Introduction. Cladribine is regarded as the first treatment of choice of symptomatic hairy cell leukemia (HCL) patients, as it is able to provide high rates of response and very long duration of remission in some cases. Methods. Disease-specific patients records have been reviewed at four European centers of excellence in the treatment of HCL (Bologna, Italy; Caen, France; London, United Kingdom, and Lodz, Poland) and all patients requiring treatment who received frontline cladribine have been extrapolated for analysis. Responses have been classified according to the Consensus Resolution Criteria published in 1987. The main study objectives were represented by long-term overall survival (OS), disease-free survival (DFS) and progression-free survival (PFS) rates. PFS calculation involved all patients obtaining at least a partial response; DFS was determined only in patients with a complete response (CR) after treatment. Determining events for DFS and PFS were disease progression (decline in hematologic parameters, reappearance of marrow infiltration and/or organomegaly), initiation of a subsequent treatment, death for any cause. Results. Three hundred and eighty-four HCL patients (including 3 patients with HCL variant) have been diagnosed and followed between 1969 and 2018, and all of them received frontline cladribine (either subcutaneously or intravenously, according to era- and site-specific guidelines and experience). A CR was obtained in 150 cases (39.1%), a partial response in 50 (13.0%) and a minor response in 7 (1.8%). Two hundred and eight patients (54.2%) received no further therapy besides cladribine as they did not require further treatment for their disease. A continuous CR was documented in 76 patients (19.8%), at a median follow-up period of 8.5 years (range, 1-22 years). Median OS was reached at 25.0 years, with 48.3% of patients being alive at 28 years. Median PFS was 13.0 years, with 43% of patients being free of progression at 22 years. DFS was 26.5% at 22 years, with median reached at 11 years (Figure). Retreatment with cladribine in relapsed patients occurred in 106 cases. Keywords: Lymphoid Cancers - Other No conflicts of interest pertinent to the abstract.

Background:Chronic lymphocytic leukemia (CLL) has a strong genetic component, evidenced by an eight‐fold increased risk to develop CLL in relatives of CLL patients. Genome‐wide association studies (GWAS) have provided evidence for inherited predisposition to CLL, identifying 42 (non‐HLA) genomic regions influencing CLL risk. However, efforts to define the mechanisms mediating the risk at these, largely non‐coding, loci have been constrained by a lack of integrated genome‐wide data in large CLL series.Aims:We aimed to refine the gene regulatory mechanisms and biological significance of CLL risk loci.Methods:We (i) analysed high‐resolution chromatin state maps of primary CLL samples, (ii) integrated genetic, epigenetic and transcriptomic data in up to 452 primary CLL cases by quantitative trait loci (QTL) analysis, (iii) performed in silico transcription factor (TF) binding analysis using motifbreakR and (iv) studied the three‐dimensional (3D) chromatin structure of normal B cells and CLL using promoter capture Hi‐C data.Results:Eighty‐one percent of the 42 genomic risk loci were enriched for active regulatory elements (active promoters and enhancers) in CLL, suggesting a specific regulatory role for these loci in CLL pathogenesis. Additionally, at 18 risk loci we detected regulatory regions showing genotype dependent levels of genome activity (H3K27ac QTLs) and chromatin accessibility (ATAC‐seq QTLs) in primary CLL cases. Moreover, within these QTLs, we defined 60 potential functional variants underlying genetic CLL predisposition.Next, we focused on the underlying biological mechanisms through which genetic variants at CLL risk loci shape the regulatory genome by performing in silico TF binding analysis. We observed that genotypes associated with higher risk to develop CLL, among others, resulted in decreased binding affinity for B‐cell related TFs and increased affinity for FOX, NFAT and TCF/LEF TF family members. Thus, our findings point towards a regulatory role for these TFs in CLL predisposition.Thirdly, to infer the biological significance of CLL risk loci, we identified 36 genes that showed genotype dependent gene expression levels (eQTLs) in primary CLLs. These represent the potential target genes through which CLL risk loci mediate their effect and affected pathways known to be involved in CLL pathogenesis such as immune response, Wnt signalling and apoptosis. Interestingly, the eQTLs included new genes, such as TLE3, that have not been associated with CLL risk before. Lastly, we observed significant 3D chromatin interactions in CLL and normal B cells between the risk loci and 15 eQTL gene loci, highly suggestive for direct regulatory links between the risk loci and expression of these genes in relation to CLL predisposition. Importantly, these analyses showed that CLL risk loci not necessarily affect expression of the nearest gene but may mediate their effect in a more distant fashion, as shown for UBR5, due to long‐range 3D chromatin interactions.Summary/Conclusion:By (i) characterising the potential functional variants that influence the risk to develop CLL, (ii) defining the regulatory elements and the TFs that play a role in mediating the effect of genetic variation at the CLL risk loci and (iii) determining the downstream genotype‐dependent effects on expression of both proximal and distant target genes at these regions, we offer improved insights into the functional and biological basis of CLL predisposition.

Patients with a Memory-like DNA Methylation Signature exhibit long-term survival after first-line immuno-chemotherapy : Data from the UK CLL4, ARCTIC and ADMIRE trials

In chronic lymphocytic leukemia (CLL), 'coding' NOTCH1 mutations were initially detected in exon 34, where they result in truncation of the C-PEST regulatory protein sequence, with consequent impaired degradation of the Notch1 intracellular domain (NCID), constitutive activation of Notch signalling and increased cell survival and resistance to apoptosis 1-3 .Mutations occur in 6-10% of cases at diagnosis, with increasing prevalence in advanced disease stages, treatment-refractory disease, and after transformation to Richter syndrome 4,5 .In diagnostic and clinical trial cohorts, patients with NOTCH1 mutations exhibited reduced survival 5,6 .In 2015, Puente and colleagues identified recurrent 'non-coding' mutations clustered to the 3' UTR of NOTCH1 in 2% (11/506) previously untreated patients with CLL or monoclonal B-cell lymphocytosis 7 .The presence of these 3'UTR mutations cause a novel splicing event, preferentially between a cryptic donor site located in the last exon and a newly created acceptor site in the 3'UTR of exon 34, resulting in the removal of the PEST sequence and constitutive activation of downstream signalling 7 .Patients with noncoding NOTCH1 mutations had similar outcomes to those with coding mutations, with shorter time to first treatment and shorter overall survival than wild type cases 7,8 .Given the highly variable natural history of CLL and the often-serendipitous date of initial diagnosis, we aimed to establish the clinical significance of non-coding NOTCH1 mutations in DNA samples available from 489 patients at enrolment to the United Kingdom Leukemia Research Fund Chronic Lymphocytic Leukemia 4 (UK LRF CLL4) chemotherapy trial 9 .NOTCH1 3' UTR mutations were identified by High Resolution Melt (HRM) analysis in whole genome amplified DNA (F: TGCTCGTTCAACTTCCCTTC; R: CAAGCAAGTTCTGAGAGCCA) and confirmed by Sanger sequencing of genomic DNA (F: CCTAACAGGCAGGTGATGCT; R: ATCTGGCCCCAGGTAGAAAC) The results were combined with the data pertaining to coding NOTCH1 mutations in the same patient cohort from our previous publication 5 .53 patients with wild-type HRM traces were sequenced, and no additional non-coding mutations were identified.It is was not possible to differentiate between clonal and sub-clonal NOTCH1 mutations using our HRM/Sanger approach.We defined associations between the presence of NOTCH1 coding and non-coding mutation and a comprehensive panel of clinical and biological features reported in previous CLL4 papers [10][11][12][13] , by univariate logistic regression.Kaplan-Meier, log-rank test and Cox regression analysis were used to assess the impact of NOTCH1 status on survival using Stata, where overall (OS) and progression-free (PFS) survival were defined as time from randomization to death from any cause and to relapse needing treatment, progression or death from any cause at last follow-up, respectively.In addition to exon 34 coding mutations observed in 47/489 (9.6%) CLL4 patients, we detected an additional 11/489 (2.2%) patients harbouring the non-coding mutations 139390152 A>G (n=7) and 139390145 A>G (n=4) (Figure 1A), both previously reported to result in aberrant NOTCH1 splicing 7 .Importantly, the non-coding variants were mutually

Telomere erosion and fusion play an important role in the pathology of many common human malignancies including CLL. 1,2 Previous studies in CLL have shown that short telomeres defined on the basis of the median value or receiver operating characteristic (ROC) analysis are associated with unmutated IGHV genes, poor risk genomic abnormalities, genomic complexity and high expression of CD38, CD49d, and ZAP70 whereas long telomeres are associated with increasing IGHV mutational load, isolated deletion of 13q and low CD49d expression.][5][6][7] However uncertainties about the most clinically relevant measure of telomere length, the optimal choice of assay, the need for assay standardisation and the lack of published data on the prognostic value of TL in patients entered into randomised trials have hindered the implementation of TL measurement into routine clinical practice.We have attempted to address these issues by measuring telomere length using monochrome multiplex Q-PCR (MMQ-PCR) in 384 patients at randomisation into the UK LRF CLL4 phase 3 chemotherapy trial (Table S1), of whom 111 samples were also screened by single telomere Users may view, print, copy, and download text and data-mine the content in such documents, for the purposes of academic research, subject always to the full Conditions of use:

Chronic lymphocytic leukemia (CLL) is the most common form of lymphoid malignancy in Western countries 1 .][4][5][6] Current projections for the number of independent regions harbouring common variants that are associated with CLL suggest that additional risk loci conferring modest effects should be identified by the expansion of discovery GWAS data sets. 2 In this study, we have made use of a meta-analysis of GWAS data, followed by validation in multiple independent case-control series, to identify a novel susceptibility locus for CLL at 12q24.13.

Although chronic lymphocytic leukemia (CLL) is characterized by a strong familial risk, the genetic basis of inherited susceptibility to CLL is largely unknown. The increased risk of Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL) in relatives of CLL patients suggests a common etiology to B-cell lymphoproliferative disorders (LPDs) through HLA variation. Moreover, as B-cell proliferation is part of an adaptive immune response, which can be initiated by major histocompatibility complex (MHC)-restricted T-cell activation, a possible influence of HLA on CLL pathogenesis is plausible.

Review on Classification of T-cell disorders, with data on clinics, and the genes involved.

Chronic lymphocytic leukaemia (CLL) is a heterogeneous disease with variable clinical presentation and disease evolution. As somatically-acquired genetic lesions, such as those targeting TP53 and ATM, are known to contribute to pathogenesis, it is highly probable that additional genetic alterations remain to be identified. Indeed, recent whole genome/exome sequencing has identified several novel recurrently mutated cancer genes in CLL, most notably NOTCH1 and MYD88, where mutations occur at frequencies of up to 12 and 3% respectively. These studies have suggested that the presence of a NOTCH1 mutation represents an independent marker of poor clinical outcome. However, the clinical significance of these mutations has not been validated in the context of a phase III clinical trial. To investigate the frequencies and clinical importance of mutations in NOTCH1 and MYD88 we screened a large cohort of previously untreated CLL cases using a combination of KASPAR genotyping and fragment analysis followed by variant confirmation with Sanger sequencing. This rapid approach is ideal as the vast majority of mutations reported in NOTCH1 and MYD88 are the recurrent P2515Rfs (deltaCT 7544-7545) and L265P sequence variants respectively. In total, we produced successful mutational data on 867 cases; 399 cases were sampled from Stage A CLL cases at diagnosis and 468 samples were taken at the time of entry on to the UK CLL4 treatment trial. For the 141 samples analysed by both techniques, the genotyping concordance rate was 100%. Using this approach we identified 47 patients with NOTCH1 mutations. We confirmed the low frequency of NOTCH1 mutations in diagnostic CLL samples (3% at diagnosis vs. 8% at progression, P = 0.006). We also confirmed the association between the presence of a NOTCH1 mutation and an un-mutated IGHV status (P = 0.003). This clinical importance of NOTCH1 mutations was further supported by a significant association with positivity for CD38 (P < 0.001) and ZAP70 (P < 0.001). Furthermore, a NOTCH1 mutation was associated with the absence of a del(13q) (P = 0.02) and lack of trisomy 12 (P = 0.001). In the total cohort, we confirm the association between a NOTCH1 mutation and reduced overall survival (107 v 161mths, P = 0.02) and we show a reduction in time to first treatment (23 v 81mths, P = 0.044). In the context of the CLL4 trial, we identified a trend towards reduced progression-free survival (26 vs. 36mths, P = 0.09). We show that MYD88 mutations are rare in both cohorts; we identified four mutations in our CLL4 cohort and an additional two mutations in our early Stage A cases. All the MYD88 mutations were in the IGHV mutated subgroup (P = 0.002). Due to the low number of MYD88 mutations, we were underpowered to identify any association with clinical outcome. Here we provide important validation of the frequency and clinical implications of NOTCH1 and MYD88 mutations in the CLL4 trial and in diagnostic Stage A CLL. We confirm the preliminary observations emerging from ongoing whole genome sequencing initiatives, and show novel associations with established biomarkers and progression free survival. This data will help establish the potential utility of NOTCH1 and MYD88 mutations as novel biomarkers for the improved management of CLL patients.

•These updated ESMO Clinical Practice Guidelines provide key recommendations on the management of chronic lymphocytic leukaemia (CLL)•Authorship includes a multidisciplinary group of experts from different institutions and countries in Europe•Recommendations are provided, including levels of evidence and grades of recommendation where applicable•Prognosis and treatment decisions in CLL depend on genetic and clinical factors including age, stage and comorbidities•Therapies targeting B-cell receptor pathway or defect mechanism of apoptosis induce long lasting remissions