these lysates were determined spectrofluorometrically by using the dye Hoechst 33258. Ambient seawater surrounding the vents was found to contain low DNA concentrations, 0.18 to 0.32 ng of DNA per ml ( n = 4; mean enz = 0.23 ± 0.05; mean fp = 0.26 ± 0.05), while low-temperature vent samples yielded significantly higher concentrations of 0.37 to 2.12 ng of DNA per ml ( n = 4; mean enz = 0.97 ± 0.68; mean fp = 1.05 ± 0.54). Although DNA recovery values from superheated (210 to 345°C) flange samples (mean enz = 0.14 ± 0.10; mean fp = 0.12 ± 0.14) were not significantly different from ambient seawater values, most of the superheated (174 to 357°C) smoker fluid samples contained particulate DNA in concentrations too high to be attributable to entrained seawater. Detailed sampling at one smoker site demonstrated not only the existence of significant levels of particulate DNA in the superheated smoker fluids but also the presence of an elevated microbial population in the buoyant plume 20 to 100 m above the smoker. These results underscore the heterogeneity of smoker environments within a given hydrothermal vent field and indicate that microorganisms exist in some superheated fluids.

Rates of degradation of radiolabeled hydrocarbons and incidence of bacterial plasmid DNA were investigated in sediment samples collected from the Campeche Bank, Gulf of Mexico, site of an offshore oil field containing several petroleum platforms. Overall rates of mineralization of [ 14 C]hexadecane and [ 14 C]phenanthrene measured for sediments were negligible; <1% of the substrate was converted to CO 2 in all cases. Low mineralization rates are ascribed to nutrient limitations and to lack of adaptation by microbial communities to hydrocarbon contaminants. Plasmid frequency data for sediment bacteria similarly showed no correlation with proximity to the oil field, but, instead, showed correlation with water column depth at each sampling site. Significant differences between sites were observed for proportion of isolates carrying single or multiple plasmids and mean number of plasmids per isolate, each of which increased as a function of depth.

Evidence of plasmid selection and genetic exchange in natural aquatic environments, including the ocean, includes: (a) high incidence of plasmid-containing strains in polluted areas; (b) presence of free DNA in natural environments; (c) co-existence of identical plasmids in different cohabiting strains; and (d) data from in situ plasmid transfer experiments. Current research in our laboratory regarding plasmid mobility in the ocean centers around viable but nonculturable bacteria, cloning of ecologically significant genes, genetic exchange between deep sea bacteria under pressure at low temperature, and development of 16S ribosomal DNA probes for tracking genetically engineered microorganisms that are released to natural environments.

To initiate study of the genetic control of chitinolytic activity in vibrios, the chitobiase gene was isolated by cloning chromosomal DNA prepared from Vibrio vulnificus. Chimeric plasmids were constructed from Sau3A I partial digests of chromosomal DNA by ligating 5 to 15-kilobase fragments into the BamHI site, i.e., in the Tcr gene, of pBR322 (Amr Tcr). The resulting plasmids were transformed into Escherichia coli DH1. Chitobiase activity of the insert-bearing clones was detected by using a chromogenic substrate, p-nitrophenyl-N-acetyl-beta, D-glucosaminide, and confirmed by the appearance of a fluorescent end product from the hydrolysis of 4-methylumbelliferyl-beta,D-N-N'-diacetylchitobiose. Endochitinase activity was demonstrated by liberation of water-soluble products produced by the degradation of [3H]chitin. Transformation of E. coli Y10R (lacY) with plasmids from chitinase-positive clones restored the lactose-positive phenotype, suggesting the presence of a permease associated with chitinase activity. Physical mapping of plasmids containing the chitinase determinants indicate that transcription of these genes in E. coli may be initiated at a V. vulnificus promoter.

Bacterial strains capable of degrading phenanthrene have been isolated from hydrocarbon-polluted sites in Chesapeake Bay using phenanthrene-overlaid agar plates. The isolates exhibited adherence to, and emulsification of, selected hydrocarbons. Two of the isolates, Flavobacterium sp. SB23 and an enteric, S53, were found to harbor plasmids. SB23 carried a 34 Mdal plasmid and S53 carried two plasmids of 34·3 Mdal and 2·9 Mdal molecular weight. Results of hydrocarbon adherence/emulsification tests indicated that the plasmid bearing strain SB23 exhibited minimal adherence to n-octane and n-hexadecane and strong emulsification of cyclohexylbenzene and 1, 2, 3, 4-tetrahydronaphthalene (tetralin), whereas the cured derivative lost ability to clear phenanthrene and emulsify the aromatic hydrocarbons. Upon transformation of the cured derivative with the 34 Mdal plasmid, the ability to clear phenanthrene was regained. A derivative of strain S53, cured of the 2·9 Mdal plasmid, lost the ability to emulsify tetralin but exhibited minimal adherence to the hydrocarbons. Radiorespirometric experiments, employing [9-14 C]-phenanthrene, confirmed the degradative ability of strain SB23.

The high density missile fuels RJ-5 and JP-9 resisted biodegradation when incubated with water/sediment suspensions collected from aquatic habitats. RJ-5 and JP-9 were not toxic to the microbial communities at concentrations of 400 mg per liter, but RJ-5 was toxic to Mysidopsis bahia in 96-hour acute tests (LC50 88 μg/l).