Polyamines, small organic polycations, are essential for life, and cells maintain polyamines via synthesis and uptake. Recently, we identified Hol1 as the high-affinity polyamine transporter in Saccharomyces cerevisiae. Hol1 is a conserved fungal-specific transporter with Candida albicans having two HOL1 homologs (orf19.4889 and orf19.2991) and no identifiable HOL1 homolog in mammals. Deleting both HOL1 homologs blocked efficient polyamine uptake in C. albicans, establishing Hol1 as the high-affinity polyamine transporter in C. albicans. Combined deletion of HOL1 and SPE1, encoding ornithine decarboxylase (ODC), the first enzyme in the polyamine synthesis pathway, resulted in a severe growth defect, confirming the importance of polyamines for C. albicans growth. In addition, cells lacking HOL1 and SPE1 failed to form hyphae when exposed to serum, suggesting a role for polyamines in C. albicans virulence. In accord with this hypothesis, in the mouse model of disseminated candidiasis, the homozygous spe1Δ mutant, like the WT strain, readily colonized the kidney and all mice died within 2 weeks following intravenous inoculation. In contrast, the homozygous spe1Δ hol1Δ mutant was avirulent with all mice surviving the infection. Consistent with these genetic results, simultaneously treating WT cells with l-α-difluoromethylornithine, an irreversible inhibitor of ODC, to inhibit polyamine biosynthesis and with the polyamine transport inhibitor Trimer44NMe to inhibit uptake substantially impaired C. albicans growth and hyphal differentiation. We conclude that polyamines are critical for C. albicans virulence and could be of potential therapeutic interest via combined targeting of polyamine synthesis and the fungal-specific polyamine transporter Hol1.IMPORTANCEFungal infections are a growing concern, and a predominant human opportunistic pathogen is the fungus Candida albicans. Current antifungals commonly target cell wall and cell membrane biosynthesis or integrity; however, resistant strains are emerging. Polyamines are essential small organic cations that cells synthesize and import. We identify polyamines as a possible new target for antifungal therapies. The Hol1 polyamine transporter is unique to fungi and is distinct from mammalian transporters, so it is an intriguing antifungal target. As proof of concept, we show that combined knock-out of Hol1 and a polyamine biosynthesis gene impairs C. albicans growth and hyphal differentiation in culture and virulence in mouse infection assays. Moreover, we identify a polyamine analog that robustly inhibits Hol1 function, providing insights into potential new therapeutics.

Diphthamide (DPH), a conserved amino acid modification on eukaryotic translation elongation factor eEF2, is synthesized via a complex, multi-enzyme pathway. While DPH is non-essential for cell viability and its function has not been resolved, diphtheria and other bacterial toxins ADP-ribosylate DPH to inhibit translation. Characterizing Saccharomyces cerevisiae mutants that lack DPH or show synthetic growth defects in the absence of DPH, we show that loss of DPH increases resistance to the fungal translation inhibitor sordarin and increases -1 ribosomal frameshifting at non-programmed sites during normal translation elongation and at viral programmed frameshifting sites. Ribosome profiling of yeast and mammalian cells lacking DPH reveals increased ribosomal drop-off during elongation, and removal of out-of-frame stop codons restores ribosomal processivity on the ultralong yeast MDN1 mRNA. Finally, we show that ADP-ribosylation of DPH impairs the productive binding of eEF2 to elongating ribosomes. Our results reveal that loss of DPH impairs the fidelity of translocation during translation elongation resulting in increased rates of ribosomal frameshifting throughout elongation and leading to premature termination at out-of-frame stop codons. We propose that the costly, yet non-essential, DPH modification has been conserved through evolution to maintain translational fidelity despite being a target for inactivation by bacterial toxins.

Translation start site selection in eukaryotes is influenced by context nucleotides flanking the AUG codon and by levels of the eukaryotic translation initiation factors eIF1 and eIF5. In a search of mammalian genes, we identified five homeobox (Hox) gene paralogs initiated by AUG codons in conserved suboptimal context as well as 13 Hox genes that contain evolutionarily conserved upstream open reading frames (uORFs) that initiate at AUG codons in poor sequence context. An analysis of published cap analysis of gene expression sequencing (CAGE-seq) data and generated CAGE-seq data for messenger RNAs (mRNAs) from mouse somites revealed that the 5' leaders of Hox mRNAs of interest contain conserved uORFs, are generally much shorter than reported, and lack previously proposed internal ribosome entry site elements. We show that the conserved uORFs inhibit Hox reporter expression and that altering the stringency of start codon selection by overexpressing eIF1 or eIF5 modulates the expression of Hox reporters. We also show that modifying ribosome homeostasis by depleting a large ribosomal subunit protein or treating cells with sublethal concentrations of puromycin leads to lower stringency of start codon selection. Thus, altering global translation can confer gene-specific effects through altered start codon selection stringency.

Polyamines, small organic polycations, are essential for cell viability, and their physiological levels are homeostatically maintained by post-transcriptional regulation of key biosynthetic enzymes. In addition to de novo synthesis, cells can also take up polyamines; however, identifying cellular polyamine transporters has been challenging. Here we show that the S. cerevisiae HOL1 mRNA is under translational control by polyamines, and we reveal that the encoded membrane transporter Hol1 is a high-affinity polyamine transporter and is required for yeast growth under limiting polyamine conditions. Moreover, we show that polyamine inhibition of the translation factor eIF5A impairs translation termination at a Pro-Ser-stop motif in a conserved upstream open reading frame on the HOL1 mRNA to repress Hol1 synthesis under conditions of elevated polyamines. Our findings reveal that polyamine transport, like polyamine biosynthesis, is under translational autoregulation by polyamines in yeast, highlighting the extensive control cells impose on polyamine levels.

Translation initiation is typically restricted to AUG codons, and scanning eukaryotic ribosomes inefficiently recognize near-cognate codons. We show that queuing of scanning ribosomes behind a paused elongating ribosome promotes initiation at upstream weak start sites. Ribosomal profiling reveals polyamine-dependent pausing of elongating ribosomes on a conserved Pro-Pro-Trp (PPW) motif in an inhibitory non-AUG-initiated upstream conserved coding region (uCC) of the antizyme inhibitor 1 (AZIN1) mRNA, encoding a regulator of cellular polyamine synthesis. Mutation of the PPW motif impairs initiation at the uCC's upstream near-cognate AUU start site and derepresses AZIN1 synthesis, whereas substitution of alternate elongation pause sequences restores uCC translation. Impairing ribosome loading reduces uCC translation and paradoxically derepresses AZIN1 synthesis. Finally, we identify the translation factor eIF5A as a sensor and effector for polyamine control of uCC translation. We propose that stalling of elongating ribosomes triggers queuing of scanning ribosomes and promotes initiation by positioning a ribosome near the start codon.

Phosphorylation of eukaryotic translation initiation factor 2α (eIF2α) by eIF2α family kinases is a conserved mechanism to limit protein synthesis under specific stress conditions. The baculovirus-encoded protein PK2 inhibits eIF2α family kinases in vivo, thereby increasing viral fitness. However, the precise mechanism by which PK2 inhibits eIF2α kinase function remains an enigma. Here, we probed the mechanism by which PK2 inhibits the model eIF2α kinase human RNA-dependent protein kinase (PKR) as well as native insect eIF2α kinases. Although PK2 structurally mimics the C-lobe of a protein kinase domain and possesses the required docking infrastructure to bind eIF2α, we show that PK2 directly binds the kinase domain of PKR (PKR(KD)) but not eIF2α. The PKR(KD)-PK2 interaction requires a 22-residue N-terminal extension preceding the globular PK2 body that we term the "eIF2α kinase C-lobe mimic" (EKCM) domain. The functional insufficiency of the N-terminal extension of PK2 implicates a role for the adjacent EKCM domain in binding and inhibiting PKR. Using a genetic screen in yeast, we isolated PK2-activating mutations that cluster to a surface of the EKCM domain that in bona fide protein kinases forms the catalytic cleft through sandwiching interactions with a kinase N-lobe. Interaction assays revealed that PK2 associates with the N- but not the C-lobe of PKR(KD). We propose an inhibitory model whereby PK2 engages the N-lobe of an eIF2α kinase domain to create a nonfunctional pseudokinase domain complex, possibly through a lobe-swapping mechanism. Finally, we show that PK2 enhances baculovirus fitness in insect hosts by targeting the endogenous insect heme-regulated inhibitor (HRI)-like eIF2α kinase.

James P. Kennett, Douglas J. Kennett, Brendan J. Culleton, J. Emili Aura Tortosa, James L. Bischoff, Ted E. Bunch, I. Randolph Daniel Jr., Jon M. Erlandson, David Ferraro, Richard B. Firestone, Albert C. Goodyear, Isabel Israde-Alcántara, John R. Johnson, Jesús F. Jordá Pardo, David R. Kimbel, Malcolm A. LeCompte, Neal H. Lopinot, William C. Mahaney, Andrew M. T. Moore, Christopher R. Moore, Jack H. Ray, Thomas W. Stafford Jr., Kenneth Barnett Tankersley, James H. Wittke, Wendy S. Wolbach, and Allen West

As part of the mammalian cell innate immune response, the double-stranded RNA activated protein kinase PKR phosphorylates the translation initiation factor eIF2α to inhibit protein synthesis and thus block viral replication. Poxviruses including vaccinia and smallpox viruses express PKR inhibitors such as the vaccinia virus K3L protein that resembles the N-terminal substrate-targeting domain of eIF2α. Whereas high-level expression of human PKR was toxic in yeast, this growth inhibition was suppressed by coexpression of the K3L protein. We used this yeast assay to screen for PKR mutants that are resistant to K3L inhibition, and we identified 12 mutations mapping to the C-terminal lobe of the PKR kinase domain. The PKR mutations specifically conferred resistance to the K3L protein both in yeast and in vitro. Consistently, the PKR-D486V mutation led to nearly a 15-fold decrease in K3L binding affinity yet did not impair eIF2α phosphorylation. Our results support the identification of the eIF2α-binding site on an extensive face of the C-terminal lobe of the kinase domain, and they indicate that subtle changes to the PKR kinase domain can drastically impact pseudosubstrate inhibition while leaving substrate phosphorylation intact. We propose that these paradoxical effects of the PKR mutations on pseudosubstrate vs. substrate interactions reflect differences between the rigid K3L protein and the plastic nature of eIF2α around the Ser-51 phosphorylation site.

Ire1 is an ancient transmembrane sensor of ER stress with dual protein kinase and ribonuclease activities. In response to ER stress, Ire1 catalyzes the splicing of target mRNAs in a spliceosome-independent manner. We have determined the crystal structure of the dual catalytic region of Ire1at 2.4 Å resolution, revealing the fusion of a domain, which we term the KEN domain, to the protein kinase domain. Dimerization of the kinase domain composes a large catalytic surface on the KEN domain which carries out ribonuclease function. We further show that signal induced trans-autophosphorylation of the kinase domain permits unfettered binding of nucleotide, which in turn promotes dimerization to compose the ribonuclease active site. Comparison of Ire1 to a topologically disparate ribonuclease reveals the convergent evolution of their catalytic mechanism. These findings provide a basis for understanding the mechanism of action of RNaseL and other pseudokinases, which represent 10% of the human kinome.

Selection of the AUG start codon for translation in eukaryotes is governed by codon-anticodon interactions between the initiator Met-tRNA(i)(Met) and the mRNA. Translation initiation factor 2 (eIF2) binds Met-tRNA(i)(Met) to the 40S ribosomal subunit, and previous studies identified Sui- mutations in eIF2 that enhanced initiation from a noncanonical UUG codon, presumably by impairing Met-tRNA(i)(Met) binding. Consistently, an eIF2 gamma-N135D GTP-binding domain mutation impairs Met-tRNA(i)(Met) binding and causes a Sui(-) phenotype. Intragenic A208V and A382V suppressor mutations restore Met-tRNA(i)(Met) binding affinity and cell growth; however, only A208V suppresses the Sui(-) phenotype associated with the eIF2 gamma-N135D mutation. An eIF2 gamma-A219T mutation impairs Met-tRNA(i)(Met) binding but unexpectedly enhances the fidelity of initiation, suppressing the Sui(-) phenotype associated with the eIF2 gamma-N135D, A382V mutant. Overexpression of eIF1, which is thought to monitor codon-anticodon interactions during translation initiation, likewise suppresses the Sui(-) phenotype of the eIF2 gamma mutants. We propose that structural alterations in eIF2 gamma subtly alter the conformation of Met-tRNA(i)(Met) on the 40S subunit and thereby affect the fidelity of start codon recognition independent of Met-tRNA(i)(Met) binding affinity.

The protein kinases PKR, GCN2, and PERK phosphorylate translation initiation factor eIF2 alpha to regulate general and gene-specific protein synthesis under various cellular stress conditions. Recent x-ray crystallographic structures of PKR and GCN2 revealed distinct dimeric configurations of the kinase domains. Whereas PKR kinase domains dimerized in a back-to-back and parallel orientation, the GCN2 kinase domains displayed an antiparallel orientation. The dimerization interfaces on PKR and GCN2 were localized to overlapping surfaces on the N-terminal lobes of the kinase domains but utilized different intermolecular contacts. A key feature of the PKR dimerization interface is a salt bridge interaction between Arg(262) from one protomer and Asp(266) from the second protomer. Interestingly, these two residues are conserved in all eIF2 alpha kinases, although in the GCN2 structure, the two residues are too remote to interact. To test the importance of this potential salt bridge interaction in PKR, GCN2, and PERK, the residues constituting the salt bridge were mutated either independently or together to residues with the opposite charge. Single mutations of the Asp (or Glu) and Arg residues blocked kinase function both in yeast cells and in vitro. However, for all three kinases, the double mutation designed to restore the salt bridge interaction with opposite polarity resulted in a functional kinase. Thus, the salt bridge interaction and dimer interface observed in the PKR structure is critical for the activity of all three eIF2 alpha kinases. These results are consistent with the notion that the PKR structure represents the active state of the eIF2 alpha kinase domain, whereas the GCN2 structure may represent an inactive state of the kinase.

The antiviral protein kinase PKR inhibits protein synthesis by phosphorylating the translation initiation factor eIF2alpha on Ser51. Binding of double-stranded RNA to the regulatory domains of PKR promotes dimerization, autophosphorylation, and the functional activation of the kinase. Herein, we identify mutations that activate PKR in the absence of its regulatory domains and map the mutations to a recently identified dimerization surface on the kinase catalytic domain. Mutations of other residues on this surface block PKR autophosphorylation and eIF2alpha phosphorylation, while mutating Thr446, an autophosphorylation site within the catalytic-domain activation segment, impairs eIF2alpha phosphorylation and viral pseudosubstrate binding. Mutational analysis of catalytic-domain residues preferentially conserved in the eIF2alpha kinase family identifies helix alphaG as critical for the specific recognition of eIF2alpha. We propose an ordered mechanism of PKR activation in which catalytic-domain dimerization triggers Thr446 autophosphorylation and specific eIF2alpha substrate recognition.

ABSTRACT Four stress-responsive protein kinases, including GCN2 and PKR, phosphorylate eukaryotic translation initiation factor 2α (eIF2α) on Ser51 to regulate general and gene-specific protein synthesis. Phosphorylated eIF2 is an inhibitor of its guanine nucleotide exchange factor, eIF2B. Mutations that block translational regulation were isolated throughout the N-terminal OB-fold domain in Saccharomyces cerevisiae eIF2α, including those at residues flanking Ser51 and around 20 Å away in the conserved motif K79GYID83. Any mutation at Glu49 or Asp83 blocked translational regulation; however, only a subset of these mutations impaired Ser51 phosphorylation. Substitution of Ala for Asp83 eliminated phosphorylation by GCN2 and PKR both in vivo and in vitro, establishing the critical contributions of remote residues to kinase-substrate recognition. In contrast, mutations that blocked translational regulation but not Ser51 phosphorylation impaired the binding of eIF2B to phosphorylated eIF2α. Thus, two structurally distinct effectors of eIF2 function, eIF2α kinases and eIF2B, have evolved to recognize the same surface and overlapping determinants on eIF2α.

The x-ray structure of the γ-subunit of the heterotrimeric translation initiation factor eIF2 has been determined to 2.4-Å resolution. eIF2 is a GTPase that delivers the initiator Met-tRNA to the P site on the small ribosomal subunit during a rate-limiting initiation step in translation. The structure of eIF2γ closely resembles that of EF1A·GTP, consisting of an N-terminal G domain followed by two β-barrels arranged in a closed configuration with domain II packed against the G domain in the vicinity of the Switch regions. The G domain of eIF2γ has an unusual zinc ribbon motif, not previously found in other GTPases. Structure-based site-directed mutagenesis was used to identify two adjacent features on the surface of eIF2γ that bind the α-subunit and Met-tRNAiMet, respectively. These structural, biochemical, and genetic results provide new insights into eIF2 ternary complex assembly. The x-ray structure of the γ-subunit of the heterotrimeric translation initiation factor eIF2 has been determined to 2.4-Å resolution. eIF2 is a GTPase that delivers the initiator Met-tRNA to the P site on the small ribosomal subunit during a rate-limiting initiation step in translation. The structure of eIF2γ closely resembles that of EF1A·GTP, consisting of an N-terminal G domain followed by two β-barrels arranged in a closed configuration with domain II packed against the G domain in the vicinity of the Switch regions. The G domain of eIF2γ has an unusual zinc ribbon motif, not previously found in other GTPases. Structure-based site-directed mutagenesis was used to identify two adjacent features on the surface of eIF2γ that bind the α-subunit and Met-tRNAiMet, respectively. These structural, biochemical, and genetic results provide new insights into eIF2 ternary complex assembly. Translation initiation involves assembly of a large protein-RNA complex at the initiation codon of a mRNA in three main steps: binding of initiator Met-tRNA and mRNA with associated factors to the small ribosomal subunit, pairing of the anticodon of Met-tRNAiMet with the AUG start codon, and joining of the two ribosomal subunits to form the 80 S initiation complex. In eukaryotes, this process requires at least twelve distinct translation initiation factors (eIFs) 1The abbreviations used are: eIF, eukaryotic initiation factor; r.m.s.d., root mean square deviation; GST, glutathione S-transferase; SAD, single wavelength anomalous dispersion. and hydrolysis of two molecules of GTP (reviewed in Ref. 1Roll-Mecak A. Shin B.S. Dever T.E. Burley S.K. Trends Biochem. Sci. 2001; 26: 705-709Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). Translation initiation factor eIF2 is a heterotrimeric GTPase that delivers the Met-tRNAiMet to the small ribosomal subunit as part of a ternary complex with GTP. Pairing between the anticodon of the Met-tRNAiMet and the AUG start codon triggers hydrolysis of GTP by eIF2 and eIF2·GDP is released, leaving Met-tRNAiMet bound in the P site. eIF2·GDP cannot bind Met-tRNAiMet and is converted to eIF2·GTP by the heteropentameric exchange factor eIF2B (reviewed in Ref. 2Hinnebusch A.G. Sonenberg N. Hershey J.W.B. Mathews M.B. Translational Control of Gene Expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2000: 185-245Google Scholar). eIF2 is a stable complex of three subunits (α, β, and γ), each essential for viability in yeast. Since their discovery, highly conserved eIF2 subunits have been identified in all eukaryotes (reviewed in Ref. 2Hinnebusch A.G. Sonenberg N. Hershey J.W.B. Mathews M.B. Translational Control of Gene Expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2000: 185-245Google Scholar) and also archaebacteria (3Kyrpides N.C. Woese C.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3726-3730Crossref PubMed Scopus (95) Google Scholar). Biochemical and genetic analyses have demonstrated that the three subunits have distinct activities during translation initiation. The γ-subunit binds GTP and Met-tRNAiMet (reviewed in Ref. 4Trachsel H. Hershey J.W.B. Mathews M.B. Sonenberg N. Translational Control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1996: 113-138Google Scholar). GTP hydrolysis by the eIF2 ternary complex bound to the 40 S ribosomal subunit is stimulated by eIF5, which interacts with eIF2β (5Das S. Maiti T. Das K. Maitra U. J. Biol. Chem. 1997; 272: 31712-31718Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar). The β-subunit also interacts with Met-tRNAiMet and has been reported to bind mRNA (6Laurino J.P. Thompson G.M. Pacheco E. Castilho B.A. Mol. Cell. Biol. 1999; 19: 173-181Crossref PubMed Google Scholar). Given the pivotal role eIF2 plays in eukaryotic translation initiation, it is not surprising that it represents an important target for regulation. In response to various environmental stressors (viral infection, amino acid starvation, heme deficiency, ER stress etc), the α-subunit is phosphorylated on Ser51, abolishing translation initiation by preventing eIF2B catalyzed GDP-GTP exchange. The γ-subunit of eIF2 belongs to the superfamily of GTP-binding proteins and is most closely related to the translation elongation factor eEF1A and its eubacterial counterpart EF1A (previously EF-Tu), which form ternary complexes with GTP and aminoacylated elongator tRNAs. eIF2γ sequences are conserved from archaebacteria to mammals (pairwise amino acid sequence identities, 43-59%; Fig. 1), suggesting that they share a common three-dimensional structure (7Sander C. Schneider R. Proteins. 1991; 9: 56-68Crossref PubMed Scopus (1489) Google Scholar). The highest sequence conservation occurs within the G domain (pairwise identities, 46-69%). Mutations of residues implicated in GTP binding are lethal in the yeast Saccharomyces cerevisiae (8Erickson F.L. Hannig E.M. EMBO J. 1996; 15: 6311-6320Crossref PubMed Scopus (84) Google Scholar), confirming the functional importance of the G domain and, by inference, GTP hydrolysis in translation initiation. Here we present the x-ray structure of Methanococcus jannaschii eIF2γ at 2.4-Å resolution. Apo eIF2γ consists of three domains structurally homologous to those in EF1A and arranged in a closed configuration, similar to that seen in EF1A·GTP and not EF1A·GDP. A similar domain arrangement was observed in the structure of eIF2γ from Pyrococcus abyssi (9Schmitt E. Blanquet S. Mechulam Y. EMBO J. 2002; 21: 1821-1832Crossref PubMed Scopus (89) Google Scholar). Our structure of an archaeal eIF2γ from a different organism and in a different space group shows that the closed configuration is not due to crystal packing effects and confirms that domain coupling differs between eIF2γ and EF1A, despite high sequence identity. Interestingly, comparison of our structure with the published one reveals that domains II and III are rotated by 14° with respect to the G domain revealing a hinge point around the Switch 2 region of the G domain, around which domains II and III move as a rigid body. In addition, using structure-based mutational analyses combined with genetic and biochemical experiments we mapped on eIF2γ conserved and adjacent binding sites for the 3′-end of Met-tRNAiMet and eIF2α, providing new insights into the mechanism of ternary complex assembly. Protein Preparation and Crystallization—A pUC18 derivative (AMJBZ12) containing M. jannaschii genomic DNA encoding eIF2γ was obtained from American Type Culture Collection (ATCC), Inc. (Manassas, VA). DNA corresponding to residues 35-437 of M. jannaschii eIF2γ was amplified by PCR using primers designed to introduce a 5′-BamHI site and a 3′-EcoRI site. Following digestion the DNA was inserted into the pGEX-6P-1 (Amersham Biosciences) expression vector generating the plasmid pC1399. The N-terminal 35 residues of eIF2γ are not conserved and the corresponding region in yeast was shown to be dispensable for function (10Erickson F.L. Harding L.D. Dorris D.R. Hannig E.M. Mol. Gen. Genet. 1997; 253: 711-719Crossref PubMed Scopus (19) Google Scholar), indicating that the critical functional domains of eIF2γ are present in our construct. The resulting N-terminal glutathione S-transferase (GST) fusion protein was expressed in Escherichia coli strain BL21(DE3). Cells were grown to an OD600 of ∼0.8 in minimal medium containing 0.2 mg/ml ampicillin at 37 °C, and the expression was induced by 0.5 mm isopropyl-o-thiogalactoside. After 6 h of induction at 30 °C, cells were harvested and resuspended in 20 mm TrisCl, pH 7.5, 300 mm NaCl, 1 mm aprotinin, and disrupted using the French press. After centrifugation, the protein was loaded on a GST affinity column. Following cleavage of the GST tag with Precision protease, eIF2γ was further purified with heparin and gel filtration chromatography. Free enzyme crystals (native and Se-Met) were grown at room temperature via hanging drop vapor diffusion against 100 mm HEPES pH 7.5, 10%(w/v) PEG 6000, 5%(v/v) methyl pentanediol, using a protein concentration of 15 mg/ml. The crystals grow in the monoclinic space group P21 with one protein per asymmetric unit (unit cell: a = 52.8 Å, b = 52.4 Å, c = 74.1 Å, β = 92.5°, diffraction limit = 2.4-Å resolution). Crystal cryoprotection was achieved by adding glycerol to a final concentration of 20% (v/v). Data Collection, Structure Determination, and Refinement—Diffraction data were measured at the SGX CAT Beamline of Argonne National Laboratory. Se-Met single wavelength anomalous dispersion (SAD) data (11Hendrickson W. Science. 1991; 254: 51-58Crossref PubMed Scopus (1019) Google Scholar, 12Rice L.M. Earnest T.N. Brunger A.T. Acta Crystallogr. Sect. D Biol. Crystallogr. 2000; 56: 1413-1420Crossref PubMed Scopus (136) Google Scholar) were collected at an x-ray wavelength corresponding to the white line of the selenium K-absorption edge. Data were processed using DENZO/SCALEPACK (13Otwinowski Z. Minor W. Methods Enzymol. 1997; 276: 307-326Crossref PubMed Scopus (38617) Google Scholar). Because of radiation induced decay, diffraction data from two different crystals were merged in SCALEPACK. All seven possible selenium sites were found using SnB (14Weeks C. Miller R. J. Appl. Crystallogr. 1999; 32: 120-124Crossref Scopus (384) Google Scholar), followed by anomalous difference Fourier syntheses with preliminary SAD phases. Definitive experimental phases were calculated at 2.35-Å resolution with SHARP (15de La Fortelle E. Bricogne G. Methods Enzymol. 1997; 276: 472-494Crossref PubMed Scopus (1797) Google Scholar), giving a final figure of merit of 0.58 for accentric reflections (Table I). After density modification, 80% of the polypeptide chain could be built into the electron density map using O (16Jones T.A. Zou J.Y. Cowan S.W. Kjeldgaard M. Acta Crystallogr. Sect. A. 1991; 47: 110-119Crossref PubMed Scopus (13014) Google Scholar). Refinement of this partial model using CNS (17Brünger A. Adams P.D. Clore G.M. Gros P. Grosse-Kuntsleve R.W. Jiang J.-S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Acta Crystallogr. Sect. D. 1998; 54: 905-992Crossref PubMed Scopus (16979) Google Scholar) and calculation of difference Fourier syntheses allowed completion of protein structure building. The current refinement model of eIF2γ consists of residues 35-437, one zinc ion, and 182 water molecules. Two regions of the polypeptide chain (residues 63-71 and 206-213) were not well resolved in the electron density map, and are presumed disordered. The working and free R factors at 2.4-Å resolution are 21.2 and 26.4%, respectively. PROCHECK (18Laskowski R.J. MacArthur M.W. Moss D.S. Thornton J.M. J. Appl. Crystallogr. 1993; 26: 283-290Crossref Google Scholar) revealed 2 unfavorable (φ,Ψ) combinations, and main chain and side chain structural parameters consistently better than average (overall G-factor = 0.2).Table IX-ray data collection and refinementResolutionReflections measured/uniqueCompleteness overall/outer shellRsym overall/outer shellaRsym = Σ|I - 〈I〉|/ΣI, where I = observed intensity, 〈I〉 = average intensity obtained from multiple observations of symmetry-related reflectionsPhasing powerbPhasing power = r.m.s. (|FH|/E), |FH| = heavy atom structure factor amplitude and E = residual lack of closureÅ%%Statistics for eIF2γData set22.0-2.35239,592/17,06199.8/99.89.4/16.62.26SAD analysis (7 sites)λ1 (0.97884Å)Figure of meritAcentric (0.58)Centric (0.25)ResolutionCompleteness overall/outer shellRsym overall/outer shellMultiplicityR-factorFree R-factorcFree R-factors were calculated with 10% of the data omitted from the structure refinementsÅ%%Refinement statisticsData with |F| > 2σ(|F|)22.0-2.498.4/84.25.8/17.160.2120.264r.m.s. deviationsdr.m.s. bond lengths and r.m.s. bond angles are the respective root-mean-square deviations from ideal values. r.m.s. thermal parameter is the root mean square deviation between the B values of covalently bonded pairsBond lengths, 0.009 ÅBond angles, 2.1°Thermal parameters, 1.3 Å2a Rsym = Σ|I - 〈I〉|/ΣI, where I = observed intensity, 〈I〉 = average intensity obtained from multiple observations of symmetry-related reflectionsb Phasing power = r.m.s. (|FH|/E), |FH| = heavy atom structure factor amplitude and E = residual lack of closurec Free R-factors were calculated with 10% of the data omitted from the structure refinementsd r.m.s. bond lengths and r.m.s. bond angles are the respective root-mean-square deviations from ideal values. r.m.s. thermal parameter is the root mean square deviation between the B values of covalently bonded pairs Open table in a new tab eIF2α Binding Analysis—Derivatives of pGEX-6P-expressing mutant forms of M. jannaschii eIF2γ were constructed by mutating the appropriate codons in the plasmid pC1399. The M. jannaschii eIF2γ-R242D and -G319I mutants were generated using the Altered Sites mutagenesis kit (Promega, Inc.) according to the vendor's protocols and the following mutagenic primers: R242D, 5′-ATGTATGTTGCAGATAGCTTTGATATCAACAAACCAGGA; G319I, 5′-AGAAAAGCTCATCCCGGGGGTTTGATTATTGTTGGGACAACA. The eIF2γ-L256D mutant was generated by PCR using the primers 5′-CCCCCCAAGCTTTGATATCAACAAACCAGGAAACTGAGATTAAGGATGACAAAGGAGGGG and 5′-CCAATCTCAGCACATATTGGAAGCTTTAATTTTATATCCGC. The PCR product was digested with HindIII and used to replace the corresponding HindIII fragment in pC1399. The eIF2γ-D325A mutant was generated by PCR using a 5′-primer containing a BamHI site immediately upstream of the codon for residue 35 and the 3′ primer: 5′-CCCCCCATGCATCTGATTTTGTTAAGTATGGGGCTAATGTTGTCCCAACCCCAATCAAAC. The PCR product was digested with BamHI and NsiI and used to replace the corresponding fragment in pC1399. All mutant and wild-type constructs were confirmed by DNA sequencing. GST-M. jannaschii eIF2γ (35-437) fusions (wild-type and mutants) and GST alone were expressed in Escherichia coli, purified by glutathione-Sepharose chromatography as previously described, and dialyzed against binding buffer (25 mm TrisCl, pH 7.5, 300 mm NaCl, 10 mm MgCl2, 5 mm dithiothreitol, 10%(v/v) glycerol). A pUC18 derivative (AMJIN75) encoding M. jannaschii eIF2α was obtained from ATCC, Inc. DNA encoding full-length M. jannaschii eIF2α was amplified by PCR using primers to insert a 5′-NdeI and a 3′-XhoI restriction site. The resulting product was subcloned into the pET28a vector (Novagen) and expressed untagged in E. coli using the protocol described for eIF2γ. The protein was purified on a heparin Sepharose column followed by dialysis against binding buffer. For binding studies, GST and GST-eIF2γ (wild type and mutants) were each immobilized on 50 μl of glutathione-Sepharose resin (Amersham Biosciences), and unbound protein removed by washing. 14 μg of eIF2α were added to 50 μl of GST-resin or GST-eIF2γ-resin mixture. Binding reactions were diluted to 100 μl with binding buffer and incubated at 4 °C for 1 h. After washing twice with 500 μl of binding buffer for 20 min, the resin was harvested by centrifugation, and bound proteins were eluted with elution buffer (50 mm TrisCl, pH 8.0, 300 mm NaCl, 10 mm MgCl2, 5 mm dithiothreitol, 20 mm reduced glutathione) and detected by SDS-PAGE electrophoresis. Yeast Strains, Plasmids, and Growth Assays—Yeast eIF2γ is encoded by the essential GCD11 gene. Yeast strains H117 (gcn2-101 gcn3-101 his1-29 ino1 ura3-52 ) and H271 (gcd11-507 gcn2-101 gcn3-101 his1-29 ino1 ura3-52 ) (19Harashima S. Hinnebusch A.G. Mol. Cell. Biol. 1986; 6: 3990-3998Crossref PubMed Scopus (59) Google Scholar) were printed to medium containing 5-flouroorotic acid to isolate the Ura- derivatives J208 (GCD11+) and J210 (gcd11-507), respectively. The high copy number URA3 plasmids carrying SUI2 (p925) and IMT4 (C50) were described previously (20Dever T.E. Yang W. Astrom S. Bystrom A.S. Hinnebusch A.G. Mol. Cell. Biol. 1995; 15: 6351-6363Crossref PubMed Scopus (109) Google Scholar). The gcd11Δ strain J212 (MATα his3-Δ1 leu2-Δ0 ura3-Δ0 gcd11Δ::KanMX p[GCD11, URA3]) was isolated as a haploid segregant from the heterozygous diploid gcd11Δ/GCD11 strain obtained from the yeast genome deletion project. Plasmids encoding GCD11 under control of the native promoter were generated by amplifying a ∼2.5-kb GCD11 fragment from yeast genomic DNA using the primers GCD11-PstI: 5′-CTAGCTGCAGCAGATCCAACCGCGGGAAGTGGC and GCD11-EcoRI: 5′-ACGCGAATTCGTCTCCATGTACAAACCACCG. The PCR product was digested with EcoRI and PstI and inserted into the single copy number URA3 and LEU2 yeast shuttle plasmids YCplac33 (pGCD11, URA3) and YCplac111, respectively. Yeast eIF2γ mutants were constructed using the Altered Sites II mutagenesis kit (Promega, Inc.) according to vendor's protocols and the following mutagenic oligonucleotides: D403A, 5′-GCTCTACACAAGGTGGGAGCAACTTTAGTACCAACACC; Y161A, 5′-GATTTCTTTATCAGATTTGAAAGATCTAGCACAATCAGGTTCGGGACATG; G397I, 5′-CAAGGTAGGATCAACTTTGGTACCAACAATAATCAGACCACCGGG; R319D, 5′-CGATTTCAGCACCTGGCTTGTTAACATCAAATGAATCAATAACAATTAACCTTGGAG;and V402A, D403A, L406A, 5′-CGACAAGACGATCAGCTCTACACGCGGTGGGAGCAGCTTTAGTACCAACACCAATCAG. The mutant alleles (∼2.5kb) were transferred to the single copy number LEU2 plasmid YCplac111 by EcoRI-PstI digestion, and then introduced into the yeast strain J212. The resulting transformants were replica plated to medium containing 5-fluoroorotic acid (5-FOA) to evict the URA3 plasmid encoding wild-type GCD11. This plasmid shuffling protocol (21Boeke J.D. Trueheart J. Natsoulis G. Fink G.R. Methods Enzymol. 1987; 154: 164-175Crossref PubMed Scopus (1083) Google Scholar) resulted in a set of isogenic strains carrying only the mutant GCD11 alleles on the LEU2 plasmid. Lethal GCD11 alleles were identified by the failure of transformants to grow on the 5-FOA medium. The high copy number HIS3 plasmid encoding SUI2 (pC1682) was generated by subcloning a ∼2.4-kb BamHI fragment from plasmid p1097 (22Dever T.E. Feng L. Wek R.C. Cigan A.M. Donahue T.F. Hinnebusch A.G. Cell. 1992; 68: 585-596Abstract Full Text PDF PubMed Scopus (569) Google Scholar) to the vector pRS423. The high copy number HIS3 plasmid encoding IMT4 (pC1683) was generated by transferring a ∼0.8-kb SalI-BamHI fragment from the plasmid p1776 (20Dever T.E. Yang W. Astrom S. Bystrom A.S. Hinnebusch A.G. Mol. Cell. Biol. 1995; 15: 6351-6363Crossref PubMed Scopus (109) Google Scholar) to the plasmid pRS423. Standard methods were used for culturing yeast strains (23Sherman F. Fink G.R. Lawrence C.W. Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1974Google Scholar). Yeast growth analyses were performed by streaking purified transformants on S.D. minimal medium supplemented with essential nutrients or on YPD rich medium. Growth rates were qualitatively determined by comparing the size of isolated single colonies in the streaks after growth at 30 °C for 3 days. Crystallization and Structure Determination—M. jannaschii eIF2γ yielded high quality crystals containing one molecule/asymmetric unit (see "Experimental Procedures"). The structure of eIF2γ was determined via SAD (11Hendrickson W. Science. 1991; 254: 51-58Crossref PubMed Scopus (1019) Google Scholar, 12Rice L.M. Earnest T.N. Brunger A.T. Acta Crystallogr. Sect. D Biol. Crystallogr. 2000; 56: 1413-1420Crossref PubMed Scopus (136) Google Scholar)(see "Experimental Procedures" and Table I for a complete description of the crystallographic structure determination and subsequent refinement.) Structural Overview—Fig. 2A shows the structure of eIF2γ, which consists of three domains (G, II, and III). Structure-based sequence alignments of various eukaryotic and archaeal homologs (Fig. 1) demonstrate that conserved residues map to the hydrophobic cores of each of the three domains, whereas insertions and deletions map to random coil portions of the structure. The remarkable level of sequence identity and the pattern of amino acid differences across phylogeny allow us to conclude that all known eIF2γs share the three-dimensional structure illustrated in Fig. 2A. The G domain (residues 1-226) consists of a β-sheet of mixed polarity flanked by 5 α-helices with overall dimensions of 36 × 44 × 29 Å and shows significant structural homology to other GTPases, with the conserved sequence elements characteristic of GTP-binding proteins (Fig. 1, G1/P loop, G2, G3, G4, and G5) (24Sprang S.R. Annu. Rev. Biochem. 1997; 66: 639-678Crossref PubMed Scopus (892) Google Scholar). Secondary structural elements are arranged in the order β1-α1-β2-β3-β4-β5-β6-α2-β7-α3-β8-α4-β9-α5 within the primary sequence. eIF2γ also contains a zinc ribbon (residues 84-107) that protrudes from the main body of the G domain, forming an overhang between the G domain and domain II. The zinc ribbon motif is formed by two β-hairpin turns, each contributing a pair of cysteines (Fig. 2B; Cys87 and Cys90; Cys99 and Cys102). The zinc ion appears to stabilize the relative positions of β-strands β3, β4, and β5, which do not make extensive hydrophobic contacts with one another. Mutation of invariant Cys155 to Ala in S. cerevisiae (corresponding to Cys87 in M. jannaschii) causes a severe slow growth phenotype (10Erickson F.L. Harding L.D. Dorris D.R. Hannig E.M. Mol. Gen. Genet. 1997; 253: 711-719Crossref PubMed Scopus (19) Google Scholar), underscoring the importance of zinc ion binding. Interestingly, in mammals three of the four cysteines are mutated to Thr and Leu. Loss of zinc binding during evolution has also been observed among transcription factor zinc-containing motifs (25Krishna S.S. Majumdar I. Grishin N.V. Nucleic Acids Res. 2003; 31: 532-550Crossref PubMed Scopus (659) Google Scholar). In these cases, the integrity of the motif is preserved by main chain hydrogen bonds and van der Waals interactions among the hydrophobic amino acids replacing the cysteines, which may be the case for mammalian eIF2γs. Hydrophobic interactions and hydrogen bonds contribute to the positioning of the zinc ribbon with respect to the main body of the G domain (Fig. 2C). Conserved Tyr93 is sandwiched between the aliphatic side chains of conserved Lys86 and Lys219, with its backbone amide hydrogen bonded to the side chain of conserved Asp215. Mutation of Tyr161 in S. cerevisiae eIF2γ to Ala (corresponding to Tyr93 in M. jannaschii eIF2γ) causes a slow growth phenotype (data not shown), underscoring the importance of preserving the integrity of the interface between the zinc ribbon motif and the body of the G domain. Domain II (residues 236-344) is a β-barrel (overall dimensions 40 × 37 × 38 Å) consisting of ten antiparallel β-strands and two 310 helices, arranged in the order β10-α6-β11-β12-β13-β14-β15-β16-β17-α7-β18 (Figs. 1 and 2A). The β-barrel is structurally similar to domain II of EF1A (pairwise α-carbon root mean square deviation (r.m.s.d.) = 1.2 Å, 27% sequence identity) and domain IV of IF2/eIF5B (pairwise α-carbon r.m.s.d. = 2.8 Å; 14% sequence identity). Both domain II of EF1A and domain IV of IF2/eIF5B have been implicated in recognition of the 3′-ends of tRNA (26Nissen P. Kjeldgaard M. Thirup S. Polekhina G. Reshetnikova L. Clark B.F. Nyborg J. Science. 1995; 270: 1464-1472Crossref PubMed Scopus (803) Google Scholar, 27Spurio R. Brandi L. Caserta E. Pon C.L. Gualerzi C.O. Misselwitz R. Krafft C. Welfle K. Welfle H. J. Biol. Chem. 2000; 275: 2447-2454Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 28Roll-Mecak A. Cao C. Dever T.E. Burley S.K. Cell. 2000; 103: 781-792Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar). Domain III (residues 347-437) is also an antiparallel β-barrel (overall dimensions 35 × 25 × 31 Å) consisting of six β-strands, arranged in the order β19-β20-β21-β22-β23-β24 (Figs. 1 and 2A). The β-barrel is structurally similar to domain III of EF1A (pairwise α-carbon r.m.s.d. = 1.2 Å, 26% sequence identity). In all GTPases for which structures of the GDP and GTP-bound enzymes are available, significant conformational changes are restricted to two polypeptide chain segments denoted Switch 1 and 2 (Fig. 1). Switch 1 is involved in interactions with effectors (in the case of eIF2, these could be Met-tRNAiMet, the ribosome and/or eIF5). Switch 1 lies at the interface between the G domain and domain II and interacts with residues from β-strand β17 stabilizing the relative orientation of the two domains. Part of Switch 1 (residues 63-71) is disordered in our structure. Switch 2 lies at the heart of the structure where it makes contacts with domains II and III. Similar Domain Arrangements in Apo eIF2γ and EF1A· GTP—Fig. 3, A and B illustrate the structures of EF1A·GTP (29Berchtold H. Reshetnikova L. Reiser C.O. Schirmer N.K. Sprinzl M. Hilgenfeld R. Nature. 1993; 365: 126-132Crossref PubMed Scopus (513) Google Scholar) and EF1A·GDP (30Kjeldgaard M. Nyborg J. J. Mol. Biol. 1992; 223: 721-742Crossref PubMed Scopus (247) Google Scholar). Residues Gly44-Gly59 of eIF2γ, forming the P loop and part of α-helix α1, are structurally similar to the corresponding regions of EF1A (pairwise α-carbon r.m.s.d. = 0.6-0.8 Å; Fig. 3D). In both cases, structural super-positions of these regions result in close overlap of the remaining nucleotide binding segments, with the exception of the switch regions. Fig. 3C also demonstrates that the spatial arrangement of the three domains in apo eIF2γ is similar to that seen in EF1A·GTP and not EF1A·GDP. In EF1A·GDP domain II is disengaged from the G domain, while in EF1A·GTP domain II is closely packed against the Switch 1 region of the G domain (Fig. 3, A and B). The orientation of the Switch 2 helix α2 of apo eIF2γ is identical to that seen in EF1A·GDP (Fig. 3D). When EF1A binds GTP (Fig. 3, A and B) the C terminus of α2 moves 7.5 Å and rotates 45°, causing domain II to rotate 90° and pack against the G domain. Thus domain coupling differs between eIF2γ and EF1A, despite high sequence conservation (22% identity; 42% similarity). The closed domain configuration of apo eIF2γ was initially seen in the structure of Pyrococcus abyssi (P. abyssi) eIF2γ (9Schmitt E. Blanquet S. Mechulam Y. EMBO J. 2002; 21: 1821-1832Crossref PubMed Scopus (89) Google Scholar) where it could have resulted from lattice packing effects (9Schmitt E. Blanquet S. Mechulam Y. EMBO J. 2002; 21: 1821-1832Crossref PubMed Scopus (89) Google Scholar). Our structure of another archaeal eIF2γ in a different crystal form confirms that apo eIF2γ adopts the closed domain configuration. We presume, therefore, that the conformational changes undergone by eIF2γ on nucleotide binding and hydrolysis differ from those seen for EF1A (Fig. 3, A-D). Domains II and III of the M. jannaschii and P. abyssi eIF2γ can be super-imposed with an r.m.s.d. of 1.2 Å (Fig. 3E). Following this superposition the G domain of M. jannaschii eIF2γ is rotated by 14° relative to its counterpart in P. abyssi, revealing a hinge region near the Switch 2 helix α2 around which domains II and III move as a rigid body. Differences in the orientation of the G domain with respect to domains II and III have also been observed among EF1A·GDP structures (31Andersen G.R. Thirup S. Spremulli L.L. Nyborg J. J. Mol. Biol. 2000; 297: 421-436Crossref PubMed Scopus (54) Google Scholar), indicating that this conformational plasticity is a common feature for these two GTPases. Interestingly, the structure of a mutant form of P. abyssi eIF2γ showed no domain rearrangements upon GTP binding (9Schmitt E. Blanquet S. Mechulam Y. EMBO J. 2002; 21: 1821-1832Crossref PubMed Scopus (89) Google Scholar), while its close homolog EF1A shows large domain movements (29Berchtold H. Reshetnikova L. Reiser C.O. Schirmer N.K. Sprinzl M. Hilgenfeld R. Nature. 1993; 365: 126-132Crossref PubMed Scopus (513) Google Scholar). This finding is surprising since it fails to explain the nucleotide dependence of the tRNA binding activity of this factor. One explanation put forth in the report describing the P. abyssi eIF2γ structures is that the other subunits of the complex are necessary for this activity (9Schmitt E. Blanquet S. Mechulam Y. EMBO J. 2002; 21: 1821-1832Crossref PubMed Scopus (89) Google Scholar). However, we have found that the mutation introduced in P. abyssi eIF2γ to obtain the structure of the GTP bound complex is lethal in S. cerevisiae (data not shown). Molecular Modeling and Functional Identification of the Met-tRNAiMet Binding Site on eIF2γ —Our structure of M. jannaschii eIF2γ provides a rational basis for directed studies of ternary complex formation. Fig. 4, B and D illustrate the solvent-accessible surface of eIF2γ color coded for amino acid conservation. The green portion of the molecular surface corresponds to surface residues that are invariant among the sequences of known eIF2γs (Fig. 1). The ventral surface of eIF2γ (Fig. 4B) shows a remarkably high level of conservation and is almost certainly responsible for interactions with conserved components of the translation machinery. The x-ray structure of EF1A in complex with GTP and Phe-tRNAPhe (26Nissen P. Kjeldgaard M. Thirup S. Polekhina G. Reshetnikova L. Clark B.F. Nyborg J. Science. 1995; 270: 1464-1472Crossref PubMed Scopus (803) Google Scholar) revealed that domain II of EF1A contributes to recognition of the 3′-end of the tRNA acceptor helix. Given the marked similarity between domains II of EF1A and eIF2γ (Fig. 3C) it is reasonable to suggest that eIF2γ interaction with the tRNA 3′-end resembles that observed in the EF1A ternary complex. Superposition of domains II of eIF2γ and EF1A in the ternary complex places the 3′-end of the tRNA in a binding pocket between the G domain and domain II of eIF2γ, and results in few predicted steric clashes, the most notable being between Phe of the Phe-tRNAPhe of the EF1A ternary complex and Leu317 of eIF2γ. The predicted tRNA binding surface of eIF2γ (Fig. 5A) corresponds to a positively charged/hydrophobic surface (Fig. 4A) that could support phosphate and/or base recognition. This model enables us to have a clearer understanding of the phenotypes of previously identified mutants and identify new residues important for tRNA recognition. Deletion of the chromosomal GCD11 gene encoding eIF2γ in yeast is lethal; however, cell viability can be maintained by a plasmid-borne GCD11 allele. As described under "Experimental Procedures," we generated the gcd11Δ strain J212 in which the essential eIF2γ function is provided from a GCD11 gene on a plasmid also containing the URA3 gene. To test the impact of eIF2γ mutations on yeast cell growth, we engineered desired mutations into a GCD11 allele on a LEU2 plasmid and introduced these mutant alleles into the strain J212. Following plasmid-shuffling, as described under "Experimental Procedures," the GCD11 mutant allele on the LEU2 plasmid is the sole source of eIF2γ. Mutations that impair eIF2γ function will be identified as causing slow growth or lethal phenotypes following plasmid shuffling. In our model of Phe-tRNAPhe bound to M. jannaschii eIF2γ (Fig. 5, A and B), the terminal adenosine and Phe of Phe-tRNAPhe project into a pocket on the surface of domain II, with the amino acid stacking against invariant Tyr79 from Switch 1 (this residue is Tyr142 in yeast eIF2γ, and Hisin E. coli EF1A). Consistent with this model, Erickson and Hannig (8Erickson F.L. Hannig E.M. EMBO J. 1996; 15: 6311-6320Crossref PubMed Scopus (84) Google Scholar) previously showed that substitution of His for Tyr142 in yeast eIF2γ caused a slow growth phenotype that could be suppressed by overexpression of (tRNAiMet, and that purified yeast eIF2 containing the mutant eIF2γ-Y142H subunit showed decreased binding to Met-tRNAi. Invariant Gly319 in M. jannaschii eIF2γ, corresponding to Gly397 in yeast eIF2γ, lies at the bottom of this putative tRNA binding pocket (Fig. 5B). Mutation to a larger residue would be predicted to result in a steric clash with the ribose of A76 of the tRNA. Fortuitously, the yeast eIF2γ Gly397 to Ala mutation was isolated previously as a mutant that derepresses GCN4 mRNA translation (gcd11-507 mutation) (32Dorris D.R. Erickson F.L. Hannig E.M. EMBO J. 1995; 14: 2239-2249Crossref PubMed Scopus (57) Google Scholar). The eIF2γ-G397A mutation causes a modest slow growth phenotype (32Dorris D.R. Erickson F.L. Hannig E.M. EMBO J. 1995; 14: 2239-2249Crossref PubMed Scopus (57) Google Scholar), and here we show that this slow growth phenotype can be fully suppressed by overexpression of Met-tRNAi, but not eIF2α (Fig. 5, C and D, upper panel), consistent with the idea that the G397A mutation decreases Met-tRNAiMet binding affinity. Furthermore, we found that mutation of Gly397 in eIF2γ to the bulkier Ile is lethal in yeast (Fig. 5C). Finally, based on the modeled tRNA binding pocket (Fig. 5B), we propose that the conserved Arg242 of M. jannaschii eIF2γ (corresponding to S. cerevisiae Arg319) contributes to tRNA binding through phosphate neutralization. Consistent with this hypothesis, we found that mutation of Arg319 in yeast eIF2γ to the negatively charged Asp is also lethal (Fig. 5C). Taken together, these results provide strong in vivo evidence that domain II of eIF2γ plays a critical role in the binding of Met-tRNAiMet to eIF2. Identification of the eIF2α Binding Site on the Molecular Surface of eIF2γ Adjacent to the Met-tRNAiMet Binding Site—In an attempt to characterize binding sites on eIF2γ for the α- and β-subunits of eIF2, we performed site-directed mutagenesis of selected conserved surface residues. Leu256 and Asp325 form part of a conserved surface adjacent to the proposed Met-tRNAiMet binding site in M. jannaschii eIF2γ (Figs. 5B and 6B). Mutation of yeast eIF2γ Asp403 (corresponding to M. jannaschii Asp325) to Ala resulted in a pronounced slow growth phenotype that was suppressed by overexpression of eIF2α, but not Met-tRNAi, consistent with defects in eIF2α binding (Fig. 5, C and D, middle panel). To directly assess the impact of eIF2γ mutations on eIF2α binding, we expressed in E. coli and purified wild-type and mutant forms of M. jannaschii eIF2γ fused to GST, and then tested the fusion proteins for the ability to pull-down bacterially expressed and purified M. jannaschii eIF2α. Consistent with the yeast mutants results, M. jannaschii eIF2γ-D325A and -L256D mutants exhibited dramatic reductions in eIF2α binding (Fig. 6A; lanes 8, 12 versus 6, 10). To further define the eIF2α binding site on eIF2γ, we generated the M. jannaschii eIF2γ-N247A/K248A/G250A triple mutant (see Fig. 6B). This triple mutation, which altered residues between the mapped eIF2α and Met-tRNAiMet binding sites, only slightly impaired eIF2α binding (data not shown), indicating that the eIF2α binding site is localized to the side of eIF2γ. The locations of mutations that affected eIF2α binding are illustrated in Fig. 6B (labeled in magenta). Despite the close proximity of the tRNA and eIF2α binding sites on eIF2γ, mutation of residues in the putative tRNA binding pocket of M. jannaschii eIF2γ (Gly319 → Ile and Arg242 → Asp) did not affect binding to eIF2α (Fig 6B; lanes 14 and 16 versus 10). However, it is possible that eIF2α enhances Met-tRNAiMet binding, as yeast eIF2 complexes lacking eIF2α show lowered Met-tRNAiMet binding (33Nika J. Rippel S. Hannig E.M. J. Biol. Chem. 2001; 276: 1051-1056Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar), and the lethal phenotype associated with loss of eIF2α in yeast is partially suppressed by overproduction of Met-tRNAiMet, eIF2β, and eIF2γ (34Erickson F.L. Nika J. Rippel S. Hannig E.M. Genetics. 2001; 158: 123-132Crossref PubMed Google Scholar). Further supporting the idea that eIF2α contributes to Met-tRNAiMet binding by eIF2γ, we found that overexpression of either eIF2α or Met-tRNAiMet partially suppressed the slow growth phenotype of a yeast strain expressing the eIF2γ-V402A/D403A/L406A triple mutant (Fig. 5, C and D). As expected, the corresponding M. jannaschii eIF2γ-L324A/D325A/L328A triple mutation blocked the binding of eIF2α to GST-eIF2γ in the pull-down assay (data not shown). Thus, whereas mutation of Asp403 in yeast eIF2γ (Asp325 in M. jannaschii) solely impairs eIF2α binding, mutation of the nearby Val402 and Leu406 (Leu324 and Leu328 in M. jannaschii; see Fig. 6B) also impairs Met-tRNAiMet binding. These results reveal that the eIF2α and Met-tRNAiMet binding sites are in close proximity on the eIF2γ surface, and they provide additional suggestive evidence that eIF2α contributes to Met-tRNAiMet binding to eIF2. In conclusion, we have determined the crystal structure of an archaeal eIF2γ that serves as the foundation of the eIF2 ternary complex on which, the α- and β-subunits and Met-tRNAiMet assemble. A combination of in vivo and in vitro studies has allowed us to locate conserved, adjacent binding surfaces for eIF2α and tRNA. Our work provides a starting point for further systematic biochemical, genetic and structural studies, aimed at understanding interactions between the eIF2 subunits, tRNA, mRNA, and the small (40 S) ribosomal subunit. At Argonne National Laboratory we thank Dr. K. R. Rajashankar for his invaluable assistance during data collection and structure determination. We thank Dr. J. B. Bonanno for his advice during structure determination, Keith Remo for his assistance with plasmid construction, and Drs. G. Blobel, B. Chait, A. Deaconescu, A. Hinnebusch, G. A. Petsko, E. Sattleger, B. Shin for many useful discussions. We also thank members of the Dever, Hinnebusch, and Darst laboratories for their support.

Initiation factors IF2 in bacteria and eIF2 in eukaryotes are GTPases that bind Met-tRNA\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} \begin{equation*}_{i}^{Met}\end{equation*}\end{document} to the small ribosomal subunit. eIF5B, the eukaryotic ortholog of IF2, is a GTPase that promotes ribosomal subunit joining. Here we show that eIF5B GTPase activity is required for protein synthesis. Mutation of the conserved Asp-759 in human eIF5B GTP-binding domain to Asn converts eIF5B to an XTPase and introduces an XTP requirement for subunit joining and translation initiation. Thus, in contrast to bacteria where the single GTPase IF2 is sufficient to catalyze translation initiation, eukaryotic cells require hydrolysis of GTP by both eIF2 and eIF5B to complete translation initiation.

Translation factors are thought to accelerate the rate ofprotein synthesis and/or increase the fidelity of the process. In addition, the positive contributions of translationfactors to cellular protein synthesis provide a means toregulate this process in response to cellular or environmental cues. Along with the requirement for factors to facilitate translation elongation, a distinct set of factorshave been identified that promote assembly of a functional ribosome•mRNA•initiator Met-tRNAiMet complexin which the anticodon of the Met-tRNAiMet and the AUGcodon of the mRNA base-pair within the ribosomal P site.Whereas three translation initiation factors (IF) have beenidentified in prokaryotes, translation initiation in eukaryotes requires at least 12 independent factors (Fig. 1) (forreview, see Hershey and Merrick 2000). In addition, GTPis an essential requirement for translation in bothprokaryotes and eukaryotes. Although biochemical andgenetic analyses have provided insights into the roles ofthe translation initiation factors, the precise molecularfunction for most of these factors has not been resolved...

The protein kinase PKR (dsRNA-dependent protein kinase) phosphorylates the eukaryotic translation initiation factor eIF2alpha to downregulate protein synthesis in virus-infected cells. Two double-stranded RNA binding domains (dsRBDs) in the N-terminal half of PKR are thought to bind the activator double-stranded RNA, mediate dimerization of the protein and target PKR to the ribosome. To investigate further the importance of dimerization for PKR activity, fusion proteins were generated linking the PKR kinase domain to heterologous dimerization domains. Whereas the isolated PKR kinase domain (KD) was non-functional in vivo, expression of a glutathione S-transferase-KD fusion, or co-expression of KD fusions containing the heterodimerization domains of the Xlim-1 and Ldb1 proteins, restored PKR activity in yeast cells. Finally, coumermycin-mediated dimerization of a GyrB-KD fusion protein increased eIF2alpha phosphorylation and inhibited reporter gene translation in mammalian cells. These results demonstrate the critical importance of dimerization for PKR activity in vivo, and suggest that a primary function of double-stranded RNA binding to the dsRBDs of native PKR is to promote dimerization and activation of the kinase domain.

The interaction of FtsZ with itself, GTP, and FtsA was examined by analyzing the sensitivity of FtsZ to proteolysis and by using the yeast two-hybrid system. The N-terminal conserved domain consisting of 320 amino acids bound GTP, and a central region of FtsZ, encompassing slightly more than half of the protein, was cross-linked to GTP. Site-directed mutagenesis revealed that none of six highly conserved aspartic acid and asparagine residues were required for GTP binding. These results indicate that the specificity determinants for GTP binding are different than those for the GTPase superfamily. The N-terminal conserved domain of FtsZ contained a site for self-interaction that is conserved between FtsZ proteins from distantly related bacterial species. FtsZ320, which was truncated at the end of the conserved domain, was a potent inhibitor of division although it expressed normal GTPase activity and could polymerize. FtsZ was also found to interact directly with FtsA, and this interaction could also be observed between these proteins from distantly related bacterial species.